#faq
Text
Hey folks, I'm opening emergency commissions specifically for PMD icons, because moving to Canada has me FLAT BROKE. I'll work out more customization options when I've got the actual brain for it, but for now, I'll take special requests on a case by case basis. I reserve the right to refuse service to anyone.
Please email me at [email protected] with a ref image or description of your OC, the names of the expression(s) you want to commission, and descriptions or ref images (stuff clipped from Google or other art is okay!) of any custom expressions you want to request.
(Or, if you're feeling generous, send me a Ko-Fi at collabwithmyself- I'll put the link in the reblogs!)
141 notes
·
View notes
Note
Hydro I love love love ur arts! And I was wondering, For your plastic pals do you draw them from memory or is there a little toy next to you that you use for reference on how the joints work and such?
Thank you! From memory at this point, though when I was starting out with designing them, I did look up refs and such on google. It helps! I actually only have about two action figures (ignoring a mega man amiibo and a weird bendy knuckles figure) so it's kinda funny I have a whole roster of ocs like that when I don't actually have a lot of em myself. I sometimes glance at them for reference, but their joints aren't quite what most of my merch mimics have.
40 notes
·
View notes
Text
A.2.6 Why is solidarity important to anarchists?
Solidarity, or mutual aid, is a key idea of anarchism. It is the link between the individual and society, the means by which individuals can work together to meet their common interests in an environment that supports and nurtures both liberty and equality. For anarchists, mutual aid is a fundamental feature of human life, a source of both strength and happiness and a fundamental requirement for a fully human existence.
Erich Fromm, noted psychologist and socialist humanist, points out that the “human desire to experience union with others is rooted in the specific conditions of existence that characterise the human species and is one of the strongest motivations of human behaviour.” [To Be or To Have, p.107]
Therefore anarchists consider the desire to form “unions” (to use Max Stirner’s term) with other people to be a natural need. These unions, or associations, must be based on equality and individuality in order to be fully satisfying to those who join them — i.e. they must be organised in an anarchist manner, i.e. voluntary, decentralised, and non-hierarchical.
Solidarity — co-operation between individuals — is necessary for life and is far from a denial of liberty. Solidarity, observed Errico Malatesta, “is the only environment in which Man can express his personality and achieve his optimum development and enjoy the greatest possible wellbeing.” This “coming together of individuals for the wellbeing of all, and of all for the wellbeing of each,” results in “the freedom of each not being limited by, but complemented — indeed finding the necessary raison d’etre in — the freedom of others.” [Anarchy, p. 29] In other words, solidarity and co-operation means treating each other as equals, refusing to treat others as means to an end and creating relationships which support freedom for all rather than a few dominating the many. Emma Goldman reiterated this theme, noting “what wonderful results this unique force of man’s individuality has achieved when strengthened by co-operation with other individualities . .. co-operation — as opposed to internecine strife and struggle — has worked for the survival and evolution of the species… . only mutual aid and voluntary co-operation … can create the basis for a free individual and associational life.” [Red Emma Speaks, p. 118]
Solidarity means associating together as equals in order to satisfy our common interests and needs. Forms of association not based on solidarity (i.e. those based on inequality) will crush the individuality of those subjected to them. As Ret Marut points out, liberty needs solidarity, the recognition of common interests:
“The most noble, pure and true love of mankind is the love of oneself. I want to be free! I hope to be happy! I want to appreciate all the beauties of the world. But my freedom is secured only when all other people around me are free. I can only be happy when all other people around me are happy. I can only be joyful when all the people I see and meet look at the world with joy-filled eyes. And only then can I eat my fill with pure enjoyment when I have the secure knowledge that other people, too, can eat their fill as I do. And for that reason it is a question of my own contentment, only of my own self, when I rebel against every danger which threatens my freedom and my happiness…” [Ret Marut (a.k.a. B. Traven), The BrickBurner magazine quoted by Karl S. Guthke, B. Traven: The life behind the legends, pp. 133–4]
