Hii bestie!! Can i request a blurb idea?? Like H has a friend who is very flirty with H nd whenever reader said something about that girl H saying like no she just being friendly nd reader is really insecure nd H found out that girl is really mean to reader too, so he confront that girl nd then he console reader that she is only girl for him!! (So sorry for this long idea no pressure about writing this)
Nd I love all your lil stories ahh I'm obsessed!💗
noo lovie don't apologize! thank you for sending this in!
nothing but you
words: 1.4k+
warnings: mentions of jealousy, insecurities, cursing, crying, kissing. some inappropriate behaviour.
♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡
"Mmm, you look so good today, Harry," Emma purred, letting her hand trail down Harry's arm as he walked into class.
Y/N frowned from her seat across the room, watching the shamelessly flirtatious interaction between her boyfriend and his friend. Emma was constantly touching Harry or making suggestive comments, and it made Y/N's insides twist with jealousy and insecurity.
"Thanks, I guess?" Harry said awkwardly, gently removing Emma's hand from his arm as he took his seat next to Y/N. He leaned over to give his girlfriend a quick peck on the cheek. "Morning, babe."
Emma rolled her eyes dramatically at the affectionate gesture. "Oh please, get a room you two," she commented with a fake gag.
Y/N felt her cheeks flush with embarrassment and irritation. She reached under her desk to give Harry's hand a squeeze, needing the reassuring contact.
After class, Emma sidled up to Harry as they walked down the hallway together. "So Harry, I was thinking we could go over that English lit homework tonight? Maybe grab a bite to eat too, make a nice study night of it?"
She fluttered her eyelashes at him coyly. Y/N felt a flare of jealousy in her chest as she walked slightly behind them. She knew Emma's "study nights" with Harry were really just thinly veiled attempts to monopolize his time and flirt relentlessly.
"Oh um, I can't tonight actually. Y/N and I had plans," Harry replied, gesturing to Y/N hovering nearby. He draped his arm casually around her shoulders, pulling her in close.
Emma's perfectly plucked eyebrows raised skeptically. "You two seem to have an awful lot of 'plans' lately. Hmm, well let me know when you have a free night for your friend Emma again, 'kay Harry?" She blew him an air kiss before sashaying off down the hallway.
Y/N scowled after her retreating figure as Harry pressed a kiss to her hair. "Don't let her get to you, babe. You know I only have eyes for you."
"I know, I know," Y/N sighed, leaning into his side. "I just can't stand how disrespectful she is towards our relationship. She flirts with you constantly, even right in front of me!"
Harry frowned, hating to see her so upset and insecure. "Hey, you're right, that's not cool of her at all. Let me talk to Emma and set her straight, make it clear her behavior is out of line."
Y/N managed a small smile at that, feeling a little better that Harry was taking her concerns seriously. "Okay, thanks love. I don't like making things awkward or uncomfortable, but that girl just has no boundaries."
Over the next few days, Y/N tried her best to brush off Emma's suggestive comments and blatant flirting whenever she was around Harry. She trusted that Harry was loyal and committed to her. But it was still hard not to feel a prickle of jealousy and hurt whenever Emma ran a hand through Harry's hair or giggled over-dramatically at his jokes.
Things came to a head one day at lunch when Emma plopped herself down on Harry's lap in the middle of the cafeteria, throwing her arms around his neck.
"You're just so strong and cuddly, Harry. Don't you two make the cutest couple?" she said with a saccharine smile, shooting Y/N a smug look.
Harry looked bewildered and vaguely uncomfortable as he gently tried to disentangle Emma's limbs from around him. "Uh Emma, what are you doing? You know I'm dating Y/N…"
"Oh don't be like that, silly! I'm just being a friendly, affectionate pal," Emma insisted with a giggle, snuggling even closer.
Y/N had had enough. She stood up abruptly, slamming her hand down on the table as tears burned in her eyes. "That's it! You need to stop with this inappropriate, gross behavior right now Emma! Can't you see how awful and disrespectful you're being?"
Harry's eyes widened in surprise at Y/N's outburst, her hurt and jealousy finally bubbling over. Emma at least had the decency to look vaguely sheepish as she reluctantly slid off Harry's lap.
"Woah, okay sorry…didn't realize I was making you so upset Y/N. I was just messing around," Emma said with an exaggerated pout.
"No, you weren't just messing around! You're always all over my boyfriend, making comments, touching him without any boundaries! It's humiliating and awful, and you need to stop right now," Y/N said fiercely, angry tears spilling down her cheeks.
She grabbed her bag and stormed out of the cafeteria, needing to get away before she completely lost it in front of everyone. Harry watched her go with a pained expression before turning to Emma with barely concealed fury.
"What the hell is wrong with you, Emma? Did you really think it was okay to continuously disrespect my relationship like that? Y/N is my girlfriend - the love of my life! And you've just been relentlessly trying to make her jealous and upset this whole time?"
Emma at least had the decency to look slightly abashed, though she quickly tried to cover it with a nonchalant shrug.
"Oh come on Harry, we were just having a bit of fun! You know I'm an affectionate person, no need to read into it so much."
"Fun? Fun?!" Harry sputtered incredulously. "You've been purposely trying to make the girl I love feel horrible about herself, all because you can't handle the fact that I'm not interested in you like that!"
He shook his head in angry disbelief, running a frustrated hand through his hair. "You know what, I think we both need to just cool off right now before I say something I might regret. But you seriously need to reevaluate how you've been acting before I'm willing to even try being your friend again."
With that, Harry stood up and hurried out of the cafeteria to go find Y/N, leaving Emma looking uncharacteristically flustered behind him.
It took a bit of searching, but Harry finally found Y/N tucked away in a quiet corner of the library, trying to hide the fact that she'd been crying. He felt like a total jerk for letting Emma's behavior go on for so long without calling her out on how much it was hurting Y/N.
"Y/N? Oh babe, hey…" Harry said softly, crouching down next to where she was curled up. He gently brushed away the tears on her cheeks with his thumbs, cradling her face in his hands.
"I am so, so sorry for letting Emma treat you like that," he said, staring into her eyes intently. "It was inappropriate as hell, and you were right to call her out. I should've shut that shit down ages ago instead of brushing it off as harmless flirting."
Y/N gave a small sniffle, leaning into his warm touch as she stared back at him with shimmering eyes. "I-It's okay, it's not your fault. I know you'd never cheat or purposely hurt me. It's Emma who has the problem, not you."
"Still," Harry insisted, brushing his lips across her forehead. "I hate that I made you feel so insecure or like I wasn't a hundred percent committed to you. The truth is, you're the love of my life, Y/N. My soulmate. I never want to be with anyone else, ever."
Y/N felt her breath catch in her throat at his earnest declaration. She searched his eyes, finding nothing but absolute sincerity reflected back at her. A small smile tugged at the corner of her lips.
"Yeah? The love of your life, huh?" she teased lightly, feeling some of the tension easing out of her body.
Harry grinned crookedly at her, leaning in to nuzzle his nose against hers. "Mmhmm, without a single doubt in my mind. And don't you ever let Emma or anyone else make you question how special and amazing you are to me."
He kissed her then, slow and deep, putting every ounce of his feelings into the embrace of his lips on hers. When they finally pulled apart, Y/N felt slightly dazed and giddy, all her previous hurt and anger towards Emma momentarily forgotten.
"I love you so much, Harry," she whispered, resting her forehead against his.
"And I love you," Harry murmured fervently. "More than you'll ever know, my gorgeous girl."
♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡~~~♡
tell me if you like this! please reblog or comment if you like, it makes my heart happy :)
feedback | masterlist
taglist: @freedomfireflies @gurugirl @thechaoticjoy @styleslover-1994 @gem1712 @ellaorchard @bxbyysstuff @opheliaofficial07 @rafaaoli @tchlamqtsgf @the-mouse27 @indierockgirrl @vrittivsanghavi @walkingintheheartbreaksatellite @drewrry @babyiamperfectforyou @me-undiscovered @tbsloneely @whoreonmondays @kathb59 @avalentina @kittenhere @speedywritingharrystylesjudge @mypolicemanharryyy @theendx888 @ladscarlett @daphnesutton @youcan-nolonger-run @prettythingsworld @chesthairrry @harryhitties @becauseheartsgetbroken-hs @hisparentsgallerryy @storyschanging @selluequestrian @islakp217 @swiftmendeshoran @princessaxoxo @tenaciousperfectionunknown @hermoinelove @chronicallybubbly @angeldavis777
162 notes
·
View notes
Arranged Marriage
(Part 01 / ?)
(Niko Omilana x f! reader)
Warnings : None
Summary : In order to be the grateful daughter, you have to comply with your father's request. But what is it?
"WHAT!?!!?", you stand up abruptly, question whether you had misheard the sentence.
"Y/n, you're gonna listen to your father, we're not going to argue over something as trivial as this". Your stepmum, Ryona, interjects rudely as she pulls a chair and sits down.
"TRIVIAL?", you exclaim.
Why did she care, you ask? Nope, I don't know either.
"Dad, why are you doing this? I mean give me a proper reason at least. You can't spring up a topic this serious and tell me to go with it." You try pleading with your dad, but he remains unfazed at your outburst.
"We've always wanted the best for you y/n. I've given you everything you wanted, done everything you asked me to. And when I tell you to say yes... You question me as your father?"
Your eyes drop to the floor. It was true. Your father was an amazing man and an even better parent. A sense of shame crawls through your spine as you realise just how much you owe him. He had done so much for you, yet you couldn't agree to one thing he had asked?
"Dad please, this is so stupid. I don't want to be married right now. I just started my career-", you reason.
"Making little videos isn't a fucking career, Y/n. Maybe you're pulling a few hundred dollars here and there, but that doesn't mean that this is a stable job. Do you even know how embarrassing it is to tell people that our daughter makes 'videos' on the internet. I mean even the phrasing of it is absolutely hysterical and shameful!" Ryona finishes her comment with a quick glance at her husband, motioning for him to speak.
"Y/n, please... ", Your dad looks at you with hopeful eyes. What you failed to notice was how that man's eyes filled up with tears as you sighed and started walking towards your room.
.
.
.
The following week was uncomfortable. Whenever you came down for breakfast, they'd stop talking. They'd drop whatever the hell the were doing and wander off somewhere else. I mean, you were used to Ryona pulling shit like this all the damn time, but not your dad.
He avoided you like the plague. This had gone to such an extent that the old man couldn't bear to be in the same room with you, avoiding your eyes everytime you tried to speak.
Perhaps it was how they treated you, or perhaps how that bizarre idea had implanted itself into your head. You weren't interested in anyone, and god forbid to say that you didn't have any personal goals to hit. You'd love to have a family, you'd love to have someone at home, just for the sake of it. You'd build the family you could never get as a child.
But how?
The were talking about marrying you off.
Or that's how you heard it.
Yeah, Definitely marrying you off.
But how does an option like that sound so much better than living in this hell hole.
Fucking hell.
It's been one month, that your dad and your stepmum have completely iced you out.
.
.
.
"I'll do it". You state, matter of factly, raising an eyebrow as your 'parents' turn towards you. They weren't gullible, they knew what you wanted to say.
"Y-you'll marry him? You'll marry Nikolas!", Your dad pulls you into a bone-crushing hug which you don't return. How could he be so happy at the thought of his wife sending their child away to a man they don't even know.
Well, they know him. You don't.
He's the son of your dad's bestfriend. Of course the know each other to an extent.
Whatever.
You had dug your own grave, might as well get it over with.
"But, I can't just say that I'll get married to him? He has to agree in order-".
"The boy has agreed a month ago. It was YOU who kept stalling the wedding. How long were you planning on doing this? Don't you see that we have an image to maintain? Now stop your wailing and mentally prepare yourself. You'll both get married in a week's time. I'm calling the Omilanas and confirming". Ryona makes herself very clear, making it painfully obvious that they were going to get you married forcefully if you didn't agree otherwise. Or else how could they manage a whole venue within such an acute time frame?
You nod weakly and head back upstairs, feeling defeated. Your future was written already, your yes meant NOTHING.
.
.
.
You've heard of him. He's big on YouTube, people in his comments often ask him to collab with you. You'd be lying if you said your comments said otherwise.
Oh how'd the internet would have an absolute field trip if they found out that their two favorite creators were about to me married.
Well....married for the sake of marrying.
Married for the sake of a title.
Married for the sake of your father.
You look at the dress and accessories you had picked out and sigh into your hands. It was happening.
Your wedding........... was tomorrow.
33 notes
·
View notes
Ughh I’ve been hyperfixated on the 3 Star Fam for months and I just gotta say.. there’s no where near enough content for them.
Well you know what they say, if you want something done, gotta do it yourself 🙄
So fuck it, 3 star fam art requests are ✨open✨
Please nothing too gory or weird. I’ll do fluff, I’ll do hurt/comfort, I’ll even do angst if it’s not too depressing. And yes I’ll even take a crack at *glitchtrapped 3 stars* too with Vanny and Rab if yall want. I’m just desperate at this point 😭
12 notes
·
View notes
Hi!!!! Okay, first of all, I'm in love with your writing!!!!!! 💕💕💕💕And I was wondering (I've never done a story request so if it is horrible, please just ignore it 😅) but I was wondering if you could write a story of maybe yandereboyfriend/friend jungkook kinda forces older (not heaps but like 2-5 years older but shes just shy and confused when it comws to sex and intimacy) reader to loose her virginity to him and she likes it at the end?? If this is super uncomfortable, please don't even think about it 😅😶🌫️👉👈 or if you wanna do something completely different, I'd love your writing anyways!!!! 💕💕💕💕💕
hello! yes I can :) thank you for sending a request and being so patient! i feel like this yandere is more light than the usual lol
best friends!
jungkook doesn't like the idea of you wanting to loose your virginity to anyone that wasn't him.
@momnomnom @sweetempathprunetree @darkuni63 @minshookie29
idol version
word count: 6.100
warning: naive/shy reader, mentions of watching porn, childhood friends jungkook + reader, smut scenes, coercion, masturbation, manipulation, light yandere tedancies, jealous jungkook, dub-con moments, dry humping, kissing, nipple sucking, oral sex, loss of virginity, rough sex, dacryphilia, fingering, unprotected sex, spitting,
“You’ll never be able to seduce a man, Noona.” Jungkook laughs boisterously, causing your face to heat up. “You’re just too shy.”
Jungkook’s eyes watch as your arms cross over your chest, any self-confidence you had slowly falling. He hums, turning over on his bed to face you. He then places a hand on your thigh. “Noona…”
“Stop calling me that, Jungkook.” you murmur. He knows that you prefer to be called by your name, but he’d often ignore you because of how much he enjoys teasing you, even after years of friendship.
“You’re upset with me.” says Jungkook.
“I’ve stopped calling you Kookie like you asked.”
Jungkook snorts. “That’s because the nickname doesn’t fit me anymore. I’m a man.” his hand squeezes your thigh. “Besides, I said stop calling me that in public. You and I are alone now.”
You and Jungkook have been friends since childhood, your father and his being great friends. The age difference never bothered you as much, and you’d often recall calling Jungkook your baby brother during his primary and middle school days - you having been homeschooled. It was when Jungkook grew in size and age and reached High School did he demand you stop calling him that but never gave a reason as to why.
Even now, as Jungkook and you are adults, the friendship remains. You went to him for whatever you thought you needed and he was there. Moving away from your father had been a big step and finding a job to support yourself was even bigger, but you were never truly alone because you had Jungkook - you and he living together.
Jungkook was the opposite of you. While your job consisted of you being home, he wasn’t. He made friends easily while you remained with a close knit circle. He was more social when needed and you often closed up around people you didn’t know. Most of your friends were Jungkook’s friends that he considered brothers - you recall asking him why he considered them family and not you. Jungkook didn’t give you any reason, stating that you’d never be a sister in his eyes, no matter if he knew you longer or not.
Now you and Jungkook lay in his bed, an action that he insisted on every so often, and watched tv. He’d often hold you, his breath tickling your ear with how close he was. A certain thought now laid on your mind and when you brought it up to Jungkook, his initial thought was to laugh at you.
“I didn’t mean to hurt you, Y/N.” Jungkook sighs. He pushes himself closer to you, the hand on your thigh firmly keeping you in place. “It’s just…you don’t go out much. You’ve been homeschooled your entire life and you don’t really have friends besides the ones I have.”
Jungkook continues. “You literally cried the first time I showed you porn.” he tries his hardest not to laugh at the memory of you and he, both in High School. You had come over to his home while his parents were working. Jungkook had asked you about it randomly, and when you insisted that you never watched something as normal as porn, he insisted that you and he watch together.
You’re flushed with heat at the embarrassing memory. “You…” you take a deep breath so your voice wouldn’t crack. “You told me it was just sex.”
“Is it not?” Jungkook knits his brows.
“They were crying!”
“In pleasure.” says Jungkook. “I should have started you off easy and not gone into bondage.” low, he begins to laugh. It’s a memory that he’s fond of. “But I don’t regret showing you either. It was the first time you came!”
A memory you wished Jungkook would forget - and stop bringing up. That same night he insisted on teaching you about masturbation, telling you that it was normal. You’ve never done so before, feeling weird about it all together, but Jungkook wouldn’t allow you to leave until you at least gave it a try.
“You even cried in pleasure.”
Jungkook closes his eyes, the scene flashing in his mind. How innocent you appeared, completely confused on what in the world you were doing. It was then did Jungkook tell you that he’d talk you through it. It took a half an hour of convincing, of course. Getting you out of your pants, then your underwear.
“Open your legs, Y/N.” Jungkook had said, grabbing your wrist. “Put your fingers right…there.” he places them onto your clit and you flinch at the feeling. “Then rub…” he murmured, his hand coaching you to rub until you got the hang of it.
Jungkook will never forget the sight and how hard he was at just watching you. Your breathing hitching, the low moans and the calls of his name. It’s a memory he cherishes with you - his best friend - and one of the main reasons as to why he’d never call you his sister; he had to dead that immediately afterwards.
“Who are you trying to seduce anyways?” Jungkook changes the subject and goes back to the original topic. “You found yourself a boyfriend?”
“No.” you quip. “I-I just want to have sex.”
Jungkook raises a brow. “Why?”
