Tumgik
#gonna keep updating the tags list
chiosblog · 7 months
Text
(Realized I dont have a proper pinned post so here it is lol)
Multifandom artist and sometimes animator too if the stars are aligned. I'm on a whole wonder journey through 70s - 80s shows and culture at the moment be warned
Oh yes I love fast cars too now lol 🏎🏎🏎
Some tags to navigate through my stuff:
A-Team here im gonna endlessly rant about this show cause my life depends on it
Facedock this ship is the core of my existence rn
My art stuff its all my art (yes I still do art/multifandom)
Dreamworks here my dreamworks obsession posts
Portal 2 my beloved
F1 and cars for my 'fast cars and silly pilots' needs
80s, 70s, 60s vintage stuff here
My Ao3 and my twitter too
🍁Enjoy your stay🍁
3 notes · View notes
radicalrobotz · 1 month
Text
i was planning to finally move dc stuff to a sideblog but i keep posting abt it here 😭
0 notes
churipu · 6 months
Text
jjk men & their sleepyhead gf !
Tumblr media Tumblr media
featuring. gojo satoru, sukuna ryomen, nanami kento x fem! reader
warnings. none, just them being all soft and whipped for you
note. first of all, anon i am so sorry, i accidentally posted your request on the queue list and fml, i'm so embarrassed but idek how to edit the queue list so out of desperation i deleted it— but i ofc screenshotted this before i deleted the og post, so i am so sorry :(( i hope you enjoy this, and i hope you get to find out i didn't delete your ask and it's here in a form of a screenshot :((
Tumblr media
GOJO SATORU. i feel like he doesn't mind most of the time— he does mind it if you fall asleep when you're supposed to be paying attention to him >:(
but whenever you fall asleep, his camera's always on standby, snapping pictures of you from every angle. whether you look good or bad (you never look bad btw), from up above, from below, from the left, from the right, with 0.5, i can go on.
and when you wake up, you find your phone blowing up with notifications from shoko, geto, and him, especially with the notification "@gojosatoru tagged you in a post" and it's just a slideshow post of you sleeping, a few close up shots, and your face with different instagram filters.
you don't even bother at this point since he's not going to stop, and not gonna lie, you did find it a bit funny. and the comments from shoko and geto made you laugh, so... good luck trying to sleep around him, you'll wake up to a whole album of you sleeping on his account.
"satoru, what the fuck is this filter?" it was a filter that made your face a little distorted, and gojo'd just sitting there innocently, blinking his white lashes up at you.
"you look adorable, princess."
"i don't want to sleep around you anymore."
"no, please sleep— how am i supposed to continue my daily updates of you sleeping?"
mind you, he has 200 posts on instagram and 150 of them are just you sleeping + with the cheesiest captions like "my baby is sleeping, pls tell her to wake up bcs i miss her 🥺🥺🥺"
and shoko is all up in his comments like "wake her up yourself, dumbass she's literally in your house."
SUKUNA RYOMEN. the first time you fell asleep around him was when he went out to get a glass of water, but he didn't think of it as anything and thought you were just tired.
but no— you fall asleep anywhere, whenever and most of the time. he gets pretty frustrated when you both spend time, and in a bit, your head leans onto his shoulders and sukuna checks on you, and you were out like a light.
"y/n?" soft snores.
he clicks his tongue in annoyance but doesn't push you away or get angry, although he finds you cute. sometimes snaps a few pictures to keep, but you don't know about that.
and at times, you wake up all tucked in your bed—your favorite plushie beside you, and sukuna nowhere in sight.
you open your phone and there's a few text messages from him.
[ you fell asleep, so i left ] he didn't leave, he said that to make you feel bad and for not giving him enough attention— he stayed in the same seated position for a few hours before prepping you onto your bed, tucking you in and not forgetting to place a smooch on your forehead.
[ call me when you wake up ]
[ love you ] awww.
he's so in love with you.
NANAMI KENTO. he's such a gentle soul, he won't mind if you fall asleep or is asleep whenever he comes over. in fact, he enjoys it when you fall asleep.
he read somewhere that if someone feels tired or sleepy around a person, it's because they feel safe. so nanami just concludes that his girlfriend feels safe around him, safe enough for her to get sleepy and fall asleep on him.
"kento," you murmur half-asleep, stretching your arms.
"hm?" he hums out, opening his arms for you to fall into — which you did, and he craddled you in his arms, placing his cheek onto your head.
"night night." it wasn't even night time, you just had to say it before you go to sleep, and nanami finds you so cute he couldn't help but to squeeze you a little.
"night night," he replies back, kissing your forehead.
nanami just sits there and continues craddling you in his arms, and if he needs to go, he would put you on your bed (on his bed when it's his house), and writes you a short message why he needed to go and when he will be back.
Tumblr media
© CHURIPU 2023 , DO NOT COPY OR REPOST ANYWHERE !
3K notes · View notes
chazuramen · 1 year
Text
i don’t want to get into trigun just yet bc i KNOW i will like it and i KNOW i will need to draw fanart for it but i already have so many ideas listed in my drawing queue. if i add one more thing to stuff i want to draw i will never get anything done 
1 note · View note
hellsitegenetics · 4 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
e1ectrostatic · 2 years
Text
update: url change and (temporary?) picture changes just to get the revamp started
for anyone who suddenly sees me on ur dash and doesnt know who the hell i am: i went from draggyy -> e1ectrostatic :]
0 notes
Text
Follow You Anywhere 1
Tumblr media
No tag lists. Do not send asks or DMs about updates. Review my pinned post for guidelines, masterlist, etc.
Warnings: this fic will include dark content such as dubcon/noncon, obsession, controlling behavoiour, and other possible triggers. My warnings are not exhaustive, enter at your own risk.
This is a dark!fic and explicit. 18+ only. Your media consumption is your own responsibility. Warnings have been given. DO NOT PROCEED if these matters upset you.
Summary: You're online existence threatens to leak into your real life.
Characters: Captain Syverson
Note: I couldn't help myself.
As per usual, I humbly request your thoughts! Reblogs are always appreciated and welcomed, not only do I see them easier but it lets other people see my work. I will do my best to answer all I can. I’m trying to get better at keeping up so thanks everyone for staying with me <3
Your feedback will help in this and future works (and WiPs, I haven’t forgotten those!)
Love you all. You are appreciated and your are worthy. Treat yourself with care. 💖
Tumblr media
"So... this is what it looks like today?" You aim your camera at the sky outside your window, "sorry, the screen is kinda in the way."