To practice solidarity means that we recognise, as in the slogan of Industrial Workers of the World, that “an injury to one is an injury to all.” Solidarity, therefore, is the means to protect individuality and liberty and so is an expression of self-interest. As Alfie Kohn points out:
“when we think about co-operation… we tend to associate the concept with fuzzy-minded idealism… This may result from confusing co-operation with altruism… Structural co-operation defies the usual egoism/altruism dichotomy. It sets things up so that by helping you I am helping myself at the same time. Even if my motive initially may have been selfish, our fates now are linked. We sink or swim together. Co-operation is a shrewd and highly successful strategy — a pragmatic choice that gets things done at work and at school even more effectively than competition does… There is also good evidence that co-operation is more conductive to psychological health and to liking one another.” [No Contest: The Case Against Competition, p. 7]
And, within a hierarchical society, solidarity is important not only because of the satisfaction it gives us, but also because it is necessary to resist those in power. Malatesta’s words are relevant here:
“the oppressed masses who have never completely resigned themselves to oppress and poverty, and who … show themselves thirsting for justice, freedom and wellbeing, are beginning to understand that they will not be able to achieve their emancipation except by union and solidarity with all the oppressed, with the exploited everywhere in the world.” [Anarchy, p. 33]
By standing together, we can increase our strength and get what we want. Eventually, by organising into groups, we can start to manage our own collective affairs together and so replace the boss once and for all. ”Unions will… multiply the individual’s means and secure his assailed property.” [Max Stirner, The Ego and Its Own, p. 258] By acting in solidarity, we can also replace the current system with one more to our liking: “in union there is strength.” [Alexander Berkman, What is Anarchism?, p. 74]
Solidarity is thus the means by which we can obtain and ensure our own freedom. We agree to work together so that we will not have to work for another. By agreeing to share with each other we increase our options so that we may enjoy more, not less. Mutual aid is in my self-interest — that is, I see that it is to my advantage to reach agreements with others based on mutual respect and social equality; for if I dominate someone, this means that the conditions exist which allow domination, and so in all probability I too will be dominated in turn.
As Max Stirner saw, solidarity is the means by which we ensure that our liberty is strengthened and defended from those in power who want to rule us: “Do you yourself count for nothing then?”, he asks. “Are you bound to let anyone do anything he wants to you? Defend yourself and no one will touch you. If millions of people are behind you, supporting you, then you are a formidable force and you will win without difficulty.” [quoted in Luigi Galleani’s The End of Anarchism?, p. 79 — different translation in The Ego and Its Own, p. 197]
Solidarity, therefore, is important to anarchists because it is the means by which liberty can be created and defended against power. Solidarity is strength and a product of our nature as social beings. However, solidarity should not be confused with “herdism,” which implies passively following a leader. In order to be effective, solidarity must be created by free people, co-operating together as equals. The “big WE” is not solidarity, although the desire for “herdism” is a product of our need for solidarity and union. It is a “solidarity” corrupted by hierarchical society, in which people are conditioned to blindly obey leaders.
#faq#anarchy faq#revolution#anarchism#daily posts#communism#anti capitalist#anti capitalism#late stage capitalism#organization#grassroots#grass roots#anarchists#libraries#leftism#social issues#economy#economics#climate change#climate crisis#climate#ecology#anarchy works#environmentalism#environment#solarpunk#anti colonialism#mutual aid#cops#police
32 notes
·
View notes
Note
Hi!! I adore your work, all of it!! Mon horrible cheri and postcards from Paris hold a special place in my heart!!!