“You have sex all the time.” you retort. You didn’t like Jungkook’s question, nor the look in his eyes.
“I’m also not a virgin.” Jungkook fires back. “You can’t just have sex with anyone, Y/N. Don’t you think it has to be special?”
“Your first time wasn’t with anyone special.” you murmur. “Do you even talk to her anymore?”
Jungkook snickers. “Don’t remember her name.” he shrugs. “But you and I are different. Sex is different for women.” Jungkook says matter-of-factly. “You women create bonds with guys you give your body to. You can’t have that bond with just anyone.”
It was a conversation Jungkook and you had time and time again. As you got older, you were tired of being a virgin - and dating was never an option. Not because you couldn’t find a boyfriend - you could. You had men come up to you asking for your number and if you’d be interested in going on dates.
The problem was Jungkook. He lingered around you often, and you never minded. He was your best friend and each man that tried were always shot down by him, not you. “He’s ugly.” Jungkook said about one man. “He looks like he doesn’t even shower, Y/N. Why he thinks he can speak to you is beyond me.” was said about another. “Men only want one thing. They can tell that you’ve never been touched.”
“What about Hoseok?”
Jungkook is quiet for a moment, your question lingering in his mind.
Hoseok?
Hoseok.
Jung Hoseok as his friend - the man he calls his brother?
There’s a dark look in Jungkook’s eyes as he thinks about your question.
“Do you like him?”
“I love Hoseok.” you say calmly. “Like I love you.”
Jungkook doesn’t realize that his nails are digging into your skin until he hears you yelp. There was no way in Hell you love Hoseok the same as you loved him; the thought makes him want to gag.
“Why Hoseok?”
You aren’t sure how to respond. “I’ve known him for years.” was all you can think of. You and he were around the same age and he was nice, always smiling widely at you whenever he came around. “Maybe Namjoon?”
Jungkook swallows.
“You look at my friends often?”
There’s a change in Jungkook’s tone that has you cowering.
“I-I’m not sure what you mean.”
“Do you want to fuck my friends?”
You’re taken aback by the harshness in Jungkook’s tone.
“I…I don’t know anyone else but your friends.”
Jungkook snickers. He wasn’t going to allow you and Hoseok - or Namjoon, hell, anyone - to do anything. Hoseok is a man such as he is and the thought of his taking something precious from you was driving him wild. Wild because he knows that if you asked Hoseok, he would.
“No.” Jungkook shakes his head. “Hoseok has a girlfriend.”
A lie, but you’d never know that.
“Oh.” you appeared bummed. “Nam-”
“No.”
You swallow. “Jimin…?”
“Do you fantasize about them?”
You’ve know his friends as long as he has, and now he’s wondering when you had the thought of fucking them in your mind.
“I just want to have sex.” you sigh in defeat, not wanting to cause a fight with Jungkook.
“Why wouldn’t you ask me?”
Jungkook doesn’t care how unreasonably spoiled he may sound. You were his best friend, after all. He kept creeps away from you who wanted nothing but to wet their cocks. You were safe with him in the home you and he shared - he’d be damned if he’d allow a man to come in here and fuck you.
You’re silent, and Jungkook continues.
“You don’t love me.”
Your eyes widen when you feel Jungkook remove himself from you.
“I do.” you quip. “I-I just…I don’t have anyone else. I’m tired of not knowing what it feels like.” watching television with sexual scenes had you wondering if sex was truly as good as they made it seem. You recall hearing from Taehyung, another friend of Jungkook, that porn is often fake and not everything you see was real - but how could it not be when their eyes are rolling and they’re screaming with such passion?
“If you loved me, Y/N, you’d ask me.”
Your heart sinks when Jungkook lifts from his lying position. You hated arguing with him. He was someone you loved and trusted with your life - him being upset with you had your anxiety spiking.
“I thought you had someone you were seeing.” you admit. You recall seeing her a few times in the home. She never spoke, but then again neither did you. She would stroll past you to enter Jungkook’s bedroom and only ever gave you a small grin.
“Oh her.” Jungkook brushes past the statement. “I am. Somewhat.” he shrugs his shoulders. Her contemplated asking her out - she was decent looking and a good fuck. But he didn’t love her nor respect her enough to make her his girlfriend. He was just bored at the moment. “Why does that matter?”
The same way it matters that Hoseok had a girlfriend, you think. You want to say it, but you didn’t want to upset Jungkook anymore than he already was. “I don’t want to come between that.”
Jungkook wants to laugh. “I don’t love her. I love you.” Jungkook says, a tone in his voice that indicates that it should be obvious. “You are my best friend. You should be able to come to me when you need me. Not anyone else.”
You lift yourself up from the bed, as well, and you slowly nod your head. “Sorry.” you murmur.
Jungkook turns to face you, a full smile on his lips. “It’s okay. I’ll forgive you, Y/N.” Jungkook holds his hand out for you to grab.
You do, and Jungkook lightly tugs you closer. You and he are face to face now.
“Sex is more than just losing your virginity.” Jungkook’s thumb rubs your knuckles. “Sex should be pleasurable for both of us. Masturbation is a form of sex. You’ve done that already.”
You nod slowly, feeling hot.
“Tell me, Y/N.” Jungkook says. “When you masturbate, what makes you cum?”
You lick your lips, again embarrassed. You swallow while trying to find the words to answer Jungkook.
“When you watch porn, what do you like?” Jungkook changes the question up, and understands how shy you were - even with him.
Jungkook waits patiently for you to respond. “I-I…” you glance away from him. His eyes were always so piercing, like small black holes that can swallow anyone whole.
“Don’t be shy. We’re best friends, right?” Jungkook pulls you closer to him. “If you loved me, Y/N, you’ll tell me. I can’t help you if you don’t let me in.”
You nod. “Oral sex?” your words come out questioningly.
Jungkook nods. “Okay. That’s a start. Oral sex is a big part of sex. It’s a form of foreplay. Get things started.”
“I don’t think you should do that.” you’re horrified with Jungkook’s face being so close to your sex. Yes, he’s seen it before - years ago - but that was then. He was a man now and he’s had sex with countless women.
“Why not?” Jungkook tilts his head.
You’re silent, and Jungkook sighs. “You don’t trust me.”
“I do!”
“Then why don’t you trust me to pleasure you? You’d rather go to my friends than trust me, Y/N. How do you think that makes me feel?”
“I’m sorry.” you quip. “I just don’t think it…looks good?”
Jungkook blinks.
You swallow.
“Of course it looks good.” Jungkook then laughs. “I’ve already seen it.”
“That was years ago.” you murmur, casting your eyes away.
“True. But still. You trust and love me just like I trust and love you.” Jungkook places a hand on your cheek for you to look at him. “If we’re going to do this, you can’t hide your body from me. I’ll have to show you mine, too.”
You nod your head.
“We can start now.”
You inhale deeply. You don’t move, and when Jungkook notices he frowns.
“Y/N. What did I say?”
“Don’t hide from you.” you murmur.
“Exactly. Here. I’ll help you take your clothes off and you can do the same for me.”
Jungkook is slow when he puts his hands at the end of your shirt. He lifts it up and you stiffen, unsure of what to do next. The shirt comes over your head and Jungkook throws it aside.
“Okay?” asks Jungkook, his eyes glancing down to the bra you’re wearing. It’s red and basic, but it hugs your breast perfectly.
You only nod.
“Okay.” Jungkook then goes towards your leggings. They’re tight, but he manages to get his hands inside. He begins to tug and awkwardly, you lift yourself up so he can remove them. Your panties are black and cotton.
“Now you do the same to me.” Jungkook says. He understands you by now, knowing that you’d never take the first move. He grabs your wrists and walks you through it. “Go ahead.”
You’re trembling, you note, as you remove Jungkook’s shirt - an oversize black shirt. You often are reminded how much Jungkook has grown over the years, going from a boy to a man. He worked out often and was athletic. He had many tattoos that litter his skin - you had gone with him for a few of them and pondered how he could sit so calmly.
“I’ll get up to make it easier.” Jungkook lifts from his bed and waits for you to continue. You’re as slow as before, hands trembling more than before. You tug at the sweats he wore, watching as they fall to the ground. You try to hide the fact that you gawk at the bulge in his briefs, swallowing at the sight.
“Y/N.”
You blink up to look at Jungkook.
“You trust me, right?”
You nod your head.
“Okay.” Jungkook gives you a grin. “Come here.”
Jungkook leans down, his hand grasping your chin. He no longer hesitates or holds back, placing his lips upon yours.
You’re shocked, completely stiff, but Jungkook doesn’t mind. You’ll give into him eventually - it may take a few rounds, but you will.
You’re pushed backwards, back hitting the mattress. Jungkook hovers above you, his hands placing themselves onto your shoulders to keep you in place.
You gasp for air when Jungkook removes his lips from yours, but then they’re trailing down your jawline to your neck. You’re breathing heavily, unsure what to do.
“You can touch me.” says Jungkook, as if reading your mind. “Don’t just lay there.”
Jungkook continues to kiss at your neck, his left hand leaving your shoulder and grabs your hand. He places it upon his chest for you to take the lead. His hand then goes to your waist to pull you closer to him.
Your heart thumps that this is happening now - you and Jungkook. Goosebumps litter your skin, the hair standing straight up. But you do as you’re told, hand grabbing Jungkook’s bicep and squeezing it.
Jungkook forces your legs apart, wrapping them around his waist. You yelp when you feel him, his bulge grinding directly against you. There’s a deep groan from Jungkook that you hear coming from your neck.
“You have to engage.” Jungkook lifts slightly to look at your face. “Kiss me like I’m kissing you.”
You’re left stunned when Jungkook flips the both of you, his own back hitting the mattress and now you’re on top of him. He places his hands on your hips, a smirk on his lips. “It’ll be easier for you this way. I’ll let you take the lead.”
There’s a tension - one sided - when you lean down to his own neck.
“You’re still shy. It’s just me.” Jungkook sighs.
It was easier for him to say. He wasn’t the virgin - or the closed off one that has been homeschooled. The only friend she kept was Jungkook, and his friends, but mainly Jungkook. There was no one she could go to that was the same sex that she could vent to about her frustrations.
“Just let loose, Y/N. We’re friends. There’s nothing you can do that’ll make me view you differently.”
You try your best, even closing your eyes in hopes that’d be better. Your lips place themselves at the nape of Jungkook’s neck, and ever so gently did you kiss him. You allowed your hands to rub softly on his bare shoulders, kissing down his neck until you got to his collarbone.
Jungkook hums to himself, his cock twitching to be let loose from his underwear.
You were adjusting - only a bit - but you’d soon be fully accepting. Jungkook allows his hands to dip from your waist and he grabs your ass fully in his grasp.
You swallow, hiding back the surprised gasp. You don’t want Jungkook to think you don’t trust him - because you do. You don’t want to appear utterly shy and closed off. You were older than Jungkook and he had to be the one to show you what life was like, as sad as it was.
“Okay. Now kiss me.”
You nod your head. You want to avoid Jungkook’s gaze, but he doesn’t falter. “You’ll have to look at me eventually, Y/N.” Jungkook murmurs.
“I know.” you murmur back, and now meet his eyes. Jungkook smiles when you do, and his head lifts slightly.
Your head dips down to capture his lips in yours once more. There’s a fire running through you this time at the feeling - no longer hesitant or awkward to kiss him. It felt…normal; as if this is something the two of you always did.
Jungkook’s teeth catch your bottom lip and he lightly tugs. “Let loose.” he whispers, and then dives into your mouth again. This time, his tongue pushes past your teeth and meets your own, it’s warm and slimy, but it causes you to moan.
Jungkook’s hands grip your ass, keeping you firmly against his erection. He rubs up your sides for a moment, then on your back. His hands are now on your bra and he appears to be swift in unhooking it.
“Kookie…” you murmur against his lips.
“It’s okay.” Jungkook responds. “You trust me, remember?”
You nod, but trust doesn’t help with your self–consciousness.
Jungkook tugs at your bra until it’s fully off of you. He disgards it, bare hands now taking your breast entirely. He doesn't care how heavy he’s breathing, or how rough his hands squeeze your breast.
“My pretty girl.” Jungkook praises.
It’s weird hearing it - for you at least.
Jungkook rarely compliments you - not because he doesn’t think you are, but because he never really has a reason to. He sees you the same everyday - his best friend who he has breakfast, occasionally lunch and dinner with. You’re the same Y/N that he shares movie nights with where the two of you cuddle and laugh at whatever was on the screen.
Now, however, Jungkook has to compliment you. He has to let you know how beautiful you are now - a woman. You grew into your womanly curves over the years, hiding it behind loose clothing, but never truly hiding it. You never hid from him; occasionally wearing shorts that showed your legs and the roundness of your ass, or tank-tops that made your breast appear more plump.
You yelp when Jungkook pinches your nipple. He chuckles at your reaction. “So responsive.” he says, more to himself than to you.
“W-What-”
Jungkook’s tongue licks on your nipple, shuddering at feeling. He couldn’t help but to bring it entirely into his mouth, tongue twirling and suckling on it while his free hand pinches the other. There’s a euphoric feeling engulfing him right now. Yes, he did think about you sexually at times - he was a man and he couldn’t help it. But this was far better than any feeling, any thought or dream he’s ever had.
“Does it feel good?” Jungkook manages to say, popping your nipple from his mouth to just engulf the other one.
“Yes.”
You don’t intend to sound so soft and meek, moaning against Jungkook. But you couldn’t hide it any longer. You can feel the wetness between your legs, arousal pooling out - and Jungkook’s grinding didn’t make it any better.
“You can talk to me, Y/N. You can tell me how much you like it. How I make you feel.”
Jungkook kisses both of your nipples softly.
“I-I don’t know what to say.”
“Tell me how you feel.” Jungkook repeats. “Here,” his right hand drops your breast and without warning, he slaps your ass. The sound echoes, as does you shriek. “I love the way your ass feels.” he then squeezes it in the palm of his hands. “I love the sweet moans coming from those pretty lips of yours.” he continues.
You’re hot, Jungkook’s words cause a new sensation to run through you - nerves running through your body and meeting exactly between your legs.
“It feels good when you touch me.” you say, admitting even if you want nothing more than to hide.
“Yeah?” Jungkook lightly laughs. He squeezes your ass again. “What else?”
You huff, this time now hiding your face. Your head is between his shoulder and neck.
“It’s okay, pretty girl. Just tell me.” Jungkook encourages. “You trust me like I trust you.”
You sigh. Jungkook was going to be the death of you - you were going to die with embarrassment.
“I like the way you look.”
Jungkook, again, is swift with his movement. He’s once more on top of you. He’s now forcing you to look at him - as if you weren’t embarrassed enough.
You go to cover yourself, but that wasn’t something Jungkook was going to allow.
“Go on, Y/N.” Jungkook places a quick peck on your lips before he kisses down your neck to your collarbone.
Your breath is shaky - but it was all Jungkook. His hands rub along your sides as his lips send kisses between your breasts, going lower and lower. “You make me feel…different.”
Jungkook’s lips are now on your stomach. “What’s different?”
“Wet…?”
Jungkook groans. His fingers are hooked between your panties and he wants nothing more than to remove them and dive in, but he’d remain calm for now.
“Look at me, Y/N.”
You hesitated. Not because you didn’t want to, but because you’re unsure what Jungkook had in store for you.
You do, however, and Jungkook is now directly between your legs. Your thighs quiver at the sight.
“What do you want me to do?” Jungkook asks, and before you can answer, he places a single kiss upon your clothed clit.
Your throat tightens.
Jungkook wasn’t going to stop. He wanted to hear you speak - hear your thoughts, whatever moans you had in you. He didn’t want you to be shy - not with him. He wasn’t a stranger and who else should be the one to take your virginity than him?
Not Hoseok.
Not Namjoon.
Not Jimin - none of his friends.
Just Jungkook.
Dare he say he was entitled to it - you were his best friend. He was there for whatever you needed him to be; and this was one thing you didn’t come to him for (not at first). You wanted his assistance in finding you someone. The thought still upsets him.
“Kookie.” you sigh, hands crashing to your face.
“So shy.” Jungkook tsks. His hands grip your waist and he drags you to the edge of the bed, him falling to his knees before you. “I’ll take the lead.”
You feel your panties being tugged off. You’re unsure of what to do or say - you knew you had to keep breathing or you’d pass out. The coolness of the air hits you and now you fully accept that you’re naked for Jungkook, completely bare before his eyes to see.
You’re so wet, Jungkook notes, arousal coating your lips and thighs. The thought of how excited you’ve been and nothing has happened yet makes him groan, anticipating what's to come.
Your throat releases a gasp and instantly, your legs clench shut, caging Jungkook in.
“S-Sorry, i-”
“It’s okay, Y/N. Relax.” Jungkook laughs, a gleeful tone in his voice. He had done nothing but flick your clit with his tongue. “Watch me, okay?”
You nod your head.
Jungkook hooks his hands right on your thighs, holding them in a firm grip so you wouldn’t be easily reactive - not without him stopping you. He dips his head back between your legs, tongue dipping between your folds.
Your eyes flutter, unable to truly focus on Jungkook like he wants you to.
The sight alone is filthy - his head bobbing back and forth while his tongue assaults your clit. Occasionally, his eyes would dart up to capture your reaction, satisfied that you no longer hid your moans from him.
But the noises Jungkook made were another thing. He suckles on your clit, completely ravishing you as if it was the finest meal. He’s animalistic, not caring. He would draw his head back and spit, then continue his assault upon your clit.
“Kookie, I-I, you need to stop.” you try to get away from Jungkook, but he doesn’t allow it. If anything, Jungkook holds you even tighter. You were going to cum, of course, never truly experiencing a man going down on you. Your stomach churns and you feel like you are going to explode. “Kookie, please stop…”
Jungkook’s eyes flicker up at you. Your eyes are snapped shut and there’s a few droplets trailing down your cheeks. Jungkook grunts into your pussy. His fingernails dig into your naked flesh, his tongue laying flat against your clit. He continues to ravish you, not caring about your pleas - it was obvious you wanted more and was far too inexperienced to understand it.
Jungkook dives deeper and deeper, your cries only fueling him for more. Your arousal coats the bottom half of his face entirely.