You let out a nervous chuckle and flip the camera to yourself. You make a silly face. You were never overly fond of your image on the screen but the vlogs help. Like a little diary, mostly for yourself. You and your seven followers on Insta.
You bat your lashes and fix the clip in your hair, "oh, I got this free. Yeah, I bought a new hair oil and they threw this in the bag." You let your thoughts run wild from your tongue. You found a journal too daunting, the blank lines leaving you just as empty. This is easier. "Anyway, I shouldn't have spent the money to begin with."
You give another splintered laugh. The one you let out when you're anxious, or scared, or happy, or even mad.  You bite your lip and catch yourself in your digitized reflection. You stop and turn your camera to your bedroom.
"Today, I'm gonna clean this mess. Me and you guys together."
You scour the room with the lens. Your laundry is piled on the floor and you have a stack of books you need to put on the shelf. It isn't the worst it's been but it's getting cluttered.
"But first, we'll have breakfast, can't start the stream on an empty stomach," you chirp and nearly drop the phone, "oops, uh..." You fix your grip and check the number in the corner. You have one viewer; on a good day, it's three, most days, it's just you talking to the void.
You go into the kitchen, just down the short hall from your bedroom, opening into your living room. You go to the counter and prop up the phone so the camera is on you again. You tap your fingers and hum.
"What should we have for breakfast?" You ask. You don't feel as crazy talking to yourself even if there's really no one watching. "Oo, French toast. Gotta use up the eggs."
You go to the fridge and pull out the eggs and the milk. You bring them back to the counter, shuffling around for a bowl, a whisk, and the cinnamon.
You mix up your ingredients and dip the bread, one piece at a time. You put on a skillet and fry up the slices, presenting a stack of three to the camera. You smile and dust some icing sugar over the top.
“Probably shouldn't have all this sugar for breakfast,” you shrug at the camera, “alright, quick break…” 
You put the stream onto the ‘back soon’ page and take your plate to the small foldout table against the wall. You're not a fan of eating on camera. You finish and rinse up before snatching your phone up again.
You return to your bedroom and put the phone on a middle shelf and flip the stream back to live. Still that one viewer…
“Anyway, I'm back,” you wave at the lens.
You hesitate, looking around as you stand straight and spin. Cleaning, right. Before you can set to work, the phone dings.
A message?
You go back to your phone and squint at the chat bubble floating up.
‘Looked delicious too.’
“It was,” you agree with a grin, “thanks.”
‘Don't mean the toast.’
The next message has you blinking. Your nape burns. They can't mean… you clear your throat and giggle.
“Well, let's get started,” you back up and clap your hands, “you know, I've been so carried away with work. This place is a pigsty.”
You sit on the floor and sort through the clothes. You toss them into the basket as you sit in silence. You stop yourself and glance at the phone.
“How about some tunes?” 
You walk on your knees to your bedside and turn on your bluetooth speaker. You go to your phone and find a playlist before pulling the stream back to full screen. As you do, you hear a noise you've never heard before.
‘BourbonBear has tipped.’ Huh? Really?
“Oh, thanks, er, BourbonBear,” you giggle around the name, “how nice. Maybe one day I can afford a proper camera for this, huh?”
You smile and go back to the dirty clothes. You quickly ball up a pair of panties and shove them in the basket. You carry on until they're all untangled.
You move on and tidy your desk, bending underneath to gather up a few loose pens. You make your way around the bedroom, putting away books, fixing the blankets on the bed, and straightening the little figurines on the shelf above the bed.
You grab the stick vacuum and suck up the dirt and proclaim your task done. It took a lot longer than you thought. It's after eleven. The one viewer is still there.
“Whew, okay, I'm gonna get myself washed up and go to the park. Maybe I'll post that later,” you give a thumbs up next to your head as you talk to the phone, “thank you.”
You end the stream and let out a sigh. Your videos aren't much and you doubt they're very interesting but it's like venting for you. Almost like having an invisible friend. You think you will take some pictures of the flowers to share.
🧸
You take your usual path through the park. The walks help you unwind your worries. You try to come after work at least a couple days during the week and both days on the weekend. You find the mindlessness of the routine to be calming.
The deeper you get into the wooded length of the path, you slow to admire the birds in the branches and the critters crawling in the brush. You take out your phone and snap a few photos of a blue jay before it wings away shyly. You smile and flip the cam, smiling as you take a goofy selfie. You can add that to your post.
The path winds ahead and you follow it in the din, listening to the river just down the incline to your left and the tweeting from the sky. You lift your face and inhale the woodsy scent. The sudden crack of a twig startles you and you spin to face the noise. There's no one there. Sometimes you forget other people are free to just walk on through.
You chuckle at yourself and continue on. The path leads out to a suburban street where you like to look at the houses. They're much more spacious and pretty than your grimy brick apartment building.
You come out from the shade of the trees and wander along the avenue. There's a mailbox painted to look like the house it stands before and a little nook for second hand children's books to be borrowed through the neighbourhood. Sometimes you picture yourself living in one of those houses though you don't think it could ever truly be.
As you crane your head, you sense a shadow in your peripheral. You're walking a bit slow. You sidle to the side to get out of the way of the other pedestrian. When no one passes, you look back. No one.
You must be imagining things. You shrug and plod along. You're already thinking of what kind of tea you'll have when you get in.
🧸
You sit down with your mug of ginger citrus tea and set to editing your post. You add a light filter to the photos as you shuffle through them on your laptop. The process is slow as the computer is nearly five years old now and chuffing on its 4GB drive. You get to the selfie you snapped, a stop.
You lean in to get a better glimpse of the background. It's fuzzy but there's a figure just over your shoulder. How could that be? You looked and there was no one there. That's so strange.
You stare as a chill courses through you. You're thankful you hadn't put your earphones in. You wouldn't have heard whoever it was and they may have even snuck up on you. Or maybe it's just a trick of the light.
You hit ‘post’ and try to shake off the foreboding. It's nothing. You're being silly. Besides, you're home and safe now. Next time, you'll be more alert.
A message pops up. You stare at the dot over the chat bubble. You tap with your thumb and bring up the DMs.
'Stream tonight?' BourbonBear asks.
You tilt your head. You already did some today. You're tired and want to lie down and enjoy your time off. You type back 'sorry, not tonight. tomorrow <3' and another notification vibrates. A comment on your latest post.
'Pretty sweater', also from BourbonBear. You heart their comment and leave a thanks below.
You flip back to the selfie. You can't really see your sweater in the picture, just the scalloped knitting of the collar. Well, you suppose it does look cute. You put your phone down and leave it on your desk. That's enough Insta for today.