I also just wanted to ask what brushes you use to draw? sorry if you already answered it somewhere else, just starting my digital art journey and selfishly asking all my favourite artists for tips :')
<3
helloo, thank you kindly!!
i’m very picky with my preference of sharpness & texture so i’m using the same brush i found ten years ago (Mr Natural by Kyle’s Brushes, included in an adobe subscription), and a brush i made myself in an attempt to emulate Mr Natural’s texture haha
you can download all my clip studio brushes/settings/fonts here with my $1 patreon tier 💛
47 notes
·
View notes
Text
WOO, finally got this ref chart together! the art's actually kinda old by now (I started this back in february) but I didn't feel like redrawing everything outside outfit changes sooooo,,,,,my apologies 😅 here's the main cast! you can find individual refs in this masterpost
#height differences may be slightly inaccurate i forgot to take heel height into account sometimes#faq#bonus links#bonuslinksdotjpg#bonus content#bonus war#bonus wake#bonus wolf#bonus mage#bonus loft#bonus mask#bonus mirror#bonus slate#bonus spirit#bonus mini#all links#if ur familiar w bonus lore there are some slight changes here. again. sorry <3#bonuslinks#spoiler link
8K notes
·
View notes
Text
MCYT SEXYMAN WINNER JOE HILLS
[ID: the sexyman bracket, showing that the final winner is Joe Hills]
13K notes
·
View notes
Text
1K notes
·
View notes
Text
TWIN RUNES MASTERPOST
1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 -15 - 16 - 17 - 18 - 19 - 20 - 21 - 21-1 - 21-2 - 21-3 - 22 - 23 -24 - 25 - 26 - 27 - 28 - 29 - 30 - 31 - 32 - 33 - 34 - 35 - 36 - 36-1 - 37 - 38 - 39 - 40 - 41 - 42 - 43 - 44 - 45 - 46 - 47 - 48 - 49 - 50 - 51 - 52 - 53 - 54
To be continued...
TWIN RUNES MINI COMICS
Glasses - Fallen down - First steps - Press [C] - Frisk Dance -
But nobody came - Whatstheirface - An acquired taste - Eye opening
______________________________________________________________
TWIN RUNES - FAQ
What exactly is this AU about?
Twin Runes is essentially a comedic crossover AU between the universes of Deltarune and Undertale. No fancy nicnacs. Just the characters being their chaotic selves. But there might be some darkness lurking up ahead...
When is the next comic?
The comic updates most Sundays at 6:30 PM Central European Time.
Why is this AU called Twin Runes?
The name is more or less a play on the typical naming format of most AU's by featuring the "Runes" part. There are no literal Twin Runes. The whole name is more of a stand in for Undertale and Deltarune as parallel worlds. Hence the "Twin" part.
When does Twin Runes take place?
This AU takes place between a hypothetical Chapter 3 and Chapter 4 of Deltarune. On the Undertale side of things, it takes place post neutral route just as Frisk was about to deliver Undyne's letter to Alphys.
Is the player a thing in this AU?
The player lost control over both human children as soon as Frisk entered the world of Deltarune.
When Chapter 3 and 4 are released, will it affect the story?
Any chapters after Chapter 3 won't affect the story in the grand scheme of things. If possible, I might make a reference to Chapter 3, but all in all Twin Runes created a new timeline so to speak.
What's up with Kris' and Frisk's hair?
The red bits of their hair is more or less a representation of their souls. That in turn is also why Chara doesn't have that feature. They are soulless. It's a stylistic choice.
What's that thing on Kris' chest?
It's a scar they got from tearing out their soul.
And why do they have weird lines all over their body?
Both Kris and Frisk's anatomy resemble that of ball-jointed dolls. They appear just as markings across their bodies. Think of them as elaborate birthmarks. Kris and Frisk are still made of flesh and blood, but are in fact hypermobile. The reason as to why they do is still a little secret :)
People here like to refer to these markings as "puppet limbs".
You can get a better look at them and the scar in this artwork
Why does Kris have braces?
This is why:
Why is Dark World Frisk green?
Frisk changes their main sweater colors with Kris when they enter the Dark World.