There was another attempt to remove yourself, buckling your hips, but Jungkook only shoves you back down upon the bed. Your toes are curling and you’re unable to see straight. There’s a tightness in your stomach that’s utterly unfamiliar to you.
“I’m not going to stop.”
Jungkook’s voice is deeper - deepest you’ve ever heard it.
“Not until you cum.”
Jungkook’s right hand removes itself from holding your thigh, but that only means he’s holding the other tighter.
Your back arches when you feel his fingers at your entrance.
“I can’t-”
“You will.”
Jungkook doesn’t give a warning before entering his finger’s inside of you. You jump at the foreign feeling. You swallow back and shriek.
“So tight.” Jungkook murmurs to himself.
Two fingers is all you can handle for now. That doesn’t mean Jungkook goes easy on you. He pumps inside of you vigorously, your walls clenching around his digits. Each time he hits a deeper spot that has you jerking.
“I know it feels good, Y/N. My pretty girl.”
You can’t speak, but Jungkook doesn’t care. He pumps and pumps until you’re cumming all over him, arousal splashing onto the hardwood floors of his bedroom.
You’re a crying twitching mess, whimpering to yourself. Jungkook removes his fingers, satisfied with your appearance.
“I could fuck you right now. You’re so wet, Y/N.”
You exhale, eyes snapping open. “Kookie, I-”
“Don’t tell me you can’t take me.”
Jungkook pushes down his underwear and you freeze.
You’ve never seen Jungkook naked before, never going past witnessing him shirtless.
Now Jungkook is as nude as you, cock erect and hard. His tip is red and leaking with pre-cum, the shaft twitching in anticipation.
“I can’t.” you cry, now dwelling on the idea of having sex with the man.
Jungkook snickers. He grips his cock and slaps the tip against your wet clit. So wet, he thinks. Wet and warm, completely aroused because of him.
“You were willing to fuck my friends.”
Jungkook rubs the tip against your clit in slow circular motions. It makes a wet and sloppy sound as he does.
“They don’t love you, Y/N. Not like I do.”
You twitch at the feeling, overstimulated enough, even if it did feel good.
“Don’t you love me, Y/N?” Jungkook’s eyes don't leave your clit. He continues to tap and circle the tip of his cock against it, the sight beautiful.
“I do…”
“Then why do you keep denying me pleasure?”
Jungkook removes his hand from his cock to place it upon your hips, keeping you in place. He begins to thrust forward, sliding his entire cock against your clit.
“I allowed you to cum, haven’t i?” Jungkook grunts. “Milked my fingers like a little whore. But you won’t let me fuck you.”
Jungkook’s words cause you to gasp - that and the way his cock feels against your already stimulated clit.
Jungkook’s open’s his mouth, a trail of saliva dripping right onto your clit, not because you needed it - you were literally dripping - but just because he wanted to. In his eyes, spitting upon you was an act of marking his territory and after he fucked you - and he was going to regardless - he would assure that only he would be the one fucking you afterwards; always and forever.
Jungkook continues to rub, his pace quickening.
“Do you think another man would have given you the satisfaction?” Jungkook hisses. “They would’ve fucked you and left, Y/N. This is why I’m here. I love you, my pretty girl…” his tone softens. “...so wet and ready for me. You’ll let me have you, right, Y/N? You’ll let me be the one who takes your virginity?”
Slowly, you nod your head. Jungkook was someone you loved greatly. He was a man and understood how men think - you couldn’t be upset with him now. “Okay…”
Jungkook smiles wide, full set of teeth shining at you. “My pretty girl. You’re always so good for me. Give me your hand.”
You do as Jungkook tells you to do, and he guides your hand to touch his cock. It twitches in your grip.
“Tighten your grip.” Jungkook demands and groans when you do. “Okay, baby…now center it at your pussy.”
You’re being so obedient for him, Jungkook thinks. He watches as you do what he tells you, the tip of his cock at the entrance of your hole. “Good girl.” Jungkook mumbles.
“Don’t you need to wear a condom?”
Jungkook wants to laugh at your words. “Condoms are for people who have one night stands. Why would I wear a condom with you?” he asks, a tilt of his head. He had no intention of allowing you to fuck another man, so him not wearing a condom was alright.
You widen your eyes. “Pregnancy…?”
Again, Jungkook laughs. He doesn’t say anything for a moment, only stares into your wide eyes. He had no intention of impregnating you now, but if it happened, then it did. That only meant that it’s what the universe wanted.
“You know I love you, Y/N.” Jungkook says.
“I love you, too.” you respond.
Simpering, Jungkook nods. “I know.” he says, and then without warning, he enters you whole. There’s no warming upm Jungkook thinks, the faster he gets it over with, the faster pleasure will come for you.
When your mouth opens to shriek, Jungkook silences you with his lips. His hips snap inside of you, unable to stop. So tight, he thinks, fully milking his cock with your essence. It’s as though his cock fit perfectly inside of you; like a puzzle piece coming together to complete a set.
The pain is excruciating and you’re unable to pull away from Jungkook. His grip on you was intense, fingers bruising into your skin.
The sound of skin slapping is loud in the room, echoing off the walls.
“My pretty girl.” grumbles Jungkook when he releases your lips. “Thank you for trusting me, Y/N.”
The pain shoots throughout your body, but hearing those words from Jungkook was worth it to you. You blink away the tears so you can focus on his face.
“Soon the pain will go away, and you’ll love the way I fuck you.”
You nod. You trusted Jungkook.
It takes a while for the pleasure to come, but that doesn’t mean it didn’t. Jungkook hits your sweet spot, slamming you against his bed with each thrust. Your moans are loud for him, so sweet and melodic - he knew you had it in you to let loose.
“Feels good, pretty girl?” Jungkook questions, the question rhetorical. He knows by the way you clench around him that it does - that and your high pitched moans.
“Feels…so…good…” you grunt, panting along with each powerful thrust.
“Good.”
Jungkook removes himself just so he can turn you around, chest firmly against his mattress. He enters you once more, hitting even deeper than before.
Your eyes snap shut and your arms shoot out, gripping the bed sheets for support. Whatever you once imagined sex would be like didn’t give it any justice. Sex with Jungkook was a pleasurable feeling you’d never forget - you’re unsure how you’d ever be able to go back to masturbating once this was over.
Both of Jungkook’s hands place themselves on yours, entangling your hangers with his. His lips kiss your back, pounding inside of you with such passion.
There it was again, the churning feeling in your stomach.
“I feel you, baby.” Jungkook pants. It’s as if you never want him to stop, creaming his cock like your life depended on it. “Go ahead and cum for me, pretty girl.”
You groan, shaking your head at how good you felt.
“I love you, Kookie.” you murmur so low that it’s barely audible, but Jungkook hears it loud and clear.
It causes Jungkook to grind into you deeper and deeper, feeling himself come undone at just words. You told him those three words many times before, but now it felt different. Intimate. This was something he’s never heard during sex - and if there was a chance he did, he wouldn’t care.
You were who Jungkook loved; his best friend since childhood.
You were the one who Jungkook wanted to hear the words from.
Jungkook’s cumming, his heaving breaths ticking the skin of your back. He doesn't bother to pull out of you, instead he milks your walls completely with his seed, shuddering with complete bliss.
Jungkook won’t regret it - cumming inside of you felt right. It wasn’t as if anyone else would be.
“My pretty girl.” Jungkook coos, pulling out of you to tuck you further into his bed. He lays beside you, embracing you from behind. “You did so good for me.”
Your heart swells at the compliment, your eyes heavy with slumber.
Jungkook holds you tight as you drift to sleep, satisfied that you were here with him.
Not Hoseok or Namjoon or anyone else - but him.
After all, he was the only one who truly loved you for who you are and didn’t see you as just a hole to fill - he wasn’t like those other men out in the world. No, Jungkook was better than any man you could ever think about being with. He proceeds to place a kiss upon your temple, satisfied that you were his and his alone.
idol version
4K notes
·
View notes
How about first time virginity loss (reader) drabbles or headcanons for choso, gojo, sukuna and naoya? Maybe? Pleeaase
no 👺 jk here you go love <3
ε ❤︎ з CHERRY POPPING! ᡴꪫ
MINORS FOR THE LOVE OF GOD DNI!!
content: nsfw; smut; jjk men hcs; drabbles? more like oneshots lmao; loss of virginity; afab!reader; fem!reader; fingering; cunnilingus; p in v sex; unprotected sex (oops)
n/a: i felt lwk awkward writing these bc i didn’t really know how to write sukuna and naoya without being traumatic, so i tried my best to make it ‘readable’. also the reader insert may be awkward too so sorry abt that. took me a while write this so give it much love pls! these are my hcs! feel free to agree or disagree :b as well as english isn’t my first language and im still a rookie at writing so bear with me please! any request/interaction supporting this post is very much appreciated
CHOSO & GOJO
w.c: 1k
The type to talk to you and ask you how you feel throughout the process. Will definitely ensure you’re okay and enjoying it as much as they do. They’ll talk to you sweetly and praise you for taking it so well. Cute aftercare.
“How does it feel?” He asks, his thumb gathering up the slick dripping out of your pussy to your sensitive clit, rubbing it in gentle circular motions. You moan quietly and nod, angling your hips for more of his touch. “Good,” you sigh, holding onto his bicep as you keep eye contact with him, your chest heaving at every heavy breath you take. He smiles softly and leans to kiss you again, his lips weaving against yours while his free hand reaches to cup your breast and gently plays with your nipple. You moan into the kiss, parting your lips slightly open to allow his tongue to slip inside. Satoru kept rubbing your swollen clit as he pushed one finger into your clamping walls. You winced at the strange sensation of his finger suddenly intruding inside your virgin cunt, making him immediately stop and pull his finger out. “Are you alright?” He asks, his eyes portraying concern.
“Y-yeah! It’s just that it felt kinda weird,” you reassure him. “You can keep going if you want…” you added embarrassed he stopped because of you, feeling your face growing hot.
He chuckled lightly and pressed a chaste kiss on your lips to soothe you. “Okay, I just want to make sure you’re okay. If you feel it’s too much we can stop anytime, alright?” He says, bringing his hand to caress your cheek, you nod once again unknowingly leaning to rest on it, feeling your heart flutter and comforted with him. He then buries his face into your neck, dropping soft kisses onto your skin, nipping and sucking the area until it bruises. “You’re so pretty,” he mutters as he presses his lips on the side of your neck, his warm breath hitting your skin and sending shivers throughout your body.
You whimper, your back arching off the bed as he reinserts his finger inside you, pumping in and out slowly. The act at first feels uncomfortable and strange. But the pleasure gradually takes place as his words of praise and the way he adores your body have you moaning his name. He laps a long stroke along your neck as he pumps another finger inside your gummy walls, curving them upwards to reach that sweet spot that has you curling your toes and writhing underneath him. You feel your legs shake and weaken, the knot you felt in your lower body tightening and your walls spasming around his drenched fingers of your arousal.
Unexpectedly, he pulls his fingers out of you, having you whine at the sudden emptiness inside your aching pussy, begging for release. He giggles at your reaction, bringing his drenched fingers to his mouth, licking them clean of your slick. You gasped, speechless by the obscenity of the action. Despite its lewdness, you couldn't help but feel your lower part throb, having you swallow your saliva thickly.
He positioned himself between your legs, placing his fat tip between your folds and rubbing it upwards to gather as much slickness as he could, coating his cock from your arousal. The tip of his cock brushed against your swollen clit, making you moan and grip the bedsheets underneath you in anticipation. He gave himself a few languid tugs, smearing his pre and your slick across his length and guiding his cockhead onto your wetness.
You bit your lip, feeling your nerves on edge which he seemed to notice, as he reached to hold your hand, intertwining his fingers with yours.
"I'm gonna go slow, okay? Tell me if it hurts too much and I'll stop," he tells you, waiting for you to give him the green light. Once you nodded, he pushed in slowly, inch by inch. He was being extra careful with you, as if scared to hurt you in any way. You hissed and shut your eyes firmly, feeling a hint of pain as his girth stretched you out. You squeezed his hand and clenched your other hand into a fist until your knuckles turned white. With your heartbeat pounding in your ears, you whimpered adjusting to his size.
He stopped midway, kissing your tears away with tenderness. "You're doing great. Relax and take deep breaths, okay?" he cooed, peppering kisses around your face, distracting you momentarily from the pain as he pushed until he was finally fully sheathed inside of you.
Once you felt somewhat at ease, you wrapped your arms around his neck as he started setting up a pace, his dick massaging your inner walls slowly. You sunk your moans into a passionate kiss, your lips against his silken smooth lips. His hands tenderly roamed across your skin, one finally resting on your waist to steady his languid thrusts inside you.
"You feel so good, taking me in so well," he purred, his mouth reaching down to your chest and taking one of your breasts into his mouth, sucking and nipping at your pebbled flesh. You whined, digging your nails into his back muscles, the fire in your abdomen having you arching your back so beautifully, you felt a type of pleasure different from any you had experienced before, it had you dazed and lightheaded.
"You like that?" he asked, his breath heavying as he pistoned inside you. You whined, feeling the coiling tension in your womb about to snap and nodded. "Yes," you hissed repeatedly, tears of pleasure welling up in your eyes. His pounds became more erratic as he chased his release. "F-fuck you're so tight, so good f'me," he panted, biting his bottom lip to hold his lewd sounds from coming out. With his name on your lips, you shuddered underneath him, coming undone as your vision became blurry and your guts tightened. His thrusts became sloppier as your walls spasmed around him, making him throw his head back in ecstasy and let out a guttural groan. He rolled his hips until he thrust one last time, going still as his warm cum painted your insides.
Careful to not crush you, he pulled out and slumped to your side, his chest heaving in exhaustion.
"How'd it feel?" He asked steadying his breath as he beckoned you to come closer. You wrapped your arms around him, resting your head on his chest glistening in sweat. "Good, really good," you hummed, struggling to keep your eyes open. "Glad you liked it," he murmured, pressing a soft kiss on your forehead. "Let's clean ourselves then we can go to sleep, yeah?"
SUKUNA & NAOYA
w.c: 1.1k
Minor praising, just to make you feel slightly better (a little backhanded). The type to say “quit whining, you’ll like it”. Will take all of his willpower to not thrust all at once, and they won’t, just because they take you into consideration. Definitely the type to feel pride in ‘taking away’ your innocence.
"Ah! It's too much! Too much!" You cried out, gripping the bedsheets tightly until your knuckles turned white. You tried to scoot your hips away, your movements being immediately halted by a firm grip, pulling you back to your original position close to his relentless tongue. "Quit whining. You'll get used to it and like it. Soon you'll be begging for more," he said, spanking the side of your asscheek as a reprimand. You squealed as he went back down lapping at your sensitive bundle of nerves. You huffed, your hips jolting at each flick his tongue did.
Your nerves were on fire. You moaned his name like it was a mantra to you. His fingers were knuckles deep into you as he sucked on your puffy lips and stroked your abused clit in circular motions. "Fuck, you're squeezing on me so tight and I haven't put in my dick yet," he teased, gaining a whine of embarrassment from you. His thick fingers scissored inside your heat, making you whimper. You felt close to reaching ecstasy.
"W-wait! I think I'm going to I'm-" Your words were cut short by a loud moan after he sucked harshly on your clit, making you see stars. Your hips jerked as you made a gushing mess on him and the bedsheets, waves overtaking you. He rode you through your orgasm, eating you out like a starved man.
"So you're a squirter, huh?" he hummed, his lips glistening in your arousal. Your legs weakened and quivered, you were in a dazed state as you gathered your breath. "How did that feel? Good?" He asked, getting up closer to your face. You nodded weakly, staring at him through lidded eyes. You swallowed thickly. "Yeah," you sighed.
"Good," he hummed, pulling you for a sloppy kiss, the taste of your cum still in his mouth. His tongue brushed against your lips, asking for permission to enter. You moaned into the kiss, parting your lips open to let his tongue in. The kiss was so heated, barely allowing you to gather your breath and making you feel lightheaded.
He pulled away and got a hold of your legs, parting them wider open. He let a thread of spit fall onto his cock, lubing himself up with spit and his precum. He pressed his tip into your cunt, pressing on it in and out, deliberately teasing you. “How bad do you need it?” He asked, a mischievous grin drawn on his face, taking pleasure in taunting you and hearing your little needy whines. “Don’t tease me like that,” you whined pleadingly.
“Say how bad you want my cock stuffing this pretty little pussy and I’ll stop,” he said, the pad of his thumb rubbing your swollen clit just to tease you more. “Please, I want it real bad. I need it,” you whimpered, your toes curling at the stimulation.
“Alright,” he chortled lightly, about to push the tip inside, but before he could keep further, you stopped him with your hand on his abdomen. "Please be gentle," you said, your eyes pleading mercy to him.
He scoffed and rolled his eyes, seemingly offended by your words. "Of course, Imma be nice. What kind of monster do you think I am?" he said with a sneer. You held back your inner thoughts, not wanting to put him in a bad mood and laid back on the bed, biting your lower lip as he pushed inside you slowly. He halted midway, beads of sweat rolling down his forehead. "Fuck, take deep breaths, angel. I can't keep moving if you're squeezing me so tightly," he grunted, the pad of his thumbs rubbing your inner thighs to soothe you.
You let out a pained moan and panted, trying to follow his words as you adjusted to his size. You reached out for his hand, locking your fingers with his as you got used to him inside you. Once he felt he could move a little more, he pushed deeper inside your virgin pussy, making you gasp at the fullness inside your heat. You winced at the hint of pain, "so big", you whimpered, a few tears brimming from your eyes. He chuckled and gave your hand a light squeeze. "I know baby, I know," he said with a hint of pride in his voice.
Once you thought you were ready, you nodded, giving the green light to start moving inside you. He rolled his hips against yours lazily, his hand leaving your hand to cup your tit and play with your nipple, pinching it and flicking the hardened peak. The pain was soon replaced by pleasure and breathy moans were coming out of you. Your skin felt hot and burned under the pad of his fingers, you were losing your composure as his cock kept massaging your walls.
"Shit, so tight. So tight and pure for me," he groaned, his pace getting quicker and deeper, the sound of his hefty balls striking your ass filling out the room. "You like that? You like being fucked by this dick?" He hissed into your ear, nipping on your earlobe as he pounded your cunt.