🧸
You time your shopping trip for the least busy hour. It's early and the store is almost empty except for employees stacking bread on shelves or wandering listlessly around the deli. You have your phone in the basket of the cart, aimed at you as you roll it along slowly and check your list.
The stream is just as empty. It's only just started but you don't expect too many people to be up at this hour. You stop and grab a loaf of sourdough, checking the date before showing it to the lens and putting it in the cart. You smile and announce the next item.
"Strawberries... you know I was thinking I might get raspberries instead," you say, catching the eye of one of the yawning employees. You must seem like a weirdo. It's why you typically don't film in public.
As you roll around to the fruit, you notice the count change. One viewer. You choose a basket of raspberries and show those. You see a message float up; morning.
You smile and return the greeting softly and place the berries down carefully beside your phone. You need yogurt to go with the berries.
You work down the list, making some substitutes as you tick off each item. You linger in the ice cream section a bit too long and talk yourself out of a gallon of rocky road. You lean on the handle of the cart and smile down at the lens.
"Going to check out," you say, "see you all later."
All? There's still just the one. You end the stream and take your phone out of the basket.
You wheel around to checkout and line up at the only open till. You put your items up as you greet the cashier with a smile. She seems tired as she gives a dull response.
As you put the yogurt on the belt, you sense someone join the queue behind you. You glance over as a large man stands only feet away. He's tall and burly and staring at you. Maybe he heard you talking to your audience, or he would think, yourself. You continue to unload your groceries.
"Never tried those," he comments as you take out a box of strawberry Pocky.
You pause and hold them up, chuckling nervously, as you do.
"Pretty good," you answer, "I eat way too many."
You notice the man doesn't have a basket or a cart. That realisation needles under your skin. Maybe he's just getting lotto or smokes?
"You like sweet stuff."
"Too much," you squeak even though it doesn't sound like a question.
He just stares, not saying a word. You swallow tightly and pull the last few items out of the cart and get behind it to wheel it through the lane. As you do, he looms closely, adding to the sweat gathering on your lower back.
You roll along and wait for the cashier to ring through the rest of your things. She bags them up neatly in two large paper bags. You pay with your card and thank her as you lift the first into your cart. The man behind you moves forward and grabs the second, startling you.
"Got it," he says as he places it with the other, squeezing by you, crowding you.
"Oh, excuse me, sir," you stammer, "oh," you lean on the cart to roll it to the end of the lane as you make space between you and the stranger. "Thanks, er, uh... thanks."
You turn and grab the handle, jittering. He's really weirding you out. Especially as you realise he's walked right by the cashier. He's following you.
"I can help get ‘em in your car," he offers in a drawl.
"Oh, that's alright, I... bus," you cringe as you realise you've said too much.
"I could drive you. I have a truck."
"No thank you," you walk faster, the cart rattling with your pace.
"Why not?"
"I don't know you, erm, sorry--"
"You don't?" He catches up and shoves his phone in your face, your Insta profile glaring back at you, "I paid for the milk, maybe the berries..."
"What?" You stop, just by the door and turn to him. "I don't--"
"You haven't eaten, have you? I'll take you for French toast. That's your favourite."
"Um," you blink at him as your eyes tinge, "I don't..."
"You got me through a hard campaign, just wanna say thank you," he adjusts his cap and you notice the pin on it. He's a veteran. Oh, 'campaign'. 
“Just got back home," he shifts on his feet, a meek gesture for such a large man, "and... your videos helped me remember it. Helped me hold onto it in the sh-- in the stuff."
"I... wow, okay, that's... I'm glad I could do that."
"I really don't mind giving you a ride. Lots of weirdos on the bus," he insists.
"That's nice but--"
"Please," he softens his tone, "been a while since I sat down and had breakfast without worrying about the sky falling."
You shudder and grip the cart tight. You don't know how to say no. You didn't think about who was watching. You always just assumed they were bots. Then you think of the chaching noise and the amount flashing on the screen.
"BourbonBear?" You ask.
"Yeah," he cracks a crooked smile and smooths his hand over his thick beard. "Everyone calls me Syv.”
558 notes · View notes
estrellami-1 · 11 months
Text
If I Should Stay
Holy shit, y’all are insane. My tag list is over a HUNDRED (wtf y’all I’m kissing every single one of you on the forehead it was EIGHT before this) and the first part got over 800 notes in 24 hours. I love y’all 😂 With that being said though, Tumblr only allows for 50 mentions per post. So I’m drafting another post with the other 50-odd mentions that I’ll link this to. Unfortunately I’m not willing to make more than two posts, meaning my tag list is officially CLOSED. I’m so sorry, y’all, please know I love every single one of you SO much!! If you’d like to follow along and didn’t make it onto the taglist, go ahead and follow the ‘#if I should stay’ tag. I’ll make sure to use this tag for every update! Thank you all SO SO MUCH!!!!! ❤️❤️❤️❤️❤️ and if you want to be dropped from the taglist, that’s fine too; just let me know! ❤️
Part 1 | Part 2 | Part 3 | Part 4
Steve is terrified.
Honestly, after the Russians and the Upside Down and everything else, Steve thought he’d never be scared again.
Then he woke up in school in 1984.
He looks around, wide-eyed, only to stop when Tommy and Carol look at him weirdly. “Uh, Steve?” Carol asks. “You look like you’re about to puke.”
Full of tact, just like always. He shakes off the feeling of wrong crawling on his skin and smiles at her. “I’m fine,” he says, when nothing could be further from the truth.
She opens her mouth to respond. Steve breathes a sigh of relief when the bell goes off, only for him to realize he has no idea where he’s going.
Thank God for Carol, apparently, because she throws her head back with a groan. “Math,” she complains. “I hate math.”
Steve feels a zing of recognition dart through him. He had English while she was in math. They used to complain about it between classes.
He feels excited when he realizes Robin will be in this class, then just as suddenly excitement turns to nausea when he realizes she might not remember him.
He walks into class, trying to keep his hopes down, and briefly makes eye contact with her.
She’s doodling in a notebook, looking around the room. Their eyes meet.
Robin’s pencil lead snaps.
Steve freezes.
He opens his mouth, he’s not sure for what, but she shakes her head slightly.
She stands and makes her way towards him before her eyes flutter back in her head and she drops.
She would’ve fallen on the ground if he hadn’t caught her. Whispers start up, enough to get the teacher to look up. “Mr. Harrington,” she says. “I’m not sure what dance moves you think you’re trying, but I will remind you this is an English classroom.”
“Yes ma’am,” he says. “Um. She passed out. I think I should probably take her to the nurse.”