Can other ghosts see Chara? (pre Darkner transformation)
No, only Frisk and Kris are able to see Chara.
IS KRIS NOW FRISK'S COUNTERPART OR CHARA'S????
:)
So, was Chara in the locket all along?
No, Chara possessed the locket to become a Darkner.
Where are Jevil and Spamton? Are they in Castle Town?
The Fun Gang have already fought these two in the previous chapters and added them into their inventory. Outside of that little dream sequence, neither will be making an appearance.
Is anyone from Undertale Yellow gonna make an apperance?
Outside of a tiny cameo from Clover (that has no greater bearing on the story) no one from Undertale Yellow is going to make an appearance.
Is (insert character here) gonna go to the Dark World/underground?
With the way the story is going to play out, only the main group will be heading to this new Dark World. The rest of the story will be taking place there.
Is the Group Project miniseries canon to Twin Runes?
It was made before Twin Runes was conceived and before I had any idea I would make a series. It is it's own self-contained story.
So it is NOT canon to Twin Runes, but You can read it here:
1 - 2 - 3 - 4 - 5 - 6
How did you come up with the idea of Twin Runes?
Twin Runes is an offshoot of a separate script I wrote. It's a similar concept but turned on its head. The funny moments in that script made me just continue what now is the start of Twin Runes. I pretty much just wanted to see if I am actually capable of drawing a comic to begin with. So... in a way Twin Runes is my first attempt at a comic ever. If I ever finish Twin Runes, then I know I can tackle turning that mammoth project of a script into a comic too.
In the grand scheme of things these two projects are sister series. They have A LOT in common and even share similar plot elements. When Twin Runes is over you will automatically also know certain mysteries of The Other Script.
What is The Other Script?
As of this moment I call The Other Script: "Lost in the In-Between". At its core it's an inverse of Twin Runes. I.e. Kris falling into the underground and being aided by Frisk on their quest to return home. The story and jokes are a considerably more grounded than in Twin Runes and so are the characters. Though they do have their moments from time to time. The overall mood of that script is a lot darker in nature and it's a 200+ page passion project of mine.
Am I allowed to make fanart?
ABSOLUTELY! You are very welcome to make fanart if you feel like it. Please let me know if you do by tagging me, so I can share it with everyone to see so that you get the appreciation you deserve :)
Can I use the funny faces you draw for memes or for private stuff with friends?
That's what they're here for :)
Is there x ship in this comic?
The focus of the story is not on shipping. If it's in the game it will very likely be mentioned or brought up, but that's about it.
What pronouns do you go with for the human children?
I try to stick as close as possible to the games so I use THEY/THEM FOR ALL OF THEM WITHOUT ANY EXCEPTIONS.
______________________________________________________________
ABOUT ASKS
Asks will open for 24 hours after a new comic has been released. Your questions will then be answered over the course of the week.
Try not to submit multiple asks. If necessary, just keep everything in one post.
Keep in mind that I receive AL LOT of asks, so not every question can be answered...
Questions containing spoilers will not be answered on principle. Wouldn't be as fun if the surprise was ruined, right?
Before leaving an ask (mostly for everyone who's new), please make sure to read the FAQ section above. A lot of times your question might have been answered already :>
I love memes and dumb jokes as much as the next guy, but try not to spam
It probably goes without saying, but please stay civil. I want to give everyone the respect they deserve, and naturally like to be treated the same way.
Please be mindful about drawing requests. It is understandable if you're eager to see a certain character drawn in my style, but I do not like to be bombarded by requests. The more it happens, the less likely I am to do it. Be kind and ask nicely.
Don't use other people's posts that I reblogged to ask me questions! It has happened before and I do not wish to see this!
______________________________________________________________
REFERENCE SHEETS
The following are ref sheets of characters that don't have established Dark World forms yet (as of writing this comic). The list will be updated as soon as a new character enters the Dark World.