You dug your nails on his skin, gaining a grunt from him. He angled your hips to reach deeper into your tight pussy, his cockhead kissing your cervix and making your eyes roll to the back of your head. You nodded, tears brimming from your eyes as he fucked you dumb. "Say it, I want to hear you," he growled, his teeth marking your skin with bruises across your neck and collarbone. You whimpered, overwhelmed and overstimulated by his thumb that had resumed rubbing your abused clit, feeling your walls flutter and squeeze his girth tightly, announcing your release that threatened to snap at any moment.
"I- I like it!" You cried out, your guts tightening begging to cum. It took a few deep thrusts for you to scream out his name, gushing and soaking his happy trail with your translucent fluids.
He grunted, your pussy squeezed him so tight it made it difficult for him to move. He could've sworn he was on the edge of cumming as so as you did.
"Fuck I love this pussy," he moaned as he kept on pumping in and out of your cunt, his pace sloppy and desperate to fill you up with his cum. He lolled out his tongue, thrusting one last time deep into your wetness, spilling his thick load inside. He pulled out, his cum dripping out of you down to your ass as he did so. Your fucked out sight with his seed spilling out of you made his cock twitch, perhaps once you'd come down from your high he could stuff you again with his dick.
2K notes
·
View notes
jjk boys reacting to getting a morning wood next to you
ANONNN UR MIND <3333
*・゚✧ JJK Men With Morning Wood
tags: multi character x reader, fem! reader, morning sex, thigh fucking, humping, handjobs, male masturbation, mutual masturbation kinda, the ittiest bit of degradation in toji's
word count: 4.9k wowie zowie
a/n: eek my first request...so happy. this was so fun to write ty anon, im supes sorry it took so long to write! i may have gotten carried away,, also TYSM FOR 100 FOLLOWERS HOLY SHIT 🎉🎉🎉🎉should i do a milestone reward :o
NSFW UNDER CUT! MDNI
⋆。˚ ♡ gojo: wakes you up and begs to fuck your thighs
Gojo woke with a startle, his body only lending him a few moments to adjust to his surroundings before he had to stifle a low groan into his palm, a dull, overpowering throb sending shocks of pleasure up his spine. He blearily glanced downwards to where he felt the heat starting to pool, his vision being blocked off by your body, pressed tight against his.
You were moving around in your sleep quite a bit, leg thrown across his own and arms wrapped tight around his chest. A quiet noise left his throat as he felt that jolt go through his body again, your hips moving up against his crotch just enough to graze across the head of his clothed cock, making him swear under his breath.
He'd found the culprit for his sudden awakening, but now comes the issue of taking care of it. The combination of sleepiness and horniness was making his head feel foggy, eyes darting around the softly lit room for any kind of distraction he could find for himself. Now he knew why you always made a fuss when he clung to you in bed, it was near impossible to move around and touch himself without waking you.
He bit his lip tightly as he felt his cock jump up in his boxers, eyes drifting back to your body innocently leaning onto his. The time on the clock read '10:20 am', much past the normal time you would wake up normally. You wouldnt be *too* upset if he just..?
"Baby.." he whispered, the arm encompassing your waist shifting forwards to jostle your still body, making you whine against his chest and hug him closer in defiance. "C'mon baby, get up." he said, moving you again and giving him a louder whine in response.
Through his persistence, your head turned up and poking out from the bumps of his naked chest, eyelids lowered as you slowly started to wake up
“G'morning beautiful, sorry to wake you up like this” he chuckled, brushing a small section of hair from your face as he watched your eyes travel downwards, to how his erection poked against your inner thigh. “You don't gotta do anything, just please-” Gojo shuddered as you slowly grinded up against his tent, your soft voice making the fog in his head worsen.
“Lemme fuck your thighs, alright baby? Please, it'll be quick, I promise” his chest rose up and down in quick, shallow breaths, stilling himself with all his might when the head of his dick slipped snuggly into the dip of your thighs, right underneath your panty clad pussy. “Please, sweet thing? I'll make you cum too, promise” he ran his hands down to your hip, pressing his lips together when you let out the softest moan.
Still too sleepy for talking, you nodded into his collarbones, spreading your legs apart enough for Gojo to slip inside them. Gojo almost moaned at the display in front of him, hushed praises and thanks coming from his lips as he hurriedly slipped down his pants and boxers, sighing in relief when the uncomfortable pressure of his underwear was finally gone.
Gojo's hand made quick work slipping his pants down to mid way down his thighs, moving his fingers to lightly press against the crotch of your panties. “Shit…” he whispered, feeling the way your pussy was already starting to wetten up for him. “Have a good dream about me, huh?” he teased, rubbing slow circles on your clit before replacing it with his length.
He could feel you clench around nothing through the thin fabric, a shudder erupting through his lower half as you slowly closed your legs back around his cock. He groaned under his breath at the warmth enveloping him, chuckling and pulling his hips back. “Shit, you feel good… where’s the lube, wanna make it feel better” he mumbled as he turned his body around to search through the drawers behind him, rummaging around loudly until he triumphantly brought out a small, almost empty bottle of clear liquid.
“Spread your legs again, this’ll make it feel good.” he spoke, a small *click* as he flipped the bottle open and squirted the liquid onto his deft fingers. As he massaged it into the plush of your thigh, his thumb caught underneath your panties, pulling the fabric to the side smoothly. His lubed fingers came to spread your lips open, the cold morning air blowing across your sensitive cunt and making you shiver from the exposure. ‘Satoruu..” you whined, feeling his cock slide up your thigh to rest right against your pussy.
“Close em, fuck, I don’ think I can stay still for long” he whispered, his large body coming to hold your lower half flush with his own. You whimpered and wordlessly followed what he asked, moaning softly at the feeling of his firm cock grazing *so* slowly across your pussy.
“That’s the shit, god.. such a good girl for me” Gojo whispered, his voice sultry and practically dripping with heat as he grinded up into your thighs, his dick gliding across the wetness of your pussy and perfectly rubbing against your clit. “Hold onto me baby, I’m not gonna be gentle.”
⋆。˚ ♡ getou: kisses you awake and humps your leg
Getou carefully turned himself around, keeping note of your tight grip against his sides and letting himself relax back against the warm sheets as he shifted himself closer to you, his fingers coming to cradle your soft hair as his lips met with your face.
Ever since getting with you, Getou had gradually lost interest in getting himself off, especially in the mornings like this. he could feel the way his half hard erection slowly filled out his pants more as he drunk you in, his lips taking their time to press against each and every crevice of your face.
He could feel you start to stir, your soft eyelashes slowly cracking open to meet with his gaze, lowered with his pupils expanded to cover the majority of his eyes.
He pulled away just enough to give you room to yawn, his hand sliding down the front of his body to grope at his cock as you greeted him, voice crackly and quiet. "Good morning hun" Getou spoke, his voice gruff right against your ear as he resumed his onslaught of kisses.
"Mm-" you tried to get out a word of questioning as to why he was so affectionate, but your lips quickly turned into a home for Getou's, tenderly kissing you. You could feel low, muffled groans being thrust into your mouth as he lifted your face up to meet with his better. “Sugu-” you gasped, pulling away only to be hungrily brought back to his lips.
“Shh, stick out your leg f’ me, baby” Getou ordered, smiling when you wordlessly obeyed him. You gasped again as your knee brushed over his bulge, Getou’s free hand coming down to hold it still. “Feel that pretty girl?” he asked, watching you nod and try to press harder against him. “Think you can help out with this?” he offered, biting his lip in arousal at how quickly you agreed with his request.
His grip on your thigh loosened, just enough to give you the wiggle room to grind down into his erection. His raspy, deep voice filled your ears as he ground his hips down into your hard knee, hand climbing up to grope at your butt and snickering when you squeaked in surprise.
“So nasty..” you murmured, watching with bated breath as he caressed the back of your thigh tenderly. “Only for you, sweet girl… fuck, keep doin that-” he grunted out, your knee pressing up against his balls slightly as he humped against you.
He’d slipped up to grinding against the meat of your thigh by now, whispers of your name escaping from his lips as a small, barely noticeable spot of wetness started to seep through the fabric of his sweatpants. “Sugu, kiss me again, please” you begged, barely needing to wait before geto’s lips came crashing onto yours. His thick, hot tongue eagerly pressed through your parted lips, grinning into the kiss as his tongue twirled around yours.
Your body quickly flushed warmly under his strong hold, feeling how pulsed and ground hard against your thigh, your breath catching in your throat when his tongue dipped up to the roof of your mouth, licking along the length of it before pulling away for a gasp of air. “So fucking sexy, baby girl, god- say my name baby please” Getou moaned, the grinds against your thighs speeding up sloppily. Getou could never control himself when he got like this, so desperate for an orgasm he’d take anything you gave him as long as it got him off.
“Suguruuu-” you drew out your words, half moaning and half whining as he raised your leg to grind back down into your knee. “Yeah, that’s right, say it louder f’ me” Getou purred, panting as his hips thrusted down onto your leg. You spoke his name again, feeling your pussy thump in tandem with your heart at Getou’s husky moans filling the thick air around you two. “Wanna see me cum, beautiful?” he asked, voice lifting as his body grew closer to orgasm already. “Mmmhm, please Sugu lemme see”
Getou fumbled with the band of his sweatpants clumsily, pulling them down to reveal his flushed red cock, the stain of pre cum much bigger now against the dark gray cotton fabric. You squirmed as Getou slid his lubed cock onto your bare thigh, rubbing down against the warm, soft skin and shivering softly. “Keep your eyes here, got it?” He whispered, forehead pressed against yours as the two of you watched his hips quickly pick up pace against your leg, raunchy sounding groans and chants of your name falling from his lips carelessly.
“Shit- y’ so good to me baby, so fucking good” Getou stumbled out, hair falling around the two of you as his head bowed down in pleasure. “Touch it honey, please, wanna cum for you” You gasped in arousal, warmth pooling down in your stomach as you quickly stroked the base of his dick, letting your fingers caress down onto his balls when your palm reached the bottom.
“*F-fuck* yes, cumming, I’m cumming, oh my *god*-” Getou groaned loudly, body trembling and curling into itself as his cock throbbed harshly against your thigh, cum leaking out of his tip and coating the skin of your leg and your hand. You slowed your hand down as Getou rode out his orgasm onto you, uneven bucks and thrusts up against you making you whimper under your breath from how hot you felt.
Getou continued to let out broken noises as his orgasm slowly simmered down, weakly grinding down into the puddle of cum he’d made. He let out fast, shuddered breaths as he rested against you, rubbing your thigh and kissing your forehead gently. Getou used his free hand to cup your chin, lifting it up to meet with his foggy, pleasure hazed eyes. “Don’t worry honey…I’m not done yet” Getou purred, gaze falling down to the way your thighs squeeze together.
⋆。˚ ♡ nanami: jerks himself off to not disturb your beauty sleep
Nanami let out a drawn out sigh as he snuck his hand downwards, carefully scooting the blankets aside for his hand to get under them. He was hard, and badly at that. And while he didn’t at all blame you for this, he’d noticed that he’s started getting more intense morning wood when you’re with him, leading to him having to carefully wrap his hand around his erection and get himself off without waking you up.
He also, never seemed to realize he could simply turn over and plop you down on the empty bed space next to him until after he was done, discreetly wiping himself off and nudging you awake. He has to pretend he doesn’t know why it slips his mind, even though he knows good and well why he chooses this riskier route.
Some gross, locked away part of him loves thinking about waking you up by feeling his thick cock pressed against your hole through your panties, his hand quickly stroking himself through orgasm as you moaned at the wet feeling of his cum soaking you. Knowing you, he’d be met with the sweetest moan of his name as the after shocks of his orgasm faded over his body, pressing your hips down against his abdomen.
He held back a noise at that thought, his fingers finally ghosting over his pre cum soaked tip, rubbing small circles across the hole of it before working his way down his shaft. He focused on keeping his breathing steady as you dozed off on his chest.
Staring at the ceiling above him as he bit his lip with concentration. You were, thankfully, not a light sleeper, but he’d rather avoid the embarrassing notion of you waking up to him like *this*.
Nanami had done this many many times before, so he knew exactly what to think of to get himself off quick. Not that it ever took long with you, he could count the amount of times he’d nearly cum on the spot when you shimmied your panties off, a string of wetness clinging to your sensitive, pulsating cunt, your swollen clit peeking between the pink-ish folds. The few times when he’d come home tired and ready to either crash into your arms or the bed, when you’d so lovingly take care of him by riding the soul out of his body.
God, he wanted that so badly right now, watching your ass ripple from how hard you were slamming down onto his cock, moaning his name as he felt your hole twitch around him, the unmistakable way you’d quiver and still yourself as you came around his cock, whimpering and squeaking out high pitched little noises as he fucked up into you through your orgasm.
*‘Later’* Nanami promised to himself, feeling his chest begin to rise and fall rapidly as his hand pumped his cock, holding back sighs and grunts of pleasure as his arm stood as still as possible, his wrist rapidly falling up and down as he fisted his cock.
His hands rapidly squeezed along his thick shaft, desperate to mimic the way your pussy would clamp down so tightly when he bottomed out inside of you.
He was quick to move his hand off your waist, and over his mouth as he nearly moaned out loud at the thought, silently cursing his memory for being so detailed in this moment. He froze stiffly as he felt you start to stir in your sleep, sleepily reaching out before he joined his hand with yours. He sighed shakily, speaking lowly to not wake you further, his hand still grazing across the sensitive veins alongside his cock. “Shh, go back to sleep dear, I’m here.” He could almost laugh at how easily you fell limp back against him, your breathing slowing back down and a one off snore leaving your throat.
He gently held onto your hand, the fist still around his cock now picking up speed, wet sounds being poorly muffled through the blanket as he leaned his head back against the pillows. The adrenaline from just now only fueled onto his racing heart and sensitivity, hand clamping down onto yours as he could start to feel his orgasm quickly approaching him.
His teeth grit together subtly, holding back swears as his legs tensed up, his fist slapping loudly down against his dick as his stomach tightened. “Shit-” he swore, his orgasm overtaking him before he could prepare for it. His fist rushed up to close down over his dick, covering his tip as it leaked out thick spurts of his cum. He held his breath in his throat as he trembled, pressure mixing wildly with the fading anxiety of being caught and the pleasure of his hand pushing down across his girth.
He let out a deep sigh as fresh air filled his lungs, his heartbeat loud and clear in his ears while his cock started to soften. He breathed out in relief, glancing downwards at your peaceful figure, none the wiser at what he’d done.
Now, to clean this up before you stirred again..
⋆。˚ ♡ toji: tries to will it away bc he doesnt feel like taking care of it, doesnt work. u wake up and take care of it for him
Toji grunted under his breath at yet another twitch of his erection, rubbing almost painfully against the starch material of his boxers. He'd been laying like this for a while now, achingly hard with you happily snoozing on his chest, unaware of the predicament he was in.
The rational decision to make here would be to wake you up, or even reach into his pants and get himself off, but it was a *little* hard to do that when one shuffle of his leg got him a whine of complaint and you shimmying back up on his body, getting yourself comfy again before falling back asleep.
And since Toji was *such* a gentleman, how could he disturb your beauty sleep and get himself off?
"Fuckin' hell..." Toji spoke softly, the pressure of your warm body laying on top of him, giving his dick the barest hint of stimulation driving him mad, slowly but surely. There was always the idea of grinding his hips up and jerking himself off with the plush of your thighs, but he knew that'd only result in you grumpily waking up from his cum coating you, glaring at him with those sweet eyes of yours, wiggling your pretty hips over his softening cock, and drowsily cursing him out for wasting his load on your leg like that-
A sharp pulse through his dick ceased his thoughts, making him loudly groan into the morning air. He heard you make a small squeak at the sudden sound, looking down and smirking. “Mornin’ princess” he greeted, his low voice carrying through the quiet air, much to your displeasure. “Y'ur hard…” you mumbled, rubbing your eyes and leaning your hips back to cradle over his tent.
Toji grunted at the feeling of you lazily grinding down against him, laughing and placing his hands behind his head. “Yeah, I am. Whatcha wanna do about it?” his lips cracked open into a toothy grin, watching the way you sleepily glowered up at him, raising yourself up by the arms and pushing yourself backwards on his lap.
You stifled a yawn into your arm, your ass colliding with Toji’s sturdy abs and making you lose your balance for a small second, your eyes shooting open on instinct. “Careful, now” Toji replied, ever the helpful one as he looked you up and down decidedly. Despite your attitude in the mornings, Toji loved when you got like this, moody, sulking from being awake 'so early' as you'd put it, but not ever hesitating to make him cum all over your pretty fingers.
“You couldn't do it y'self?” you asked accusingly, now seated right below Toji's bulge, your smaller hand pressing down against his length. “Nah, you do it better” Toji said snarkily, watching your eyes roll as you slipped down his sweatpants. For as annoyed as you always looked when he woke you up with his hard on, your eyes almost glittered from how wide they'd get, staring at his thick cock poking out from the band of his underwear.
“Go on mamas, it won't bite.” He teased, groaning under his breath at your hands quickly pulling the last piece of clothing off him, your fingers pinching over his tip to lube his cock with his pre cum. “Dirty girl..” he commented, his voice much too confident for your liking. “Zip it.” you glared up at him, watching him run his pointer and thumb across his mouth in a zipper motion, the silence immediately being broken when you squeezed your hand around the base of his cock.
With a kiss of your teeth, you quickly began jerking him off, your hand twisting up near the tip before slamming back down at the base, making him let out a pleased moan. He knew you loved when he got vocal, so he made sure to put a little more effort into telling you how good you were doing for him. His sugar sweet girl, so cute even when she was being so slutty like this, manicured nails struggling to meet as they stretched over the girth of his fat dick. Your cheeks flushed as you continued, trying to subtly wiggle your hips as his words sent jolts of arousal straight to your cunt.
“Don’t stop, baby, fuck-” Toji let out, head tilting to the side as he never took his eyes off of you. “You better make this up t’ me, Toji” You murmured, cheeks feeling hot at his heavy gaze, making you feel surrounded by him even as you laid across his flexed thighs. “Oh yeah? You want me to fuck you with my fingers after you make me cum? Make that pretty pussy squirt?” You barely stifled a whine at his brash words, Toji laughing under his breath when he felt the way you tried to grind down against him.