She leans over her desk to peer first at Steve, then at Robin, who still has her eyes closed. “Very well,” she says. “I’ll give you a hall pass. Please ensure she returns once her little spell has worn off.”
He nods, shifts Robin completely into his arms, and walks out of the classroom.
He walks down the hallway and stops by an empty classroom, darting in when nobody’s looking. “Robs,” he chokes, and her arms are around his neck and now he’s choking for an entirely different reason.
She’s shaking, and he feels hot tears land on his shoulder, and he knows she feels the same from his tears. “I thought-”
“I know,” Steve whispers. “I thought the same. I woke up and I was with Tommy and Carol again and I didn’t know what was going on and I was terrified you weren’t gonna remember me.”
“Jesus,” she says. She’s laughing a little, through her tears. “Imagine how I felt, waking up in Mrs. Click’s class. Thought I’d had a weird fever dream. Then you walked in, and…”
“Yeah,” he agrees. “Jesus, Robs, I’m so glad you’re okay.”
“Right back atcha, Dingus,” she whispers, which really just makes his tears start all over again. “Who else do you think knows?”
Steve sighs. “I don’t know. And other than asking them, and risking getting sent to a padded room…”
“Yeah.” Robin sighs.
“Oh, fuck,” Steve says, tensing up.
“What?”
“I’m pretty sure I’m still with Nancy.”
I tried to tag everyone who wanted it… I’m so sorry if I missed you! Once again I’m so sorry about closing the taglist. Thank you for understanding! ❤️
Permanent Taglist: @justforthedead89 @ilovecupcakesandtea @madigoround @bookbinderbitch @suddenlyinlove @nburkhardt @artiststarme @paintsplatteredandimperfect @i-less-than-three-you @alyelf @quarble @messrs-weasley @littlewildflowerkitten @vankaar @starman-jpg @bornonthesavage @steddie-there @goodolefashionedloverboi @andienotannie @cinnamon-mushroomabomination @platinum-sunset @just-ladyme @steddiestains @swimmingbirdrunningrock @imhereforthelolzdontyellatme @martinskis-lydias @notaqueenakhaleesi @sleepyboosstuff @bestwifehaver @m-owo-n @thatonebadideapanda @finalmoondragon @velocitytimes2 @callmeanythjing @ajeff855 @ilikeititspretty @knitsforthetrail @sillysparrow @that-one-corvid @ace-is-bored @local-writers-corner @harpymoth @weirdandabsurd42
@paperbackribs @ninjapirateunicorns @bisexualdisastersworld @hiscrimsonangel @lolawonsstuff @xo-r4e @thedragonsaunt @l0st-strawberry
Fic Taglist: @blondlanfear @do-you-want-something-more @little-gae-shit
Me @ all of you:
Tumblr media
2K notes · View notes
itsnotgray · 7 months
Text
gray’s fic recs
my tagging/recommendation system is a mess beyond the point of fixing, so i made a masterlist. (i’ll slowly be adding fics to this!)
- an asterisk is next to players who play for the ahl team of said nhl team
- if works focused on more than one person, they’re listed under the other people, but only tagged in the first one you see in the list.
- also, apologies if the links don’t work correctly, it is in fact my first time making a masterlist
NHL/AHL
Anaheim Ducks
Jamie Drysdale
hey roomie by @emaanemaa
- trevor and jamie threesome. that's right, that's all it took to get you to go read it.
Trevor Zegras
chameleon by @hischierhaze
- listen- if you're someone who, whether it be consciously or unconsciously, changes themselves and their personality for those around them, or you have a history of it- please read this. I promise you, you won't regret it.
now that we don't talk by @sc0tters
- it's a toxic relationship with trevor, of course I'm gonna eat it up (she might end with trevor... or she might not. you'll never know if you don't read it.)
hey roomie by @ emaanemaa (fic linked above under jamie)
the penalty box series by @starsandhughes
I- if you're not already keeping up with this series... where have you been? every update is laugh out loud hilarious, and leaves you itching for more.
cruel weather- apart of the penalty box series by @starsandhughes
cruel weather gets it's own link because of the amount of emotional damage this inflicted upon me.
Arizona Coyotes
Boston Bruins
Buffalo Sabres
Devon Levi
like it very much by @jackhues
there aren’t many devon fics (which there totally should be), but the way i squealed when i read this one. further affirmed the fact that i think he’d be the best bf.
Calgary Flames
Nikita Zadorov
that scar hurt by the way by @swissboyhisch
- listen…. i’m the farthest thing from a flames fan, and can wholeheartedly admit it was an adorable read.
Carolina Hurricanes
Chicago Blackhawks
Colorado Avalanche
Columbus Blue Jackets
Adam Fantilli
to you, my adamo by @hischierhaze
- it's adam's birthday + his debut, can you blame me for crying?
his return by @hischierhaze
-this made me cry. but in making this, i'm convinced anything kei writes with the fantilli brothers makes me want to cry from either just how sickeningly sweet it is, or of course, sadness.
tiny dancer au by @letsgetrowdy43
god when i say sunny and adam have my heart- i mean it. they’re sososo special to me.
Dallas Stars
Wyatt Johnston
our song by @lovinbarzal
hands down one of my favorite wy jo fics/au’s. it’s wyatt x a barzal sister, a pairing i wouldn’t have thought of, but works so well!
Detroit Red Wings
Edmonton Oilers
Florida Panthers
Matthew Tkachuk
waking up in vegas by @doc-pickles
- matty t x hughes!sister is a dynamic i didn’t know i needed.
Mackie Samoskevich*
perfect girl by @dmercer91
- this had me feeling things like no other... a big hint as to why? she's shared.
Los Angeles Kings
Alex Turcotte*
who does it better? by @harry-hollands
one of the cutest social media au’s in a while (technically has two parts, but they don’t have to be read together)
Minnesota Wild
Montreal Canadiens
Kirby Dach
here with you by @sc0tters
- it's amber's writing + kirby, what's not to love? (if that's not convincing enough, maybe the line, "I will follow you to the ends of the earth," is.)
Nashville Predators
New Jersey Devils
Jack Hughes
timeless by @babydollmarauders
- if I hadn't originally read this in the middle of the grocery store, I can almost guarantee that I would've cried from just how heartwarmingly adorable this is.
out by @babydollmarauders
- equipment manager x jacky boy- aka a trope I never knew I needed, but now crave after reading this.
ballad of a homeschooled girl by @babydollmarauders
- hands down one of the best pics I've probably ever read in terms of conveying emotion. my stomach was in knots the entire time, attesting to just how realistic the writing is.
never grow up by @aliaology
- i'm sorry but you're not human if you don't get even the tiniest bit emotional at any fic with "never grow up" as the song. BUT A FIC WITH THE BROTHERS? this rendered me emotionally unavailable for a solid 20 minutes.
medía management au by @babydollmarauders
the media management au is an ongoing series staring mr jack hughes and his lovely girl, dove! the updates always bring a a smile to my face, and more than likely make me laugh out loud.