Here you will also find references of characters that might appear as surprise cameos, or maybe even completely new faces...
______________________________________________________________
FULL ART
#twin runes#twin runes masterpost#masterpost#deltarune comic#comic#deltarune au#crossover#undertale#my art#FAQ#frequently asked questions#important#please read#deltarune
4K notes
·
View notes
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
#hellsitegenetics#faq#intro post#flowers#plants#requests#birds of paradise#asks#remember to keep checking back!
1K notes
·
View notes
Text
WritingWithColor FAQ: How do I start writing a character of color?
First, be mindful that no race, culture, or ethnicity makes one inherently predisposed to certain emotions or personalities, despite what stereotypes or TTRPGs may suggest. We are all humans who share the same range of emotions and ways of thinking, even if we have different values.
Understand that there is no single template for a good [race, ethnicity] character. A person’s social, economic, and geographical background influences their life and values just as much as their race, culture, or religion. Consider: a Black American boy who grew up in a California mansion versus a Black American boy who grew up on an Illinois cornfield versus a Black boy who grew up in an apartment one city over. All three will have very different privileges, disadvantages, and outlooks on life.
Further reading (WWC x NaNoWriMo):
The Do’s of Writing PoC
Properly Coded: Creating Characters of Color
3 Ways to Show a Character's Culture
---
This Q&A is an excerpt from our General FAQ for Newcomers, which can be found in our new Masterpost of rules and FAQs. For more general resources on POC representation, check it out!
-Writing With Color
#writing with color#writeblr#representation#poc representation#writers on tumblr#writing advice#writing tips#faq
2K notes
·
View notes
Text
head up if you don’t want tumblrs partnered ai companies automatically scraping your blog for image datasets, you need to manually opt out.
You can’t do this in the app rn (apparently you can but I couldn’t find it so you might have to update), only the desktop version or web browser on your phone. It will also need to be done for every sideblog you have.
You find it by opening up your blog settings > scroll down to visibility > prevent third party sharing
As an aside, I’d thoroughly recommend opting out of having your blog scraped, even if you’re not an artist. Afaik Tumblr hasn’t explicitly stated which companies they’ll be partnering with, but the vagueness of that wording is really alarming.
These datasets use a lot of selfies for photorealistic results, moderation of who has access to these datasets is notoriously ass, and a lot of AI engines are being used to generate pornography and racist imagery (you can see this rn with the rise of ai generated propaganda). While ‘your likeness is used in an awful generated image without your consent’ IS a worst case scenario, it’s a really upsetting one. Protect yourselves.
#dis.txt#ai discourse#ik this is all on tumblr faq but i can’t stomach reblogging their ridiculous staff post#it’s not staffs fault bc matt has been salivating at the chance for this for months now apparently#but the language rly cushions from how shit this is#faq
1K notes
·
View notes
Text
Butch Fairy Zine: Answering questions
What art style are we looking for? What is the estimated timeline? Will you get paid? we answer them here!
We will be answering more questions and posting them in the days leading up to the artist application form opening. So if you have questions, use our inbox, or you can fill in our interest form and leave them at the bottom. And if you have queries for the frog, you can leave them there too. He is very busy, so keep that in mind.
Find the interest form here.
Our Artist Application form will open on the 12th of January 2024.
text version under the cut
What type of artists are you looking for? And are you after a specific style or a range of styles?
We are looking for artists who can create pieces with fully rendered fairies and a background within the specified schedule. These can be digital artworks that are flat colour artworks, paintings, a mixture, or another style entirely.
We will also accept mixed media and traditional artworks, but they will need to be scanned at a minimum of 300dpi.
~
When you sign up for an artist position, are there any requirements to be a part of the team?
E-mail communication is required (discord is optional).
You must have a PayPal account to receive payment.
You must be able to communicate comfortably in English.
You must be 18 or older at the time of signing the contract by the 16th of February.
~
For artists accepted into the zine what would be the timeline for completing and submitting artwork?