“Yeah, that’s what my girl wants. Fuck, c’mon and make daddy cum, lemme get my hands on you.” Toji groaned, chest rising up and down as you added your other hand to stroke him. He swore at the sight, his brain fogging with arousal at how even your two hands struggled to handle his dick. Toji’s mouth struggled to stay closed as he could practically *feel* how desperate you were now through the way your hands moved, milking his dick effortlessly and making the coil in his stomach tighten fast.
“Fuck- open your mouth baby, yeah that’s it, *shit*-” Toji’s arms came down to grip at your hair, holding your head still as your tongue lolled out of your mouth, drool beginning to run down the tip of it as he came on your face. You watched through your lashes at how his eyes rolled back, hand covering his face as he groaned lowly, warm cum coming out quickly and covering your lips.
Your hands came to a stop when Toji’s iron grip on your hair loosened, his body falling back against the bed as you swallowed what had gotten in your mouth. You made a small sound of annoyance as your hand was now covered in Toji’s cum, your thumb rubbing against your plush lip and gathering a stray drop of cum from them. Glancing back down at your boyfriend, you could see him facing you yet again, a grin making its way back onto his face.
You yelped loudly as you felt your body get dragged up Toji’s body, hovering over his stomach with your legs spread open widely. “Whatcha doing with your panties still on? C’mon baby, show me what I wanna see.” Toji purred, licking his lips when you shyly brushed the crotch of your underwear to the side. “*That’s* right…”
⋆。˚ ♡ choso: wakes up and asks if he can fuck you
soft clicking across a keyboard filled choso's ears as his brain slowly came into conscious, a vision of you seated on your side of the bed, leaning back comfortably against the pillows as you typed away at your laptop. choso let out a shocked sound as he tried to scoot closer to you, his pajamas unreasonably tight around his crotch and making his body shiver with sensitivity.
You paused your writing at the noise, shutting it and turning your head over to him. "Good morning cho" You smiled down at him, the morning glow of the sun casting highlights across your chest and collarbones, the loose fitting night gown you sported hiding nothing from Choso's rapidly growing imagination. He felt his leg twitch up at another jerk up against the cotton of his pants, a quiet gasp getting pushed from his lips in surprise.
Your laptop had been placed on the floor by the bed at this point, your body turned over to face Choso while your fingers went to caress his flushed cheeks. “‘M hard” he croaks out softly, making you giggle and nod “I can tell, baby.” he pushes himself up with his forearm slowly, moaning under his breath when his dick grazed against his thigh. “Need you, c’mere, please” he rasped out, tossing the blanket off of him and watching how your eyes dropped down to his tent.
Your body quickly came to lay back down next to his, lifting your nightgown up to reveal your bare body underneath. Choso moaned shamelessly at how you looked, running his hands across your soft stomach all the way down to the small slit hidden between your thighs. “Thank you, thank you, gonna make you feel good, promise-” he purred out, leaning down to kiss you as his thick fingers quickly made their way to pulling down his pants.
“So needy, aren't you baby?” you teased lightly, watching excitedly as Choso’s hard cock bounced out of his boxers, slapping the dip of his abs with a quiet ‘pwip’ sound. He nodded along breathlessly, hands gripping the fabric of his underwear tightly as you spread your legs, grinding your bare pussy down against his shaft. You shuddered when you felt it twitch up against you, Choso poorly hiding a whine into his hand as he grabbed your hips, pressing his lips together and pulling his underwear down to his knees.
Your nightgown, previously bunched up midway up your tummy, was now being pulled off leisurely by you, Choso quickly coming to cup his hand underneath your chest. “Yes yes, thank you, won’t take long I promise- *ohh god*” he spoke, voice unsteady and breathy as he prodded his tip against your hole, eyes threatening to roll up when he felt how easily you sucked him in.
You moved your hips down to meet with his cautious thrusts up, tightening around him as he slowly, so slowly inched his way inside of you. “Haahh- so tight” Choso vocalized, looking up into your eyes as he started to bottom out inside you. Choso had been made aware he was *much* bigger than average, so he’s always been extra careful when sheathing inside of you, mind being driven into filth at the way your pussy would so eagerly swallow him up, hole stretched wide over the base of his dick, your wetness seeping out and coating the front of his balls.
“Need this so badly, need you” Choso chanted, your name feeling like pure sugar on his tongue as he moaned it. The way you felt, stretched taught all the way down to the bottom of his dick, wet and hot and tight as he reeled his hips back, sighing out so softly as he kissed along your neck made his body feel tingly with pleasure.
To Choso’s credit, he was honest when he said he wouldn’t take long. With a simple plea in his ear, and a clench down around him, he was wordlessly rutting up into you, his thumb coming down to rub quick circles across your swollen clit. Breathless little ‘ah- ah- ah’s’ spilled from his lips into your shoulder as your leg hooked around his waist, hugging him close as he sloppily fucked into you.
“Sorry, ‘m already, *ah* already close, can I? Inside?” Choso asked, his words broken and strained as his hips effortlessly rammed up into your pussy, filling it out so perfectly that it was impossible not to dumbly nod along with anything Choso asked for. His eyes sparkled as they started to get misty, teeth clenching together while his hands held your hips still, abs tightening as his body chased after his orgasm that was rapidly approaching.
“Gonna cum, gonna cum, go-” Choso’s begs were cut off by your lips crashing down into his, his moans being drank down by you as he came instantly, shaking in your grasp as he thrusted up deeply into your pussy. The thumb on your clit never stopped as he came, stroking it alongside the bottom of the nub and whining at how it made you tighten down around him. “S-so *good*, can’ stop, plea-se” Choso cried into you, his arms stiffening into a tight grip that left no room to squirm or move away from him.
You whimpered and squeaked at Choso’s uneven, rapid thrusts up into you, his tip threatening to kiss your cervix as he sloppily rode out his orgasm inside you. You could feel the way his full balls emptied out as he grinded his hips down inside you, low groans vibrating against the skin of your neck and making you shiver when they reached your ear. You needily bucked up into him as his fingers pressed down onto your clit, eyelids lowering as your own orgasm was starting to form, just barely. Though, the feeling of tension left as soon as it came, Choso stopping his movements when he was done emptying his load inside of you
You made a noise of discontent as Choso’s thumb moved away from your pussy, clenching down weakly as he pulled out his softening cock from inside you. “Cho…I was gonna cum” You moaned, grunting as he flipped you onto your back. “I know..lemme use my mouth, please?” Choso uttered gently, his body crouched between your spread legs, with his eyes wide and hopeful staring up at you. You resisted the urge to smile as you nodded, shivering at how fast he dipped his head down between your legs
2K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
hello 😘 aaron hotchner drabble request!
anything with jealousy and possessiveness but in a natural normal way not a joe goldberg way haha
and also - aaron sees you wearing his hoodie/shirt drabble!
thank you and your work is amazing!
pairing: aaron hotchner x bau!fem!reader
genre: established relationship, aaron is a little (a lot) upset
warnings: misogynistic moron >:( reader wears a skirt, if you get the reference ily
a/n: i wrote it and the more i wrote the more i realised that it... really isn't the same at all :( if you want me to redo it, please send me an ask !! thank you lovely <3
wc: 631
“You would think that he would know by now,” Emily hums, her tone disapproving and mostly disappointed as she watches from a distance as Captain Pembroke attempts to chat you up.
“He’s a captain?” Spencer asks in genuine amazement.
“For NYPD’s major crime unit,” JJ confirms, her arms crossed over her chest. “He tried to hit on Emily a couple days ago, and on Amy from the fourth floor. I wouldn’t be surprised it he has some sort of sealed file on him.”
Emily scoffs a little, rolling her eyes. “Sounds like a charmer.”
“The bigger question is, does Hotch know?” Derek pipes up as he glances in your direction.
“Well…” JJ lets out a nervous laugh. “I kind of hope he doesn’t.”
You offer a curt smile in Pembroke’s direction, doing everything in your power to subtly signal that you really should be leaving. Fiddling with the loose threads of your shirt, averting eye contact, taking tiny steps away in hopes that he’ll somehow get the message. It isn’t surprising that he doesn’t.
“I beat my PR yesterday, you know,” he brags, flexing his muscles. You think you’re about to throw up as he continues, “129. Impressive, right, hun?”
“The average amount of pounds an untrained man can lift is 135,” you respond dismissively in an attempt to lean into Spencer’s way of getting people to leave him alone, but Pembroke doesn’t seem to hear you.
“You know, sweets, I don’t think you should even be in this job. You’re far too foxy,” he says with a wink, “You’d be better in a different job. I mean, women aren’t fit for these types of roles. They get too emotional.”
You refrain from punching his face as it will only prove his point. “Listen, Ken–”
“It’s Keith–”
“Kyle,” you amend with a sickly smile. “I do need to get these files to Agent Rossi, so if you’ll excuse me…”
“Aw, come on, it was only a joke,” Pembroke says with a laugh. “It’ll be fine–”
“There you are.”
You don’t think you’ve ever felt more relieved in your life. Aaron’s hand rests flat against your back, dangerously close to the waistband of your skirt and he stands behind you. Aaron is a good couple of inches taller than Pembroke, especially when he stands at his full height, his dark eyed narrowed and his jaw clenched.
“Did you need something from my agent, Captain?” He asks lowly.
“Just pleasant conversation,” Pembroke responds dismissively.
Aaron raises an eyebrow, his gaze shifting from your uncomfortable frown to the captain’s smug face. “We have three missing women and you are disturbing an investigation by disrupting my agents. I suggest you get your act together before I report you to your superiors for harassment.”
He doesn’t bother waiting for a response, guiding you by the small of your back towards his makeshift office in the New York Police Office. He doesn’t say a word until the door is firmly closed and the blinds are drawn.
“Are you alright?” He asks softly, taking a step towards you and curling his fingers by your cheekbone. “I heard what he said. Do you want me to report it?”
“I’ve dealt with worse.” You don’t mean to sound so honest when you say it and his frown deepens.
“That’s not okay, honey.” Aaron presses a kiss to your forehead. “I’ll report it. You know how it is with cases like these; someone just has to put the first step forward.”
You smile at that, poking at his cheeks. “I thought you were going to hit him.”
“I thought you would’ve beat me to it,” he admits through a quiet laugh, giving you a proper kiss. “We shouldn’t make this into a habit.”
“Tell that to Kimberly.”
“That isn’t even close.”
reblogs are always appreciated!
events page
968 notes
·
View notes
This is my first time requesting here, so...
Hi! Mind if I send in a request? Hear me out: the track club bois, the basketball club bois and the spelldrive club bois getting a kiss on the cheek from the reader after a successful game/track meet
A KISS FOR THE VICTOR
SUMMARY: After a successful club meet, you give them a kiss on the cheek! How do they react?
WARNINGS: Some of these may be out of character (I’m sorry I still have no clue how to write Jack, Leona and Floyd)
COMMENTS: Hi! Sorry it’s taken me so long to get to this request, there were a lot of boys hehe! I hope you don’t mind but since there are a lot I did shorter headcanons instead of a full thing for each boy. Also, since I have no experience writing kisses yet, I just did their reactions. I hope that’s okay! This is such a cute prompt though, thank you so much for requesting it!!
Also, if you enjoy this, please consider checking out my 200 followers event!
TRACK CLUB
Jack froze, his eyes going wide. He coughed into his fist and looked away, desperately trying to regain his composure. A herculean feat, considering how adorable you looked gazing up at him like that. He smiles at you hesitantly - a small, wavering smile, before his cheeks go pink and he turns away to talk to his teammates. Although it seems he does not care, a keen eye will notice how his ears won’t stop twitching and his tail keeps wagging.
Poor boy stopped responding immediately. He tripped on the sidewalk and almost fell over, he got so flustered. He can’t concentrate on anything now. He’s really sorry, he’s trying his best to listen to what you have to say, but his mind is replaying that kiss over and over… He can’t look you in the eye for the next few days. The moment he gets to crash in his room, he calls his mum. He briefly talked about his match, but mostly talked about you. How does he talk to you again after that?? He might be a little awkward over the next couple of days, but know that you’re constantly on his mind and in his heart.
BASKETBALL CLUB
Oh? You’re gonna give him a kiss? Well tough luck, he expects one every match from now on! So what if he doesn’t win? He wants one anyway! That’s how you can cheer him up after a match from now on! But in the moment, he’s picking you up and spinning you around. His face is very red - whether from the exercise or from you, it’s hard to tell, but the bright red ears are a dead giveaway. He’s not gonna forget what you did, and loves to remind you - in the hopes that you’ll do it again.
Time stops for him and he stares at you, dumbfounded. His face heats up and boy does he wish he had his hood right now. He can’t talk to you or face you for the next hour as he struggles to figure out what to say. He does however feel really smug. Everyone in the match did super well, but he was the only one who got a kiss! From you! Ha! …wait. He was the only one who got a kiss. From you. He’s confused and flustered all over again. Please confess to him before he goes insane.
Ehhh~? Shrimpy’s giving him a kiss? Only one on the cheek? Screw that, he’s gonna give you an actual kiss! And a squeeze to boot. The moment you give him a kiss he registers that kisses are okay in whatever relationship you and he have and boy is he gonna abuse that. What are the two of you? He doesn’t care as long as you don’t, but if he makes you uncomfortable then he wants to know. Like Ace, he’s going to be expecting one for every match now, but if you don’t give him a kiss for some reason that won’t stop him giving you one~!
SPELLDRIVE CLUB
You thought Ace was bad? Leona’s gonna be so much worse. He doesn’t tease you quite as much, but he’s going to be incredibly smug, both after the track meeting and for the next couple of weeks after. Please be prepared for suddenly more Leona in your life, as the moment you press a kiss to his cheek he’s going to take that as a rite of passage to be almost constantly around you. He will encourage you to ditch class with him as much as possible. He just wants to spend more time with you now, and after that kiss, surely that means you want that too, right?
Ruggie nervously laughs it off, his cheeks going bright pink as he fumbles for something to say. He honestly, genuinely wasn’t expecting it - you managed to catch him so off guard that he doesn’t quite know how to act. Ah, but he’s not upset! He’s exactly the opposite of that, if anything. Elated, maybe? Who cares, his crush just kissed him! He is going to be bragging so hard to Leona and anyone who’ll listen afterwards. Maybe he’ll start giving you a couple more snacks - with a kiss as payment of course! Shishishi.
LET’S FREAKING GOOO. wait. Did you just kiss me-? Epel was in such a good mood after his match that his brain didn’t fully register that you just kissed him. He takes a break from celebrating for a moment to double check. When you confirm that yes, in fact, you did kiss him, his cheeks go apple red and he starts celebrating way harder. Calm down? He can’t calm down, this is the best day of his life! He won a match and got a kiss from a cutie to boot! The only thing that makes him calm down a little is Vil threatening to smack him with his shoe.
♥Thank you for reading!! I hope you enjoyed it!!♥
1K notes
·
View notes
✱ confessing to you w/ Gojo, Nanami, Higuruma & gn!reader
@snailor-bee asked: LALEEEEE!!! (o゜▽゜)o♥ WHAT'S THIS I HEAR?? REQUESTS ARE OPEN?? FOR MORE FANDOMS?? You just know I just gotta...
May I please request Gojo, Higuruma, and Nanami trying to confess to reader? (*/ω\*) Like headcanons/drabbles whichever. I just think it's real cute. And you're real cute. It just works out perfectly, hehe.
Hoping you're doing well!! ;3; Sending you hugs and kisses!!
a/n: BEE my sweet (´⌣`ʃƪ) it feels like forever since i for around writing something for you, so i was super excited when you sent something in for me! i had a lot of fun writing these small drabbles, i hope they're to your liking! ps: i think YOU are super cute love you ok bye
➸ 𝐩𝐚𝐫𝐭 𝟐: Geto, Toji & Shiu
❦ 𝐆𝐎𝐉𝐎
Gojo is used to being fawned on. He has the good looks and he knows. Keeps running his mouth without any consequences because there simply are none when you’re Gojo Satoru. The strongest. The balance of the world depends on him. He’s untouchable.
And then there’s you, who is tearing his whole act down with such ease, it makes his heart stop.
You don’t fuss over him and you don’t bow before him. His name doesn’t fall out of your mouth as if he was a deity, someone holy; and still it’s the sweetest sound he has ever heard. When you call out for him, Gojo wants to be there in an instant. There’s this unknown calmth whenever he’s with you, his heart feeling lightweight somehow. He’s drawn to you like the tide to the moon.
For someone as grand as Gojo, he loves so quietly.
He can’t bring himself to say those words out loud, as if they carried a weight that threatened what you two have. Still, he doesn’t know what to do with all this love; he never learned where to put it down. You can handle it, can you? The burden and the curse of being loved? You wouldn’t be scared to love him back, right?
So Gojo makes sure to show you his love in the most mundane things, so there’s no room for doubt just how tight he holds you in his heart. Midnight strolls to the candy aisle at the supermarket. I love you. A hand on the small of your back when you’re moving through a large crowd. I love you. Your fingertips brushing over his long white lashes while he rests his weary head in your lap under the cherry blossoms. I love you.
It’s only when you kiss him one night, in the middle of the parking lot, that those big words get caught in his throat. Six eyes aren’t enough to comprehend the feeling in his chest when his big hands cup your face, as if he wants to hinder you from ever pulling away from him. It would be so easy to mumble his confession against your lips, but you already know. So instead he simply kisses you back, sweeping you off your feet when you lose your balance from being on your tiptoes.
He smiles when you shush him with another kiss. He doesn’t need to say it out loud; you know, you’ve always known.
❦ 𝐍𝐀𝐍𝐀𝐌𝐈
Nanami’s confession is apologetic.
The words have been weighing on his heart until one night, they just fall out of his mouth. Maybe he had one drink too many, not enough to be drunk, but enough to loosen his tongue. His thumb rubbing over the rim of his glass, his shirt slightly unbuttoned, his tie not so accurate anymore. He isn’t looking at you; it’s easier if his gaze doesn’t catch yours, if his eyes can’t wander to your lips. Your hands are next to each other on the bar counter, almost touching. He could close the distance so easily, but he’s aware that he wouldn’t be able to let go of your hand anymore.