4:41 am by @sweetestdesire
listen, as much as i adore brynn’s smut like no other, her fluffy, soft and sweet fics just do something to me. she writes them so detailed, and consistently has me craving for soft moments with a significant other (a significant other i do not have)
John Marino
stay for a while by @sc0tters
- when i talk about made me feel things, i mean it. amber never fails in writing panty-dropping smut, while also having an thought-out plot.
Luke Hughes
welcome back by @leaentries
- this literally made me swoon. a protective lukey- what's not to love?
nobody's love by @eyesthatroll
- my heart was in my throat while reading, and my emotions were all over the place. regardless of how emotional it left me, it was amazing and deserves all the love.
never grow up by @ aliaology (fic linked under jack)
- older hughes sister watches her brothers grow up + never grow up = tears
summer aches by @starry-hughes
- this fic makes me want a luke to take care of me when i get headaches, triggered by heat or not
what’s not to like? by @starry-hughes
- queen ellen and jimmy are a little apprehensive of you…
jack’s best friend by @lvrzegras
okay listen- any of the brothers x their best friends is great, but jack’s best friend x luke… it just hits different, yk?
Nico Hischier
I never could've seen you coming (I think you're everything I could've ever wanted) by @writingonleaves
- this is probably as close to a literary masterpiece as a fanfic posted on tumblr will ever get
will you take a moment? promise me this (that you'll stand by me forever) by @writingonleaves
- listen- it's apart of the universe she began in the fic above. I have the fic linked under nico (because the oc eventually ends up in a relationship with nico, as seen in the part above), but this is sososo found family heavy. if found family is your trope, then this is your fic
New York Islanders
Mat Barzal
it's nice to have a friend by @youunravelme
- put me through the emotional wringer in the best way possible.
winnie martin's favorite person by @ilyasorokinn
- god- i cannot even begin to describe how cute this is. all i can say, is that I need more pictures of barzy with kids... for science of course.
New York Rangers
Ottawa Senators
Philadelphia Flyers
Pittsburgh Penguins
Sidney Crosby
she was the (red) devil by @crosbyscurls
- hockey meets f1 is already a dream combination… but sid x f1? absolutely amazing
San Jose Sharks
Seattle Kraken
St Louis Blues
Tampa Bay Lightning
Toronto Maple Leafs
Vancouver Canucks
Quinn Hughes
these michigan summers by @lukevangelista
i feel like the only way your not aware this series exists, then your new here. because if you haven’t read this, where have you been? this is for sure one of my top three series’ on tumblr, finished or unfinished. will in fact, forever have my heart. (currently unfinished)
the sun to my moon by @ghostfacd
this fic is part of an au! i highly, highly recommend checking it out- quinny + a grumpyxsunshine trope, what’s not to love?
never grow up by @ aliaology (fic linked under jack's name)
- older hughes sister watches her brothers grow up + never grow up = tears
Vegas Golden Knights
Washington Capitals
Dylan Strome
it's never too late to come back to my side by @lukevangelista (a series)
- one of my recent favorites. particularly geared towards those who think back on old friendships (...and constantly overthink on whether you should reach out. spoilers- it's never too late)
Winnipeg Jets
NCAA
University of Michigan
Luca Fantilli
missing you, quietly by @bitchinbarzal
- emotional torture in the best way possible. i re-read a concerning amount
i lost him by @hischierhaze
- made me cry- but in a good way
baby 101- name reveal by @hischierhaze
- it's dad!luca... yeah that's right, now that you have that cute thought in your head, you kinda have to go and read it
I tell you that I think im falling back in love with you by @writingonleaves
- this fic is sososo special to me for so many reasons- and I think you should totally read this fic to figure them out... just saying
opposites attract au by @dmercer91
this is a link to the head anons for the au- but please go read this sweet au. luca and landen are one of the sweetest pairings.
Nick Moldenhauer
sundays are for textiles by @drewsbuzzcut
- super cute read, and it's apart of an even cuter au
all american lace by @drewsbuzzcut
- also apart of that super cute nick au she has- but this part was not so cutesy (it was at the end). had me on the edge of my seat, and tears building in my eyes. the type of angst you physically feel- but with the type of ending that makes up for it (trust me, it does!)
Mark Estapa
icy roads by @nicohischierz
the simplest explanation i can offer is that this broke my heart- but i loved it anyway!
Boston College
Gabe Perreault
princess!gf x gabe perreault by @yankstrash
- these two are on my mind at least three times a week. i aspire to become amelia- aka find someone who is as down bad for me as gabe is for “his meels”
450 notes · View notes
scoonsalicious · 15 days
Text
Tumblr media Tumblr media
7.3 Major*
Pairing: Bucky Barnes x Fem!Reader
Summary: Lily McIntyre, trainer for new SHIELD recruits at the Avengers Tower, has been in love with her best friend, Bucky Barnes, from the moment she met him. She's been content with her role of the #1 girl in Bucky's life, even if it means she has to sabotage a romantic relationship or two. It'll be worth it when he realizes that they're meant for each other, right? There's just one small problem: Lily McIntire never expected Bucky Barnes to fall for You.
Warnings: (For this part only; see Story Masterlist for general Warnings) Language, Explicit Sexual Content Minors: GTFO; I don’t serve your kind here (unprotected piv, slight praise kink, slight size kink)
Word Count: 2.8k
Previously On...: You finally got Bucky's dick down your throat <3
A/N: Again, sorry about yesterday, besties! My spirit child took precedence. At least this is a decent-sized, smutty update!
If you ever feel so inclined to support my work, hop on over to buy me a coffee; it's much appreciated! <3
NOTE! The tag list is a fickle bitch, so I'm not really going to be dealing with it anymore. If you want to be notified when new story parts drop, please follow @scoonsaliciousupdates
Thank you to all those who have been reading; if you like what you've read, likes, comments, and reblogs give me life, and I truly appreciate them, and you!
Tumblr media
You were pretty proud of yourself, you had to admit. You had no idea how many women Bucky had slept with over the years (and, if you were being completely honest, you really didn’t want to know), but given he was well over a hundred, you figured it had to be a pretty decent number. Yet, here he was, lying next to you, trying to recover like you’d literally just sucked his very soul out of his body. You swore you’d never swallowed so much cum in your entire life, let alone at one time. For a moment there, you’d briefly wondered if you’d be the only person in history to literally drown in cum.