Our current schedule for the artists requires concept ideas to be submitted by Feb 16th, and the final version by May 16th! Progress check-ins will be on Feb 29th, March 21st, and April 11th.
(In the image there is also a table including this information as well as the final submissions date being May 16th)
~
When the zine is for sale, where would the profits go to (charity, zine admin, etc.)?
We are aiming to hold pre-orders in June/July of 2024, with a flat fee paid to all contributors and additional proceeds split between contributors and mods.
Our priority is to make sure each contributor is paid fairly for their work. If sales do well enough, 20% will be used for future books and projects, and 80% split between taxes and fees, production costs, contributors and shipping costs.
~
Is this physical or digital and will there be prints of the art available? Got any merch ideas planned to go along with the zine?
Both physical and digital! Our goal is to make a 210 x 148 mm (A5) perfect-bound soft cover book.
We also plan to add some paper merch, including prints of some of the art from the book. Additional merch ideas include stickers, sticker sheets and bookmarks.
1K notes
·
View notes
Text
my storybook is now live! link to PO on my profile!!! (rbs are appreciated!)
happy 3rd life anniversary! 💚💛❤️
#desert duo#grian#goodtimeswithscar#3rd life smp#desertduo#hermitcraft#trafficblr#hermitblr#third life smp#faq
982 notes
·
View notes
Note
I know we've all established that you're just a master at typohraphy 'n unique/funny ways to format speech but, like-
I need to know how you come up with TD's dialouge. I feel like y'just have to be on a completely different mental wavelength to even conceptualize speech like this.
My best guess is that I was inspired by a mix of Half Life's G-Man's speaking style, Portal 2's Space Core's aimless rambling, and freeform jazz/eccentric poetry, where thoughts and sentences are broken down into repeating fragments.
"I would like an apple please, how much would it cost?"
Becomes
"Apple! Many. Would enjoy. Me. Would. How?how much. Many cost. Much? Many much?? How. Would it. Cost. Have. Apple. Red. Apple.! For boy. Me! Would like. Apple. Cost? Cost? Cost? What"
Another way to describe it is that your train of thought normally goes from A to B to C, but TD is so scatterbrained his train of thought goes from A to B to C to B to C to A to D to C, and it happens so fast his speech can't keep up with it.
My brain isn't.. THAT messed up, but I think I have a little brainrot of my own that causes me to blank out in the middle of my sentences, ramble, etc. If I didn't speak carefully and just voiced my stream of consciousness, it'd honestly just sound like a slightly more coherent version of how I write Tails Doll's speech.
That's why he's my son!
685 notes
·
View notes
Text
Openaskbox Countdown: To Jan 20, 2024
ayyyyy so i’m at the bottom of the askbox, and old timers on this blog know what that means!
time for the countdown to the next openaskbox event!
Openaskbox streams are when i get to the bottom of my request inbox, during which the askbox will open for the first time in months and everyone gets a chance to yeet up to three free requests my way. there’s a few rules you gotta follow for your request to be considered, but I’ll post more about that on the day of.
I will endeavor to do as many requests as I can during the event (which lasts between 4-6 hours) on stream so people can hang out, chat, ask about calligraphy and the like whilst listening to some tunes.
When time’s up, the askbox will close again and I’ll use the remaining hundreds of unanswered asks to fuel my regular 4 posts/day (28/week) queue card post schedule until the next time we run dry.
This time it’s sort of a weird day bc its a Monday, but I’ll hopefully see plenty of you Saturday January 20th at 3pm to 10pmish EST on the usual twitch channel
I will see yall there, and for the countdown
FIVE days to openaskbox!!!
797 notes
·
View notes
Last Seen Blogs
knucleic-acids
what's better than this
paramoregf
now @gidianthe
crookedtacostudentwobbler
Untitled
vintagebikesforsale
Mike's Vintage Bikes For Sale