“I’m in love with you.”
His voice is low, whisky-raspy. The silence that follows isn’t uncomfortable; it’s a warmth that’s surrounding you like a veil. At this moment, it’s just you and him. In another life, this could have been so easy, couldn’t it? In a life where he doesn't have to worry about fighting curses, and the horrors humans are capable of, and about the day he might not come back home to you from work. He wouldn’t have to break your heart like that.
“So deeply, utterly in love with you.”
In another life, you could have had it all. The shared books on the nightstand, the matching rings on your fingers, the messy blankets in the morning. Maybe he was being greedy, yearning for this. He couldn’t help himself when you tugged on his heartstrings like that. He tried to fight it, this attraction to you; but the more he tried to keep his distance, the more he yearned for a glimpse of your attention. Your bright smile from the other side of the room–it should have been enough. And still…
“I hope you can forgive me.”
Was it really greed that made him cradle your face in his palms, gazing into your eyes before leaning in for a kiss? No… no. But he knows he can never let go of you now, not when he tasted the sweetness of your lips. Not when you kiss him back with such hunger, years of yearning unraveling in this very moment. Not when forgiveness lies on the tip of your tongue, asking to be devoured. All he can do is hope that when his time comes, you’ll let him pick up the pieces of your broken heart and that the light of your love will guide him somewhere south; back to the warmth the two of you feel in this very moment with his lips on yours.
❦ 𝐇𝐈𝐆𝐔𝐑𝐔𝐌𝐀
Higuruma has no doubt in his heart regarding his feelings for you. They’re clear as day to him. His heart leaps in his chest when you enter a room and your laughter washes away all of his exhaustion for a bit.
He studied you from afar for a long time; he can read all of your small gestures and expressions like a language only you and him know. The way your tongue pokes out between your lips when you’re in deep focus, reading over a file from a case you’re working on with him. Your fingertips picking up a tiny piece of lint from his suit before you enter the courtroom together and the small smile playing on your lips when he looks over his shoulder to catch what you’re doing. That one strand of hair that seems to be loose no matter how often you try to tuck it away, much to your annoyance and his adoration.
“I’d like to ask you out.”
His words are as clear as his intentions. Higuruma is a straightforward man, not brash but gentle in his own way. With him, you don’t have to wonder what's between you two, he’ll tell you what’s on his mind and he’ll expect the same from you. Never pushy, but longing for connection, for mutual understanding. He sees no point in hiding his feelings and he knows you’re clever, you’ve probably had them figured out anyway.
Higuruma and you have to face them daily, the abysses of the human mind. It’s easy to let your heart go cold over them, to lose a bit of your own humanity. And yet, when your eyes meet, it’s all forgotten. It’s like he can see the essence of your soul and you can see his and it’s all golden; so golden.
You don’t pull away when his fingers weave between yours one night when you leave the office together. He feels a sense of relief wash over him in this moment, not because he was afraid that you wouldn’t reciprocate his feelings, but because his world got a bit brighter in this moment, a bit warmer. He missed this for much longer than he’d admit.
To Higuruma, loving you comes easy. It feels as natural as breathing. It calms him, as if you’re the eye of a storm. And so he doesn’t even hesitate to say those words out loud, almost stating them like a matter of fact, and sealing them with a kiss. Guilty of loving you.
2K notes
·
View notes
Hi girl ❤️ inhope it's ok to send in a request. i thought of something where the reader is working at the Avengers Compound and trains new agents, but one of them grows fond of her and like creeps up on her or follows her around all the time. Soon Bucky noticed that and decides to help. As the guy then again waits up on you and gets too close for Bucky's liking, he steps in between and kisses you passionately, making the creep leave and takes you by surprise. But what started as only some help, continues in Bucky's bedroom, revealing hidden feelings and passion 😏 i hope this is ok with you ❤️
we could've done it earlier
masterlist ko-fi ao3
Word count: 2.3k
Warnings: +18❗️creepy men, protective Bucky, smut, friends to lovers, idiots in love, dirty talk, unprotected sex
Author's note: well, that was fun to write. I hope you'll like it and that I saw the vision right. thank you for the request💘
You rolled your eyes again when you noticed that Kevin’s eyes stayed on your body for way too long. You had just finished another session of training with the new recruits from S.H.I.E.L.D. and everything was fine—most of them were really talented and eager to learn, but that one guy had acted super weird since the day Fury introduced you.
He always gave you weird looks, tried to flirt with you during the training and you swore that he was following you around the tower because you “accidentally” bumped into him and ended up in the same room more times than you could count.
You decided to forget about it for today and took a quick shower in the gym, and after changing your sweaty clothes, you went to the kitchen on Avenger’s floor to grab a snack.
You didn’t even have time to look through the cupboards when you saw a figure in the corner of your eye walking towards you.
“Mind some company?” Kevin stepped closer to you with that creepy smile on his face and scanned your body up and down once again.
“What are you doing here? It’s Avenger’s quarters; you shouldn’t be here.” You crossed your arms over your chest to hide from his stare.
“Well, I thought they could make an exception for me, especially since my favorite trainer lives here.” He stepped closer and you instantly stepped back. Yes, you were one of the Avengers, but it didn’t change the fact that he was a man who clearly had bad intentions towards you, so your body and mind worked differently around him. “And I also thought we could do something together, if you know what I’m talking about.”
“I don’t know what you are talking about, and I’m not interested in whatever you are suggesting. Please don’t overstep the line. I’m your trainer and nothing more.” You tried to talk firmly and confidently, even though your whole body was tensed from Kevin’s almost predatory stare. “I-I have a boyfriend. Don’t try to do anything.”
“You’re lying. I know that you want me. And I want you–” Kevin wanted to get closer to you, but a certain Super Soldier appeared out of nowhere, stood between you and him, and kissed you.
Bucky was watching this whole scene from the beginning. He also saw how that guy was following you around and just staring at you shamelessly.
Bucky had a crush on you since the day you met, but he didn’t try to change things between you, being too scared that you wouldn't ever talk to him again. At first, he thought that there were mutual feelings between you and Kevin because you were so sweet to everyone, but the more he paid attention, the more he noticed how uncomfortable you would get every time you spotted Kevin in the same room.
So when Bucky saw him following you once again, and this time being even more persistent, he knew that he should save you.
So he just stepped in and kissed you.
Was it stupid? Probably. Did he regret doing it? Not in the slightest way.
Your whole body froze, and your mind was overloaded with the unknown feeling of Bucky’s lips and his hands on your face while he was slowly kissing you. He kissed you as if he had all the time in the world, and as if Kevin, who was clearly confused and angry, was not standing right behind him.
Bucky slightly pulled away, not letting go of your face, and looked back at Kevin. “Do you have a problem with my girlfriend?” His stare could scare anyone, and the way all the color washed away from Kevin’s made him feel weirdly satisfied.
He looked back at you, not missing how your pupils were dilated and your mouth was slightly open in shock, before he captured your lips in another kiss. Now it was not so sweet, though. Bucky was clearly dominating over you, biting your lip and then licking it with his tongue.
You both didn’t notice how Kevin left. Too lost in each other’s touches, scents, and lips. It was addicting.
“I’m sorry for doing it without permission. Just wanted to scare him away from you.” Bucky mumbled against your lips, yet he didn’t move, not even an inch away from your body. Your eyes lowered to his lips, already craving to feel them again. And Bucky understood it straightaway. “Tell me to stop.” He knew that he was fucked up. Before, he was just observing you and trying to suppress his feelings, but now that he had finally touched and kissed you, he couldn’t hide it anymore.
Your head was feeling fuzzy, while your hands were clenching onto Bucky’s shirt. You could barely understand what he was saying to you, but that familiar heat in your stomach appeared again, as it did every time he called you “doll” or smiled.
“Please don’t…” You whine, pulling him even closer. “I want you. I need you, Buck.” You kissed him this time, raising one hand to bury it in his fluffy and soft hair. Bucky moaned in your mouth when you slightly dragged your nails along his scalp.
He gripped your waist with both of his hands and then let the metal one slide down to the back side of your thigh. Bucky mumbled a raspy “jump”, and you, without hesitation, followed his command, wrapping your legs around his waist.
You both moaned when your clothed core met the hardness in his jeans. As if it were an instinct, you moved your hips, trying to do something to relieve that aching feeling in your body.
“Stop moving, or I’ll fuck you right in this kitchen, doll.”
It was shameful how quickly you would’ve agreed to do that.
After firmly settling you in place, Bucky went to his room without a struggle, carrying your weight and kissing the heated skin of your neck. As soon as the door was closed and you were gently placed on a perfectly made bed, you both became even more greedy for each other.
Tugging clothes, pulling hair, and biting each other’s lips and skin. Bucky's firm body was pressing against yours, and you nearly drowned in the mattress. Bucky's cock became even harder when he finally got a good look at your face—half-closed eyes, smollen red lips, completely messed-up hair. You looked fucking majestic.
“You are so fucking beautiful, Y/N. Fuck, I wanted to do it for so long.” He said it harshly, trying to catch a breath.
“Me too. Me too, Bucky… Oh God, it almost hurts.” You tried to move your lower body upwards to grind yourself on something, but Bucky just smirked at you and pinned you back to the bed.
“Be patient and let me have my time with you, doll.”
“Not now, please. James. I need it. Just fuck me. We can do whatever you want later. ” You almost cried, your hands sliding under Bucky’s shirt and sending shudders down his back. Who was he to decline your request when you asked so nicely?
When he just slightly nodded to your words, you lifted up your arms, allowing Bucky to take off your oversized t-shirt. He almost choked on his saliva when he discovered that you were naked underneath it.
“I love the twenty-first century.” Your laugh quickly turned into a moan when Bucky took one of your nipples into his mouth and pinched the other one with his fingers. The way he tried to be so gentle with his metal arm didn’t go unnoticed by you. He was always so careful not to hurt you in any possible way, but this felt much more intimate, deeper.
After finally being satisfied with his work on your tits, Bucky trailed a way of kisses down to your leggings, slightly pushed the waistband down and teased you with his wet tongue, almost in the place where you wanted him the most.
“Just take it off.”
Bucky stood on his knees in between your legs and pulled down your pants and underwear, throwing them on the floor. “Dear fucking God. I’ll have my sweet time with her later.” He licked his lips, eyes glued to your wet folds. You just wined at his words, slightly pressing your legs together to exert some kind of pressure on your swollen clit.
Bucky hesitated to take off his shirt. Being too lost in you, he almost forgot about his metal arm. But you were on his bed, naked, impatient, and only with lust written in your eyes. He knew you wouldn't judge him.
Actually, you had never seen Bucky without clothes; only once did you catch him after the gym in the tightest possible t-shirt that revealed every little muscle on his chest and press. But holy shit, seeing him naked was shocking in the best possible way. His perfectly sculpted body, tanned skin, and slightly dingling silver dog tags made your mouth water with the need to kiss every centimeter of him. When your eyes shifted a little bit higher and caught the tormented skin on his shoulder, you felt nothing but sadness and pride for Bucky being so strong.
“You’re pretty.” The pink color spread to Bucky’s ears at your words. “And I want you all. Buck, you better hurry up and undress or I will have to handle this on my own." You slowly lowered your hand in between your legs to tease him and ease the tension in Bucky’s body, and you saw it working by the way his eyes were laser-focused on your actions.
“You’re playing with fire, doll.” He lowered his body on yours again, pushing away your hand, but instead pinned it above your head and kissed you. His free hand finally unbuckled his pants, and he did not bother taking them completely off—he just pushed them down slightly because he did not want to lose the sensation of being so close to you. “Oh fuuuck—” Bucky moaned as his cock touched your lower stomach and you could help but drag your eyes there.
"There's no way you’re walking around with this…” You whispered in disbelief.
“Mhm, you’ll get used to it.” He gave you a cocky smile. “Um, do you want me to find a condom? Fuck, I don’t have it.” The worry appeared in Bucky’s face and he looked around the room, as if the box could just magically appear somewhere.
“No-no, Bucky, just fuck me. Please. I’m on birth control. I need you in me right now.” You were too desperate, wrapping your legs around his body and pushing him closer. The tip of his hard cock slipped across your pussy and you both hissed at the feeling.
Bucky nodded more to himself and finally reached in between your bodies, gave himself a few pumps and started pushing inside of you. The stretch was almost painful, but at the same time, it was the best thing you had ever felt.
He couldn’t hold it inside anymore. As soon as you took every inch of him, Bucky started moving in a steady rhythm. He lost himself in the way he fit so perfectly into you. He was fucking you without mercy. You gripped his shoulder with your free hand, while the non-stop moans escaped your mouth with every movement. Your body was jumping up and down on the bed; your eyes rolled back in pleasure and not a single thought flashed through your head.
“So good for me. You’re taking me so well, doll. Just like that.” He was practically splitting you apart with his cock, but it seemed like you became even wetter with every second. If you weren’t too lost in pleasure, you would be ashamed of the way you made a total mess on his cock and thighs.
Bucky, on the other hand, did not seem to mind; he kept pounding into you, sensing how you clenched tighter around him as you got closer to the orgasm. He freed your hand and grabbed your face so you would stay focused on his face.
“Tell me how good you feel, baby. Your sweet juice is practically soaking my bed.” He said it without losing the speed of his thrusts or breaking eye contact.
“So good– Bucky! Oh my fucking God.” You moaned through greated teeth, barely being able to keep your eyes open.
“Are you going to cum, sweet girl? Gonna milk my cock?” His face got closer to yours, so your lips barely touched when his was talking. You wanted to cry, moan, scream, or do everything all at once when the pure bliss washed over you. “Ye-e-es, that’s it, baby. Take it all, fuck!”
Bucky pushed his cock into your spasming pussy a few more times before he groanted somewhere near your ear and you felt the hot liquid covering your insides. You both were heavily breathing, clinging closer to each other. You felt too hot and sweaty; the feeling of Bucky’s heavy body covering your smaller form was so calming and safe. Bucky hummed into your neck when you wrapped your hands around his shoulders and lowered his flesh one to sofly trace the delicate skin of your thigh.
“I can’t believe that we wasted so much time. We could’ve done it earlier.” Bucky rolled to his side, dragging you with him. He pushed your hair out of your face, and his hand stayed on your cheek for a few seconds while he was admiring you.
“We’re idiots.” You giggled and bit your lip, looking at Bucky.
“We totally are. But I won’t let you go again.”
You were just staring at each other, smiling. It felt so natural to be in his arms, surrounded by his scent and warmth, as if it were supposed to have happened a long time ago. Bucky couldn’t help but move forward to capture your lips in another sweet kiss.
Everything finally fell into place.
1K notes
·
View notes
Getting fucked by ghostface!Billy in an alley on your way back from Tatum’s. He tried to scare you and pull this little stunt, but you figure out it was him
More Billy, YES (this is 1.5k, enjoy)
Please read the warnings before reading this one, some of the content might make you uncomfortable or be triggering for you
Warnings: 18+, dub-con, semi-public sex, p + v, non-protected sex, creampie,
my taglists are here + you can send requests here at any time
—
‘’Are you sure you don’t want to wait for Dewey to drive you home? He should be there at ten,’’ Tatum asked again as you were getting ready to leave. ‘’The psychos are out at this hour...’’
You declined her offer. ‘’I can’t. My parents will have my head if I'm not home before curfew.’’ You grabbed your backpack and opened the door. ‘’See you tomorrow!’’ You waved at her before stepping out and closing the door.
The chill autumn air brushing your face and the fallen leaves swished on the ground around you as you walked down the Rileys’ driveway and took the sidewalk. You didn’t particularly enjoy walking alone at night — no women did, honestly —, but Tatum’s house was only a few blocks from yours.
On the way, you admired all the carved pumpkins out on the porches and other halloween decorations, making you miss when you were kids. Halloween was still fun as a teenager, but no parties could beat trick-or-treating and exchanging candies with your friends.
As you turned on Elm street, a growing unease pricked at your senses. Someone was following you. Your steps became quicker, but not quick enough that your change of pace would alert the person behind you. The last thing you wanted was to let him know that you knew he was following you. He could take a run after you and it would be done for you.
You thought of going back to Tatum’s, maybe Dewey was home from work, but you were almost home. Instead, you took the shortcut to your house and turned in an alley, thinking you could kick a trash can at your pursuer's feet in case he tried anything, but a shadow loomed over you. Panic surged through you, and before you could react, a gloved hand swiftly clamped over your mouth, stifling the scream that tried to escape.
Fear pulsed within you, your mind racing to comprehend the situation. You struggled against the grip, your instincts kicking in as you fought to break free. The scent of leather filled your nostrils as you twisted and wriggled, attempting to loosen the stranger's hold.
A distorted voice pierced the air, its chilling words sending a shiver down your spine. ‘’Don’t you know walking home by yourself at night is a danger-magnet? Especially with a tight little skirt like yours,’’ he said as the hand that wasn’t over your mouth slid up your thigh, making your heart race in fear of what was going to happen.
A sickening feeling twisted in your stomach. Maybe you should have waited for Dewey to drive you home. Your parents would have been mad for not respecting your curfew, but at least you would have been safe.
You tried to scream again, and fight back, but the stranger only laughed at your attempts.
‘’You’re not gonna escape me, babydoll,’’ the distorted voice laughed, tightening their grip and pressing your front against the brick wall of a building. ‘’If you try, I’ll gut you like a fish.’’ Something cool touched your leg and tears pricked in your eyes.
A knife.
Tatum was right about psychos being out at this hour…
You turned your head slightly, trying to see who was holding you, but all you saw was a strange halloween white mask with a black hood.
‘’Have you ever been told how good your ass looked in that skirt? Bet your boyfriend likes to take you from behind, uh?’’ The hand that was on your thigh moved up, pulling your skirt and lifting it up, making your skin crawl.
The night air hit your bare ass, completely exposed to the masked stranger, and you pressed your thighs together. You doubted it would stop the man from doing anything, but you could at least try.
‘’Mmh, what a nice ass,’’ he pointed out, smacking his hand on your ass-cheek, the sound resonating in the alley, and grabbing it. You squeaked at the impact. ‘’I can’t wait to feel it against me as I pound in your tight pussy.’’