You’d never enjoyed giving your ex-husband head before, but giving it to Bucky had felt almost like a religious experience. He’d allowed you to take your time, to set your own pace, and do what felt natural to you– not just grab both sides of your head and fuck your face like a fleshlight, the way Connor had been so fond of doing. Your mouth was going to be so sore tomorrow, though. It was like having a forearm in there. You laughed quietly to yourself. Totally worth it.
“What’s so funny, doll?” Bucky asked, rolling over onto his side so he could face you properly.
“I was just reminiscing about how huge your dick felt in my mouth, Sarge,” you told him honestly. 
Bucky wrapped an arm around you and pulled you closer to him. “Major,” he moaned into your shoulder, “you keep talking like that and you’re gonna get me going all over again.”
You smiled and scooted closer to whisper in his ear. “That cock was so big, I thought I was gonna choke on it, Sergeant.” Bucky shivered and, sure enough, you could feel the appendage in question hardening against your stomach as you spoke. He was insatiable, and you loved it.
“Come back with me to the Compound tonight,” Bucky said. “It’s closer than your place and I’m not going to be able to wait much longer to be inside of you.”
You sat up, torn between being touched that he wanted to take you back to the home he shared with his friends, and wanting to just jump his bones immediately. In the end, being horny won out. “Why wait, Bucky? We’re both already naked, and you’ve already blown one load out here. What’s a couple more?” You reached down and grabbed his semi-hard member, stroking it gently. 
“Fuuuuck,” Bucky groaned. He sat up and placed a hand over yours to cease your ministrations. “Sugar, we can’t,” he said through gritted teeth, as though it pained him to put a stop to your actions. “This is a public park. What if we get caught?”
You threw your head back and laughed at that. “Bucky,” you said through your giggling, “that’s half the fun! Besides,” you said, turning a bit more serious once you saw the concern in his eyes, “it’s after hours on a Sunday night. No one is coming to the park now. And even if they did, what are the odds of them finding us? We’re so far off trail.”
“They could see the lanterns,” Bucky said, “and follow the light. And I just… Nevermind, it’s stupid.” He turned his face from you, embarrassed. You were beginning to love the way he shied from you when he was afraid he was going to say the wrong thing.
You frowned and gently tilted his chin so he was facing you again. “What’s ‘stupid’? Bucky, you can tell me; I’m not going to judge you, I promise.”
A small smile tugged at the corner of Bucky’s lips. “I just… don’t want anyone else seeing you like this,” he murmured, running his vibranium hand down your shoulder. “You look like a fucking goddess tonight, Major. I want to be the only one that gets to worship you.”
His words couldn’t have had more of an impact on you if you had been physically struck by them. “Bucky,” you whined, pulling him close to kiss him. You had a fleeting thought of self consciousness, that he’d be able to taste himself on your lips, but he didn’t seem to care as his tongue sought entry into your mouth. He kissed you like he was dying of thirst, and your lips were the only source of water for miles.
“Let’s compromise,” you told him once you’d broken apart. “We can blow out some of the lanterns, so we’re not so easy to find.” Bucky nodded, seeming to like the idea of your offer. “Then,” you continued, “you can fuck me under the stars.” 
*
The two of you must have looked absolutely ridiculous, you thought, traipsing around, completely naked, as you collected all of the things that Bucky had brought for your picnic and packing them away into the basket, save for the blankets and some pillows, giggling like idiots the entire time. You wanted to have everything packed up as neatly as possible before blowing out the lanterns, so that when it did come time to finally leave, you wouldn’t risk leaving anything behind because you’d been fumbling around in the dark. You’d both completely forgotten about actually eating dinner.
As you worked, you kept sneaking occasional glances over at Bucky, admiring the way the light rippled over his body. The man was essentially made entirely of muscle, and yeah, you’d seen him naked before, in the confines of your condo, but something about seeing all of him outside, under an open sky, did something to you. It made you feel… feral.
“You okay there, doll?” Bucky asked, causing you to refocus and clear your head. 
“Huh? Yeah, I’m good. Why?” you asked him.
Bucky smiled as he walked over toward you. “Well, you stopped moving, then got this dazed look on your face, and you were just kind of staring at my dick,” he said. Reaching you, he put his hands on your hips and playfully yanked you toward him. 
You chuckled at his apt description of what you must have looked like. “Just admiring the scenery, Sarge,” you teased. You could feel your desperation for him growing by the second. You took his hand and guided it down your body, between your breasts, down the skin of your stomach, until you had it against your aching heat. 
Bucky took the initiative of running two of his thick fingers between your folds, gathering your copious slick. “Oh, sugar,” he said, his voice almost patronizing, “you’re fucking soaked.” He brought his fingers to his lips and sucked off your arousal. “Shit, you taste so damn sinful. Be a good girl and go wait for me on the blanket while I finish up, alright?”
You nodded and did as he asked. You watched as he quickly finished gathering all the lanterns and blowing them out, one by one, until he was just a silhouette of shadow among shadows. 
“Hey, sugar,” Bucky said through the darkness as he climbed toward you across the blanket. Your eyes were adjusting to the starlight, and though you couldn’t make him out perfectly, you could see him much easier.
“Hi, Sarge,” you replied with a soft giggle as you reached for him. “Come fuck me, please.”
“Oh, doll,” Bucky purred, “I’m not going to fuck you tonight.” He kneeled down on the blanket, resting back on his heels, and, as if you weighed absolutely nothing, he picked you up, positioning you so you were facing him, straddling your legs on either side of his torso. “Tonight, I’m making love to you, Major. Put your arms around my neck.”
You obeyed him dumbly, his words having driven all rational thought completely out of your head. Bucky reached underneath you, putting his hands under your ass and using them to pull you close to his chest. “Are you ready?” he asked. 
You nodded desperately; you were practically dripping for him by this point, but something hit you. “Fuck,” you hissed. “I don’t have any condoms.”
“What happened to my always prepared Girl Scout?” Bucky asked with a grin. 
“I thought we were going out to dinner!” you told him in exasperation. “I didn’t think we’d end up fucking in the middle of the woods! I just assumed we’d end up fucking back at my place, where I have copious amounts of condoms!”
Bucky laughed at that. “Well, maybe we should both start carrying them at all times then, sugar. Just in case. Seems we’re making it a habit of not always gettin’ to a bed in time.” But then his face turned serious. “If you’re worried about diseases or whatever,  you don’t have to be– the serum, it prevents me from contractin’ anything, so I can’t pass stuff on, either. Kind of like a catch-all vaccination. The only thing we’d have to worry about is… well,” his eyes glanced down to your belly. “You know. I can always pull out before I finish, if you want.”