Your stomach churned. Your night was turning into a nightmare.
‘’Now, I’m gonna take my hand off your mouth, but if you dare scream…’’ he trailed with a threat.
You nodded, having no other choice. He was the one with the knife.
‘’Spread those legs, hands on the wall,’’ he ordered, the distorted voice glitching a little, causing you to hear the man’s real voice. It sounded familiar, like you had heard it before, but a lot of men had similar voices.
Shaking that thought, you obeyed and parted your legs, holding a hiss when pressing your hands against the rough brick.
‘’Now what?’’ you spat, looking over your shoulder.
The stranger chuckled, then pushed himself up against the curve of your ass, letting you feel his erection through his clothes, the hardness and heat radiating from his body admittedly kind of hot. ‘’Now I'm gonna stick it in you and rearrange your insides, you dumb fucking bitch.’’
You gasped at his words, arousal leaking through your panties.
A car drove by on the other end of the alley, making the both of you go completely still. Minutes ago, you would have been relieved that a car was driving by. Not anymore. A sick and twisted part of you wanted the masked stranger to fuck you against that wall.
Once the car was out of earshot, the masked man another grope of your ass, then pulled aside your underwear, running a gloved hand over your folds and discovering your little secret.
‘’Is this…turning you on?’’
You kept quiet, disgusted and ashamed of yourself.
He laughed, keeping going with the teasing by pressing a finger inside you, making you gasp as you automatically clamped around it. ‘’It is turning you on.’’ You heard the smirk in his voice. ‘’Dirty little slut.’’
You whined at his words, his finger moving in and out, but not nearly enough. ‘’Please,’’ you surprised yourself by saying, chasing his finger. ‘’I need more.’’
If anyone were to see you right now, you would be mortified. Not only were you getting sexually assaulted by a masked stranger in an alley, but you were enjoying it. It was sick.
Much too soon, he removed his finger, making you whine in protest. You turned your head to glance at him, but his head was down and you couldn’t see much.
‘’Think you can handle my cock in you? Your slutty little cunt is weeping around my finger,’’ he said as he reached beneath his robe, fighting with his belt buckle and zipper to free himself.
Your stomach bubbled with excitement, your teeth catching your bottom lip when you felt his hard cock pressing against your entrance. You pushed back against him, the hard press of his tip prodding at you, his pre-cum mixing with your leaking arousal.
Your jaw dropped as you felt his cock part your folds, pushing himself all the way inside before stilling for a few seconds. Fuck. His dick was filling you so good. He gave a first snap of hips and a moan escaped from your lips, louder than you were expecting.
Behind you, the masked man stopped moving, clamping a hand over your mouth as he hissed in your ear. ‘’Keep quiet or I’ll stop playing with your cute little cunt. Can't get caught, can we?’’ he warned, forgetting to use the voice distorter and giving himself away.
‘’Billy Loomis, you sick fu—’’
Your words were cut off as his thick cock plunged back into you, making you moan instead.
Billy laughed. ‘’Surprise, babydoll.’’ He gripped your hip firmly with one hand, the second coming around your throat while he was pounding in you from behind, stars flying around in your vision as the pleasure filled your whole body, explicit groans and muffled moans filling the dark alley.
‘’Always so fucking tight,’’ he grunted, getting really hot under the mask. Halloween costumes were not made to be worn during sex.
You tried your best to brace yourself, both hands flat on the brick wall as Billy kept pistoning into you, your legs were shaking with the intensity of the pleasure he was giving you. ‘’Ahh, yes, just like that!’’
After he emptied himself and rode the waves of your respective pleasure, Billy slipped out from you, a white string of hot cum connecting you to him. He smirked under the mask, loving to watching himself leak from your abused pussy and drip out and down your leg.
‘’You’re insane,’’ you said, turning around to face your boyfriend, your wrinkled skirt still bunched up at your waist.
Laughing, Billy pulled the mask off his face, his lips curved into a wicked grin. ‘’The best people are.’’
You both fixed yourself in silence, having enough played with public indecency for tonight. As thrilling and exciting as this had been, you didn’t want an actual stranger to see you exposed like that.
‘’How did you know I just left Tatum’s?’’
‘’Stu,’’ he explained. ‘’Tatum called him saying you just left, so I put on that sweet little costume and decided to surprise you. Did you like it?’’
You grabbed the front of the black robe and kissed him in response.
—
Scream taglist: @misfityanii @beautybyfire @iluvscream191 @mariposa555 @bella7866 @o638 @lulubelle14 @luvvtxinityy @frasersgf @Eddiefrickenmunson @jasperr-the-friendly-ghost @ghostf4cee @thesebitcheslovesosadotcom @wandaswigglywoos @xjennyx2 @jennasslut @thatonesblog @mikaelsonsstuff @icarly23 @tcddszn @bt.oliana @skyesthebomb @a1mzcruml3y @red1culous @iluurmom @popeheywardssecretgf @michaelangdonsslut @byhrxb @kamthecoolest @kattybug @ravenstrueluv @landryslxys @die4niyahhh @sl4sh3rfuck3r @radiant-whore @Meadzy21 @luci1fer @nomorespahgetti @bloodyhw @depthsofdespairr @bellysbeach @wilmalovegood @loupiotesworld @wenvierismycomfort @t-candy @s-al-em @darylscvmdumpster @tommysaxes @adaydreamaway08 @johannelis2302nely @aqshua @lynbubble @luiise @planetkt @vampyrgoff
All and more taglist: @spiokybirdstarfish @kenqki @liidiaaag @hawkegfs @gillybear17 @areaderinlove @acornacreacure @black-rose-29 @fudge13 @cece05 @rosie-cameron @Caxddce @laylasbunbunny @gemofthenight @beautyb1ade @hi-bored-as-fcuk-rn @lovelyy-moonlight @mellabella101 @vxnity713 @marzipaanz @bisexualgirlsblog @queenofslytherin889 @thatbxtchesblog @softb-tterfly @ethanlandrycanbreakmyheart @xyzstar @graceberman3 @Heartsforneteyamsully @aerangi @hallecarey1 @bxbyyyjocelyn @mikeyspinkcup
2K notes
·
View notes
hi i saw that you mentioned you’d do Obey Me Characters react to you being jealous and was wondering if you did it, cause i couldn’t find it 😅. and if not.. well i guess this is a request haha thank you 🫶
The brothers reacting to a jealous MC
Notes: Omg it's been yeaaaaars since I talked about that jsnsjqh I totally forgot
Gender: neutral
Warnings: none
Masterlist
Lucifer
Saying that he doesn't enjoy the scene that unfolds before him would be a lie. You're standing there with your arms crossed and a frown on your face, too proud to admit your jealousy
He might even tease you little bit and have that awful cocky grin form on his pretty lips. That frustrates you more than anything
"Don't be a fool, my love. As much as I take joy in seeing you like this I don't want you to feel insecure."
"I'm not insecure though. I trust you."
"I know, but nevertheless I want you to remember that you have no competition. You could never have competition."
Maybe it's his reassuring voice or the adoration that is oh so obvious in his eyes that makes the silly voice in the back of your head shut up. You believe him when he says that no one compares
Mammon
So many mixed feelings. On one hand he likes the thought of having his favorite person fight for him, but on the others he really doesn't want you to beat yourself up over this
Mammon is a party animal and incredibly outgoing so those traits naturally come with some side effects which is in this case an overly confident admirer. The same admirer who is currently experiencing the terror of a lifetime thanks to the deadly looks you're giving them
As much as a jerk your beloved boyfriend can be this time he's keeping his teasing comments to himself. On the contrary even. He's sending clear signals towards the other demon by displaying so much affection towards you to the point where you have to practically shove him off you. It still leaves you giggling and grinning
"What in Diavolo's name are you doing?!"
"What does it look like? I'm givin' ya the Mammon deluxe package!"
Leviathan
Of course he knows the feeling too well. After all he's struggling with keeping it at bay at the slightest interaction you have with other people. It's not his intention to hurt you or cage you in simply because he can't control himself
So out of all the brothers Levi is the one to react the fastest. He's already pulling you aside for a more private setting and tightly wraps his arms around you
"Please don't think anything of it! You're my number one and you always will be!"
The hug might or might not have been a way to hide his intense blush as he's saying those words. We all know that it takes a lot out of him
He will avoid the other person like a plague from that point on even if you stop being jealous of them. Someone only has to mention their name and he's jumping to his feet as if he got stung by something
Satan
He doesn't care about how others feel about him so when you first mention that he has an admirer he doesn't pay it any attention. You don't know if it relieves or bothers you to be honest
While Satan couldn't care less about such things he still does care how you feel in this situation. If you're uncomfortable with the way the other person is treating him then he will address it to them immediately
But beware! He thinks the problem is solved with that and most likely doesn't quite notice that it still bugs you. You literally have to bring it up to him, but don't worry. Everything after that is easy
"Please don't get this the wrong way. I trust you with all my heart, but I don't know...I guess I need some extra reassurance to be able to get passed it."
"No, don't apologize, my dear. I'll give you anything you need to have the issue solved."
Asmodeus
Us Asmo stans know that he comes with a price. The price being a comically large amount of fans who would kiss the ground he walks on
Usually you're not the type to be bothered by that, because you knew exactly what you agreed to when dating him and Asmo has done everything in his power to never let you feel insecure in this relationship
Unfortunately there is still this one specific person who you can't seem to stand at all. The thought of them alone turns your stomach upside down and has your blood boiling
Please feel more than free to bring it up to Asmo though! He doesn't want you to feel that way.
Since the beginning he's been doing nothing, but fight the allegations that he's not a loyal partner and only cares for one thing and you've been making sure that he knows how much you trust him
"I can tell them to step on the breaks and if they don't listen then I'll just be a bit more assertive."
"What exactly do you mean with assertive?"
"Don't you worry your pretty head, honey."
The next day this person magically vanished from all social media and for some reason Asmo doesn't want to give you any details, but you do know that his fanclub has something to do with it
Beelzebub
Like Satan he couldn't care less what other people feel towards him. He has his family and his own close circle that's all he really needs, but he's an extremely attentive boyfriend. Your sudden mood changes whenever this particular demon is mentioned or around don't go unnoticed
"Did they do something to hurt you?"
Beel-fight-mode is activated and he's looking around for that person, ready to knock the breath out of their lungs
"No, no! It's a bit...silly."
You're feelings aren't silly! They're valid! Just tell him what's going on and he will get to it immediately
If you need some extra reassurance after that then he's more than happy to cover you in love and affection
Belphegor
Is it bothering you enough to put up with his teasing? Don't give me that look. We both know that he's going to provoke the shit out of you
"Wow, is someone jealous?"
"I will punch you."
Yes, he will make you suffer for several days, but when he notices that you're genuinely hurting from it he will stop
He doesn't mind being rude to others to get his point across or to get you what you want. So, no. He's not breaking their heart. He's shattering it into million tiny pieces and stomps on the remains
Later that day when you two are cuddling in bed he's telling you that you're the only one for him as he drifts off to sleep kissing you
811 notes
·
View notes
hellooo I have a request for Spencer x bombshell! reader (I'm not sure if you've done this before and if you have I apologise!!) but like they're on a case and one of them gets pretty badly hurt somehow & then the other is really worried about them & stuff and then I'm not sure (I think this could be good but not the way that I have spoken about it and so I'm very very sorry!!)
u r so awesome don’t worry!!
cw canon typical violence and injury
Everything is crisp and quiet at the precipice of the stakeout. You adjust your gun where it’s poised over the roof of an SUV away from a moving officer’s body. The negotiator adjusts the megaphone at their thigh nervously, waiting for Hotch’s go ahead. You’re all waiting for it. A hand raised, sending you in, hostage recovered, a long case coming to a short close.
“Don’t forget your leg,” Spencer says to you under his breath.
“Trust me, babe, I can’t forget it,” you say back, glancing quickly at him to your left. He’s facing forward, trained on the window where you’d last seen the unsub. The distance between you both and the danger is small, less than three feet of space. You and Spencer don’t have a clear shot, the agent’s behind you better equipped and better trained, but you can make do in a pinch.
“Hurting?” he whispers.
“Half as bad as it was yesterday.”
“I have a bad feeling.”
“Yeah?” You follow Hotch’s hand. The negotiation begins. You and Spencer don’t talk again.
The unsub is sour, the victim terrified. When the screaming inside begins in earnest, the FBI rolls inside, confident in taking down the unsub, if a little worried about the victims wellbeing. You and Spencer sweep in less than ten inches away from each other, unafraid, and you don’t see the sledgehammer until it’s hitting you in the jaw, spraying blood like dark ink over Spencer’s pale cheek.
—
“I don’t care if that’s what you recommend.” A drag of a soft touch somewhere on your skin. “Sincerely. I want a second opinion.”
“It’s a mandibular fracture, we have a suitable follow up procedure.”
“I understand, but I’m doing what she’d want me to do. When she wakes up, she’ll say the same thing, and so there’s no point in starting the paperwork for a procedure she won’t agree to.”
“I doubt her cosmetic preferences will outweigh functionality.”
It’s Spencer’s voice, Spencer’s hand on your leg. He’s reaching back to hold you as he defends you. “Respectfully, you don’t know her. I don’t want to talk about it anymore. She needs peace and quiet.”
The doctor harrumphs but leaves. Quiet is restored, and for a while you doze, the only thing at your attention Spencer’s hand where it climbs. He takes your hand. You know his fingers well where they twine between yours.
A few hours pass by in sluggish slee, the bed elevated to an uncomfortable sitting position.
“Hey?” he asks, fingertips to the hill of your shoulder. “Are you waking up?”
You can’t make your mouth form words. Your eyes flash open in shock.
“Hey, don’t panic. I’m sorry, I’m going to explain, but please don’t panic.”
You wait.
Spencer stands in a rumpled shirt, hair in his eyes, glasses slipping down his nose. “Your jaw is broken, fractured, actually, pretty badly. You’ve had so much pain relief over the last few hours I’m surprised you can even open your eyes, and it’s good you’re struggling to move your mouth because it would only hurt anyways.” He claps your arm gently. “I’m sorry. I’m not going anywhere though, okay? I’m right here.”
That’s not what scares you; you know Spencer’s gonna stay. It’s not a question.
Your hand strays up to your face.
“It’s not bad,” he swears, and perhaps lies.
“Spence,” you manage, a croak that aches and lisps at once.
“It’s okay,” he says, leaning down. “Please don’t get upset.”
You blink tearfully. You don’t remember what happened, just the flash of pain and now Spencer looking down at you like you’re wounded. He sits carefully on the side of your bed and grabs you by the waist, two hands on your sides and arms resting on your stomach, like a hug that hasn’t crept forward.
“You won’t like the bruise,” he says apologetically.
“Bad?” you whisper.
“It’s all the way up to your eye. He also chipped two of your teeth… I’m so sorry, angel. It was my fault.” He thumbs your ribs. “I’ll fix everything. I already talked to your dentist, and tonight they’re coming back to talk about your plastics because the blow split your skin, okay? But you're mostly fixed already.”
“‘M I… still pretty?” you ask.
“Still the most beautiful girl I’ve ever seen,” he says, not half as shyly as he’d usually would.
You cry panicked, dribbly tears. He rubs shapes into your sides and swears again that it’ll all be okay, and it’s not that you don’t believe him, it’s just that it’s really starting to hurt.
“Had a bad feeling,” he says, wiping your tears as gently as he can before they can wet the bandaging on your jaw.
“Did you get him for me?” you ask.
Morgan clears his throat from the doorway to announce his arrival, a coffee cup in hand, pastry bag hanging between his pinky and marriage finger. He sounds like he’s about to laugh, “Did you, lover boy?” He beams at you. “I’ve never seen him pistol whip someone before. You would’ve loved it.”
You groan in agony. Missing out on seeing that is almost as bad as breaking your jaw.
“I’ll recreate it for you,” Spencer promises.
“And now it’s time for him to eat,” Morgan says, putting the pastry bag on the bed, “and get some sleep. He hasn’t slept in the two days you’ve been in here.”
“I had important stuff to take care of,” he says, rubbing your side. “While you couldn’t do it yourself.”
“Sleep,” you insist through your achy mouth.
Spencer’s eyes go soft and sad. “I will.”
1K notes
·
View notes
GOOD GIRLS GET BACKSHOTS - NANAMI KENTO
✴︎ summary: nanami has always been a gentleman, but he finally decides to play rough and mark you up -- at your request
✴︎ contents: 18+ only, pure filth, backshots, fingering (f!receiving), soft dom!nanami, degradation (slut), swearing, multiple orgasms, groping, pet names (sweetheart, baby)
✴︎ wc: 1,024
“Is this all it takes for you to be good?” Kento smiles, bending down to press a kiss to your back, making you shiver, “usually you’re so obstinate, but now,” his fingers slip into your hair again, tugging harshly, uncomfortable but sending pleasure right down to your core, your cunt still sensitive from his fingers that had bullied you a few moments before, “look at you, you’re so needy for me, so pliant,”
And you whimper in response, as his fingers slide down the front of your body, teasing your pebbling nipples, making you squirm, pulling a chuckle from his chest, “easy now, sweetheart,” he cooed, fingers pulling your hair lightly as a warning, “don’t want you to be a bad girl, now, you know what happens to bad girls, don’t you?” And he’s leaning down to nip at your exposed neck, as he teases his leaking cockhead against your dripping core, “they don’t get fucked,”
You whine, “Kento, please, I’ll be good, I’ll be so good for you,” and he’s smiling against your neck, as he kisses and then grazes your pulse with with teeth, sucking and nibbling, “please, fuck me,”
“Beg for me, baby, say it again,” and his rough hands, calloused from years of fighting curses, that gripped his blunt sword, slaughter demon, now gripped the soft flesh of your thighs, as he manhandled you into your hands and knees, your hands clutching at the sheets under you, “gonna fuck you, paint your back with my cum, just need to hear you say it again, sweetheart,”
And your face is nearly into the pillow, words muffled against it, arms shaking like jelly, unable to keep yourself up, until his fingers find your strand again, tugging you back into him, making your back arch, “Didn’t hear you, sweetheart, Speak clearly,”
“P-please, Kento, I need you, please fuck me,” you whine, cheeks burning by the noises leaving your lips, back arched against him, pressing against his front “Please—”
His hand slaps your ass, large palm bearing down on your cheeks meanly, “You asked for this,” he chuckles at your yelp, your ass lurching against him, “wanted me to punish you — to, what was it, ‘fuck you like the slut that you are?’” you hear the click of his belt, cold metal of the belt rubbing against your ass, “I wouldn’t use such vulgar words, but—“ his fingers press against your soaking cunt through your panties, making you gasp, “you love it, don’t you?”
“Yes, I do, I need—“ and his fingers slide your underwear aside, teasing your outer lips, as you keen against his touch, “Kento — don’t tease me—”
“How can I not, when you react this way?” a thick finger slides into your folds, your walls flutter around his finger, “fuck, practically sucking me in, sweetheart,” he grunts, finger curling against you, making you gasp at his touch and filthy words — Kento reserved swearing for moments like this, and these moments were what made it worth it, “you want me this bad? Gonna fucking break my cock in half at this rate,”
And he’s slipping another finger into you, and he’s stretching you out so pretty, melting into his touch, as your hips roll back into his palm, as your head lolls back and your eyes roll back, “So pretty, tell me who you belong to, baby,” his fingers fuck you, your ears ringing from the lewd squelching of your wet cunt, “tell me,” he orders, stern words making your walls tighten around his fingers.
“‘m all yours, just yours, i’m your needy baby,” you mewl, as his palm guides you to kiss him, gasping as a third finger joins you, pistoning in and out, deep, deep, deeper — “‘m about to cum, gonna—”
And he’s swallowing your moans and whines eagerly as you gush around your fingers, dripping, as he continues to fuck you through your orgasm — juices slipping down his palm, as you grind into his fingers, until you’re slumping against his broad chest.
You’re all too sensitive when his hardened tip is teasing your entrance, as you squeal, “Kento—I—” and he’s pressing his fingers into your mouth, letting you taste your release on his fingers, as his thick cock starts to sink into you, inch by inch.
“Easy now, love,” he murmurs, he’s got his thick arm around your middle, pressing your ass against him, “let me do what I promised I would,” and he’s bottoming out inside you, “you always take me so well, baby, you’re soaking me—“ and he’s rolling a nipple between his fingers, drawing a moan from your lips.
And he’s rolling his hips against you now, thrusting, “look at you, sweet baby is sucking me in — don’t want me to even pull out an inch,” you can hear the smile in his voice, even over the sweet lewd sounds of him fucking you — and you’re arching into him, your own hips driving back against him.
He’s gritting his teeth — you always made him cum so fast, but this was ridiculous — the way you were wrapped around him made him liable to burst any second. And when his calloused thumb reaches down to rub at your sensitive clit, you’re close — the telltale flutter of your walls.
“C-Close, Kento, please, I-I can’t st—“ and your walls tighten around him, “I’m—“
And you cum around his cock, curling your toes, as he grunts, pace growing sloppy, as his hips stutter, until he’s pulling out of your messy cunt, as his arm slips out from behind you, face down, as he pumps his cock, once, twice, groaning your name as he cums, spurting thick and white all over your back.
You’re moaning into your pillow, as his cum slides down your sides, as he’s grabbing his phone to snap a picture of you, spread out and fucked out with his seed all over you, as you slowly lift your head, turning to look back at him, small grin on your face.
And he’s grabbing a towel from off the bed to wipe you off, kissing your shoulder, “Told you, I always keep my promises to my good girl, baby.”
✴︎ a/n: so this is something i started writing and then finished today between larger projects. in honor of the episode today where we got to see bloodied nanami :)
✴︎ tag list: @crazychaoticizzy, @gloomyandpitty, @thesweetestqueenofall, @elmos-sockpuppet, @cedeslaneee, @bigdog-23, @dcoobar, @polarbvnny, @mooly-artistic, @jordanscomet, @erwinsrightnub, @btsisscience, @toastedsmoreo, @dragon-gals, @simpingoverfictionalman, @darling-arwen-rose, @itsfairly, @bunnysra, @funerals-with-cake, @scarlet-kazuha, @ichikanu, @porples-blog, @golden-estelle, @sugacor3, @beantokki, @batmansleftfoot, @ceceher, @minmin-minnie, @stillnotoverace, @arabzian, @cndp
2K notes
·
View notes
Hello! Can you do jjk men reaction when y/n said their safe word during sex? Only if you're not busy! Thank you! 😘
JJK MEN’S REACTIONS TO YOU USING YOUR SAFE WORD
FEATURED: gojo, geto, toji
WARNINGS: 18+ MDNI. fem reader, afab terms, use of safe word, descriptions of anxiety. please mind individual tws for each scene. proceed with caution and don’t read if it’ll make you feel bad! take care bbs
A/N: my first request i hate it but i hope you love it anon!!! 😊 also sorry i couldn’t do nanami or choso if i’m inspired another time i’ll add em to this LMAO
GOJO SATORU
warnings: reader is blindfolded and bound (wrists), use of safe word, unprotected sex, crying, descriptions of anxiety
you’ve done it a ton but it still makes you nervous.
one sense is kind of a lot to lose when you only have five of them, as a non sorcerer. but the relinquishing of control, entrusting your safety and pleasure and entire body to someone else… it turns you on beyond belief.
so here you are, tonight, blindfold tight over your eyes and hands bound behind your back as satoru fucks you, pace languid, fingers running all over your body.
any other day, it would be just what you needed to relax. any other day you’d be squirming in pleasure, hips bucking wildly against him as your nails claw at your own palms.
but today, for whatever reason, it’s uncomfortable. maybe you’ve had too much caffeine, maybe it’s the stress of his most recent mission, the first one to ever have you worrying your lip all night long thinking, maybe he’s not coming back this time.
his wandering hands feel foreign, the pleasured moans coming from his mouth sounding distant and wrong. your arms tingle from the position you’re in, your sweaty skin itches and you can’t reach to scratch at it.
you furrow your brows.
“satoru…” you whine softly, still unsure of what to ask for.
“mmm?,” he grips your waist, his strokes deep and precise. “my pretty baby looks so good like this. so mine.”
you whine, wriggling in search for comfort. satoru must mistake that for pleasure because he fucks you just a little bit harder, puffing out hot breaths into the crook of your neck.
“kiss me,” you ask, hoping it’ll make it better, but it does nothing to calm you down. with no stimuli but touch, your brain starts to go into overdrive, and you feel tears begin to trickle down your face.
satoru notices, but not in the right way.
“is it that good?” he teases, like he always does, but today it sends a chill down your spine. “i could do anything i wanted to you right now and you wouldn’t even know. wouldn’t be able to stop me.”
that does it for you, a wrecked sob leaving your lips along with your safe word.
satoru stills immediately. you can feel him softening inside you and for some reason that only makes you cry harder.
gently, he reaches behind your head to unhook the blindfold, his worried gaze searching your face for answers.
he lifts your back and unties your wrists, rubbing them to soothe the friction from the ropes.
“baby…” his tone is careful and guilty. “sweetheart, is everything okay? did i do something, what did i do?”
you sniff. the first words that come out of your mouth are, “i’m sorry.”
you’ve never had him so doting, so tense, all that confidence vanishing and it makes you chuckle, this big lanky man handling every limb of yours like they’re made out of snowflakes.
“satoru, i’m okay. i just…” you inhale deeply. “i just got overwhelmed, is all.”
he lays down beside you, visibly unsure about touching you. you grip his hand firmly in yours, offering him a wavering smile.
“i’m okay, i promise. you’re good,” you lean over to peck his lips.
satoru looks regretful, but he relaxes at the gesture, caressing the side of your face softly.
“i love you so much. i’m sorry if i, like, went too far or something—“
“you did nothing wrong,” you assure him. “i think i’m just having a bad day. just wanted to see your face to feel better.”
at that, he smirks. he kisses you slowly, adoringly, unspoken apologies every time your lips touch.
“i am sorry, by the way,” you say. satoru looks back at you with a confused expression on his face. you continue sheepishly, “for having to use the word.”
“huh?” he exclaims, his incredulity so earnest that it rips a hearty laugh from you. “nah, hell no. thank you for saying it, actually.”
“yeah? you’re not upset?”
“of course not. i completely understand,” he traces a line down your body. “not being able to see my handsome face would make anyone cry.”
you slap his hand away playfully and he pulls you into his chest, cuddling you.
you stay like that until you fall asleep, reassured that the most powerful sorcerer in the world is indeed fit to take care of you; heart, body and soul.
GETO SUGURU
warnings: overstim, degradation/humiliation and dirty talk, use of safe word, reader’s discomfort is brief but descriptive
you don’t know how long it’s been.
maybe ten minutes. maybe twenty. maybe ninety.
you don’t know how many times you came.
your entire body is covered in sweat, the top of your thighs and the bottom of your ass soaked in your own arousal.
suguru holds the wand to your clit almost disinterestedly, eyes glazed over and locked on your cunt.
he fucking loves it, making you cum over and over again, thrash against his body, make a mess on his sheets. and you love it just the same.
the undivided attention, the devotion, the seconds right after when the stimulation doesn’t stop and it hurts so bad before it gets mind-numbingly good again.
“hahh,” you breathe out, voice cracking. “i—i’m gonna—“
“oh, you’re gonna?” suguru mocks you. “shocking.”
you moan at his words, his tone. by now, your body barely has any energy left to react. all you can feel is the release of an unbelievable pressure in your core as wetness gushes out of you uncontrollably when you cum.
your puffy clit is throbbing, thoroughly abused, your spread legs quivering in pleasure. you sigh in anticipatory relief at the incoming break suguru is bound to give you after your orgasm.
except this time, the break doesn’t come.
“ahh!” you scream — honest to god yell — as the buzzing continues, suguru pressing the wand down hard on your pussy.
he chuckles, playing with the toy, lifting it up just slightly before bringing it back down on you, over and over again.
“can’t—i can’t, suguru, i can’t cum right now—“
“of course you can, baby,” he says in a sickeningly sweet voice, getting off on your desperation.
usually you’re just as much into it as he is, but this time it’s for real. it’s painful and not in the nice way, you’ve hit your limit but you can hardly talk, can’t do much more than try to wiggle away from your boyfriend’s ministrations.
“how can you say that when you have such a slutty pussy?” he runs his fingers through your slick folds, and every clench of your cunt makes it hurt even more. “so greedy…”
you’re clawing at his hands, but he’s so much stronger than you, his forearms and thighs holding you down, leaving you entirely to his mercy — of which he has none.
“please please fuck please no more—“
it’s something he’s heard you say a thousand times, in a thousand different scenarios, and never truly mean it, which is why you even have a safe word in the first place.
oh right. the safe word.
you pull it out from the depths of your fucked out, mushed up brain and blurt it, digging your heels into the mattress.
it all happens so fast, after that.
suguru all but tosses the wand to the side, switching to lightly stroking your pussy. it makes you jolt; even a gush of air right now could probably make you cry in overstimulation.
“oh fuck, shit,” he removes his hand and you whine. “what do you need baby, what can i do?”
“s-suguru…” you’re still trying to catch your breath, your legs spasming erratically.
“i’m here, i’m here,” suguru starts to move towards you but stops halfway. “do you want me to be here?”
you let out a croaky laugh, opening your arms because you’re too far gone to use words.
hesitantly, he lays his head on your chest. when he feels how fast your heart is beating, his own sinks to his stomach.
“i’m so sorry honey. i thought you were into it.”
you swallow, taking a few beats to regain your composure.
“i was, it was just… a lot, all of a sudden.”
suguru turns his head to look up at you.
“i get it,” he wipes away a stray tear you hadn’t even noticed you’d shed. “i’m sorry. i love you, i'm so sorry—”
“it’s okay,” you offer him a weak smile. “it’s what the word is for, right?”
“right…” he sounds unsure. that makes you frown.
you two lay there for a while, until your breathing has evened out, until your thighs have stopped shaking.
you can practically hear the hear the cogs in his brain turning, certain that his brain chastising himself.
“hey, suguru?” your voice rips him right out of his thoughts.
“hmm?”
“can you promise me something?”
he sits up in attention, instinctively reaching for your hand. “of course.”
“promise me you’re never gonna stop fucking me like that," he gulps, audibly, visibly relaxing. "and i promise to always let you know if i need to stop.”
it takes a beat, but suguru finally loosens up, pressing his smile into your lips over and over again and mumbling all sorts of promises of his own against them.
TOJI FUSHIGURO
warnings: knifeplay, cnc (sort of), roleplaying, pretty graphic descriptions of anxiety and panic, oral (m! receiving)
“what’s a pretty lil’ thing like you doin’ here this late at night?”
you roll your eyes to yourself before putting on your best innocent look to turn around and face the man.
he’s smirking down at you, the streetlight lamps casting dark shadows on his features.
if you were being honest with yourself, you’d never really been interested in roleplaying in your previous relationships. it was always so awkward and you never truly felt any incentive to stick to the script no matter how much the scenario excited you.
until you met toji, that is.
he was always so into it, played his parts convincingly well, which should probably worry you considering he would always opt to play the sleazy delivery guy, the pervy doctor, the horny stranger in a bar.
as for you, acting the part of the ditzy student or the clumsy maid or whatever the fuck toji wanted you to be that particular day… yeah, that was embarrassingly hot too.
tonight, he’s playing creepy guy in a dark alleyway. he’d texted you in advance, a very romantic meet me in that alley between the tracks and the highway. dress slutty.
“i was just looking for the station and got lost…” you mumble, looking up at him through your eyelashes. he pouts in a fake display of pity, twirling something inside his jacket pocket.
“oh, what a coincidence! i was just on my way there. care to accompany me?”
you smile sweetly, linking arms with him.
soon enough, you find yourself being shoved past toji’s apartment door, his pocketknife prodding at the small of your back.
you have to contain your giggles to stay in character, letting him toss you onto his bed. you also have to fight your anger when he slashes through your top, a sleazy smile on his face as he breaks character to say he’ll get you a new one.
he’s so goddamn hard that it should concern you, holding your jaw open while he feeds you his cock.
“god—shit, that’s right, such a slutty little mouth,” you moan around his length, hands resting primly on top of your thighs. “you were just begging for it, weren’t you, slut?”
you bob your head up and down, putting on a fake grimace while squeezing your legs together at the same time.
you hear something click in the distance, the sound barely registering in your brain as you get lost in the scent of him. he’s beginning to push into your throat now, laughing like a maniac when you choke on it.
“c’mon now, open up that throat for me, girl,” you inhale in preparation. but your breath gets caught in your throat when you feel something cold and sharp poke you. “or maybe i’ll just to do it for ya with this.”
toji’s pressing his switchblade to your neck, grazing it delicately up and down.
he’s not going to hurt you. you know that.
the blade is probably too dull to pierce skin even if he tried, but he would never, you know this, you know he won’t.
and yet despite that, your heart is jackhammering in your ribcage, uncontrolled and wild as your eyes widen around tears.
toji takes your inaction as a sign to just start fucking your mouth a little more, but your attention is zeroed in on that pocketknife.
suddenly colors are sharper, like it’s bright as day inside his dimly lit bedroom. a headache begins to bloom and you start choking in earnest now, not because toji’s going too hard but because you can’t coordinate your breaths.
he starts tracing your throat with the blade. “feel me right here sweetheart? fuck.”
you’re clearly struggling but it’s hard to distinguish your real reactions to the character you’re supposed to be playing. that only serves to make you panic even further, hands coming up to push on toji’s thighs.
“hands to yourself, whore,” he grunts, pressing the knife a little too hard, a little too close for comfort, and you hit your breaking point.
you start garbling wildly around his dick, repeating your safe word over and over again until a very confused toji finally makes out what you’re saying.
he rips himself out of your mouth, instantly dropping to his knees and grabbing your chin in his hand.
“oh fuck, did i cut ya sweetheart?” he moves your face from side to side, examining you.
you swallow around the lump in your throat, willing your heart to calm down.
“uh, n-no. just got a bit too real there, for a moment.”
he sighs, partially relieved, reassessing the situation. you’re gulping in air, blowing it out of your mouth in calculated puffs.
toji waits until you're visibly calmer before he gets up.
“wait here,” he orders.
you sit down on the floor, hands wrapped around your knees and mentally repeating to yourself that you’re okay, it wasn’t real, you’re not in danger.
toji returns with a glass of water, sitting down in front of you and waiting until you’ve drank most of it.
“you okay?” he asks.
you take a beat before you can honestly say you are. you nod.
“that knife on your throat was a bit too far, huh, babe?”
“yeah,” you garble out, tracing circles on his knees. “could’ve warned me of that particular detail. asshole.”
he laughs but his body language isn't nearly as carefree.
there’s a long drag of silence before he speaks again.
“i’m sorry, honey. really.”
and toji, as amazing as he can be, is usually way too prideful to admit guilt. so the fact that he apologizes is what finally gets you to fully relax, knowing he does realize the situation you were in and feels bad about it.
“honestly we can stop with all the roleplaying bullshit, it’s getting kinda old anyways. you know i don't need you playing a slut to get you acting like one on my co—“
“toji,” you hiss, and he puts his hands up in mock surrender. “it’s fine. i think i have a better idea, anyway.”
that seems to spark his interest. he rises his eyebrows, prompting you to go on.
“because there’s a few roleplays we haven’t tried yet. and if you genuinely feel so bad—“ he says your name sternly but just you ignore him, “then i know the perfect thing you can do to make it up to me.”
“babe…” he bemoans like a chastised child, with a hint of resignation at what awaits him.
when he sees that you’re beaming he just takes a deep breath, running a hand through his hair defeatedly.
“when?” is all he asks.
impossibly, your smile grows even wider.
“i already ordered the costume! and the cat ears should be here next week,” you kiss his forehead, propping yourself on his shoulders to stand up.
you hear him groan in the distance as you skip to the bathroom, turning on the faucet.
he stalks after you almost immediately, wrapping his arms around your waist and honest to god pouting at you in the mirror.
“are ya really going to do this to me now?”
you grin.
“don’t you mean meow, kitty?”
a/n: yayyy my first somewhat wholesome post i am so bad at this but i hope it was readable! bye now!
1K notes
·
View notes