Just the idea of feeling him inside of you, with absolutely nothing between you, invaded your thoughts and filled your mind like a thick smoke, reaching every crevice of your brain until it was all you could think about. To actually feel him cum inside of you… “Don’t you dare,” you said, a little more sharply than you intended. “Pull out, I mean. Fuck, I wanna feel you, Bucky. All of you. I’m clean, and I’m on birth control. I can pick up some Plan B in the morning, just to be safe.”
Bucky closed his eyes and groaned. “Fuck, sugar, if you’re sure.”
You tightened your grip around his neck. “I’m so sure, Sergeant Barnes,” you said. “I wanna feel every inch of you inside of me.”
Bucky opened his eyes and looked at you. “I don’t think I’ve ever had sex without a condom before,” he confessed. “Don’t take it personal if I don’t last. It just means you feel so fucking good, I couldn’t help myself.”
You snorted at that, and Bucky grinned at you. “As long as you make sure I cum, too,” you said, kissing his jaw, “I don’t care how long you last.” You both knew he would never leave you unsatisfied.
“Hey.” Bucky jerked his chin so he was looking into your eyes again. “I’m really glad that, this first time for me without anything between me and a dame, it’s with you.”
You didn’t have words to describe how that made you feel, so you did the only thing that would properly convey the depth of your affection toward him– you kissed him as you lowered yourself onto his dick. You were so wet, he met virtually no resistance as he tilted his hips up into you. And your body, now after your… eleventh, or was it twelfth?-- time in two and a half days, knew how to welcome him.
“Holy fucking shit!” you gasped.
“What is, doll?” Bucky asked, eyes wide with concern. “Are you alright? Did I hurt you?”
You shook your head. “Do you have any idea how deep you feel inside of me right now, Bucky?” you asked him. “It’s like I can feel you in my soul.” 
“Fuck,” he grunted, and then he started using his arms to guide you up and down on his cock, sliding himself nearly all the way out before pulling you back down on him again, and each stroke felt like ecstasy. “Damn it, doll,” Bucky said, looking down to watch where his cock disappeared inside of you, “you feel so fuckin’ good! I don’t know if I can ever go back to fucking you covered again!”
“Oh, god, Bucky,” you moaned. You didn’t know if you could go back, either, not with the way you could feel every single vein of him drag against your inner walls. His motions were deliberate, slow, gently feeding the fire instead of pouring gasoline on it the way he usually did. It was intoxicating.
“Look at me, sugar,” he begged, his voice holding a tone of longing. Your eyes met his, and despite the dark, they shone. You couldn’t look away as he pumped into you. “You’re fucking amazing, Major,” he gasped, timing his statements to match his languid thrusts. “So goddamn beautiful.” Thrust. “You make me laugh.” Thrust. “You’re brave as hell.” Thrust. “You’re independent.” Thrust. “Strong.” Thrust. “Smart.” Thrust.
He kept praising you as he increased his rhythm, hips thrusting up into you faster and faster, the whole while keeping his eyes locked on yours. The coil inside of you was tightening, constricting the expanse of your lungs, making your breath come out in shallow gasps. 
You kissed him, putting every ounce of lust into the motion, moaning into his mouth as he never broke stride and brought you closer to the edge. “Bucky,” you moaned into his mouth. “Fuck, Bucky, you’re making me feel so good, honey. Don’t stop, please!” 
“Never, sugar,” Bucky grunted back. “Fuck, wanna make love to you until the day I die.” You sucked in a breath at his words, and before you knew it, tears were streaming down your face. Bucky’s thrusts faltered. “Doll,” he said, lifting a hand to wipe the tears from your cheek, “did I say something wrong? I’m sorry!”
“No!” you cried, shaking your head as you worked your own hips to make up for his loss of motion. “No, Bucky, shit, honey, you’re saying everything so right. I’m crying because I can’t remember the last time I felt so goddamn happy.” 
Bucky resumed his thrusts with a renewed purpose. Getting up on knees, he repositioned you so you were lying on your back, his giant frame leaning over you. “Come on, sugar,” Bucky grunted as he snaked a hand down to your clit and began to rub. “Need to feel you cum around my cock. Show me how happy you are, pretty girl. Show me how good I make you feel.”
You propped yourself up on your elbow to bring your face closer to his. Grabbing a hold of the chain that held your name, you pulled his face to yours and kissed him. “‘M so close, honey,” you moaned into his lips. “Need you to give it to me.”
“I wanna give you everything, Major,” he grunted, kissing you again. And then, suddenly, it was all over for you, the coil snapping, and you were falling, shouting his name to the stars and the sky. Bucky’s thrusts lost their careful rhythm, and you could feel him spilling into you, wave after warm wave of cum pouring down your channel. 
“Fuck, sugar,” Bucky cried. “Can feel you squeezin’ me. Shit, baby– you feel so fucking good, sugar. ‘S so good, can’t stop cumming.” His words lost all meaning as they devolved into grunts and moans as he collapsed on you, his hips still thrusting as if with a mind of their own.
The weight of him should have been suffocating, but instead, you never felt safer than you did with his body splayed on top of yours. He held you to him, as though afraid that, were he to let go, you would float away on the breeze, and you felt so light after your orgasm, you very well could have. Mumbling sweet nothings into the side of your neck, Bucky’s flesh hand found your hair, stroking it. 
“Thank you,” he whispered into your skin. “Thank you so much, Major.”
You let out a shuddering breath, hands gripping the muscles of his upper back as you held him, legs finding their way around his waist. “Thank you, Bucky,” you said, pressing a kiss to his temple. “That was everything.”
After a few moments, Bucky gently rolled off of you, but his hands never left your body as he held you close, running his fingers along the meridian of your spine. 
“How’re you feeling?” he asked you. Always considerate, always checking in. It made your heart swell with affection. Fuck, with love for him.
“So good,” you told him. You placed a gentle kiss on his pectoral. “How are you feeling? Did you have a good time?”
Bucky huffed out a laugh. “Are you fucking kidding me, sugar?” he asked with mock incredulity. “Every time I’m with you feels like the best time of my fucking life. And I’m not just saying that,” he added, anticipating your incoming protest. “You… I don’t know what it is you do to me, Major. I just know that, when I look at you, things feel right, for the first time since I shipped out in ‘43. I feel like I’m exactly where I’m meant to be.”
But goddamn if this man didn’t know how to say just the right words to you. “If you’re not careful, Bucky Barnes,” you said, hoping to put enough tease in your voice to mask how sincerely you felt the words you were saying, “I’m gonna end up falling in love with you.”
<- Previous Part / Next Part ->
197 notes · View notes
marlenesluv · 8 months
Note
Helloo! Could you maybe write a smau of Charles x reader where reader a hollywood actress from brazil and fans keep shipping them without knowing they’re a couple?
Thank youuu 🫶🏼🫶🏼
Nobody Knows. (CL)
hiii! this is so cute, yes, i can for sure do this! 🫶
pairing: charles leclerc x brazilian!reader!actress
fc: bruna marquezine
warnings: j a little cussing
note: i tried to do a semi-slow burn, i hope you like it!
masterlist here -> masterlist link
^ check my list for all posts! ^
Tumblr media
liked by: charles_leclerc, zendaya, and 872,005 others
y/n.user: 🇧🇷 to 🇲🇨
view comments…
y/n.movieedits: she’s in monaco?? f1 fans RISE
f1wags: fav actress in monaco, charles leclerc likes, what do we think?
↳ y/n.rolesmovie: i think that they could just be friends
↳ user2: nah, i think they would be a cute ass couple
user8: MONACO?????
↳ user1: she’s said she’s wanted to move there, but i think she’s there for a movie…..
↳ user6: the monaco gp is this weekend tho🤔
kellypiquet: gorgeous🩵
↳ y/n.user: miss you!💗
leclerc.skeskeaye: KELLY????
neymarjr: O Brasil sente sua falta
*translate: brazil misses you*
user04: NEYMAR?
↳ y/n.edit2: they are family friends i think. he always gets her tickets to games!
_______________________________________________
Tumblr media
liked by: y/n.user, arthur_leclerc, and 1,567,024 others
charles_leclerc: let’s get pole in monaco this weekend🇲🇨❤️
view comments…
pierregasly: ❤️
*liked by creator*
ferrarifriends: you’re gonna win this weekend! (also we are not skipping past the second picture, WHO)
y/n.shipsss: me hoping that it’s y/n in the second picture
↳ char.fanpage: they would be soooo cute stop
y/n.user: good luck this weekend!!
↳ charles_leclerc: thank you!!
↳ user3: YOU GUYS SEE THIS
mclarenbby814: mmmm stop. if this is y/n, i’ll scream. they would be the hottest couple alive
user8: i need them to get married and then sign my adoption papers
arthur_leclerc: tu seras incroyable, mon frère
*translate: you will do amazing, brother*
*liked by creator*
y/n.editpage16: pls be dating pls be dating pls be dating
_______________________________________________
Tumblr media Tumblr media
liked by: charles_leclerc, carlossainz55, and 982,024 others
y/n.user: little ferrari party means we go full red
view comments…
scuderiaferrari: ❤️
*liked by creator*
user4: okayyyy the hints are being dropped, guys
y/n.fp: red suits you omllllll
francisca.cgomes: stunning!!❤️
↳ y/n.user: thank you, kika🥹❤️
formula1edits: yup, i need her and char rn
chili55: her and charles would be so cuteee. i need
user7: queeeennnnnnn
leclerc1655: her and charles OWN red
carlossainz55: so glad you could make it!!!
↳ y/n.user: it was so fun!!
y/n.fanssss: WHAT THE
_______________________________________________
twitter:
F1 Informal Updates @f1lovaaa • 2hr
Tumblr media
↳ Papaya Boys @81papaya4 • 2hr
no cuz, yes. and they would just be so cute, and they have to know that. they are the it couple
_______________________________________________
Tumblr media
liked by: y/n.user, pierregasly, and 1,619,193 others
tagged: y/n.user
charles_leclerc: after ferrari party to morning after (its race day❤️🇲🇨)
view comments…
y/n.user: ferrari boys for the win
↳ charles_leclerc: im a man actually, y/n
↳ y/n.user: yes, ik, so sorry, char
user3: they’ve either been dating or they j started dating. i’m leaning towards the first one tho…
ferraripics: ferrari gf ferrari gf ferrari gf
f1wags: idk if i wanna be charles or y/n rn…. i want them both
vroomposts81: i’m a papaya girl for life, but i’m loving this relationship too much for not even liking ferrari
↳ feerrraarriiiii55: everyone likes ferrari
lorenzotl: miss you both! good luck this weekend
↳ y/n.user: we would have seen you and charlotte if you guys didn’t go on vacation😒
↳ charalotte2304: miss you, y/n!!
↳ charles_leclerc: sending love to greece ❤️
user6: Y/N KNOWS ENZO AND CHARLOTTE!?
↳ user2: she prolly knows the whole family AGH
_______________________________________________
your instagram story:
Tumblr media
seen by: charles_leclerc, maxverstappen1, and 782,025 others
charles instagram story:
Tumblr media
seen by: y/n.user, danielricciardo, and 1,321,939 others
_______________________________________________
Tumblr media Tumblr media
liked by: charles_leclerc, arthur_leclerc, and 972,021 others
y/n.user: back to brazil, time for char to see my home❤️🇧🇷 (also yes, we’re dating. you guys are a little late tho)
view comments…
charles_leclerc: im so excited, cherié❤️
↳ y/n.user: me too, baby❤️
f1wags: holy shit. seeing them in this amazing quality, they are the hottest couple i have ever seen
user4: y/n is using charles’ photo tactic now where he only posts professional pics
↳ y/n.user: i took the first one and char took the second, are you saying we are professional 🤭
↳ user4: YES 🫠🫠🫠
user2: im dead they are soooo cute
chillifp55: it’s confirmed AHHHHH
16leedits: im jealous. of charles. i wanna be with y/n
lailahasanovic: cutestttt💓
↳ y/n.user: lailaaaaa💓
y/n.fansss6: me when i saw this post =🫠
lissiemackintosh: adorable🤍
↳ y/n.user: you’re an angel🤍
_______________________________________________
(reposts, comments, and likes are appreciated!^-^)
728 notes · View notes
whiskygoldwings · 26 days
Text
WHISKY'S FOXY FIC REC LIST
Okay! The promised Fox-centric fics rec list is here WOOOO! I’ve split this into complete and not complete. I did have grand plans about sorting it into genres but uh, that might be for later when I've regained the will to live... I’ve also been recommended a few I haven’t read, so have given those a section of their own. These are FOX-CENTRIC fics. … Mostly. I’ve said where the focus is more on someone else with Fox as more secondary!
THIS IS ALL HUGELY BIASED! I have my personal tastes, and know they don’t fit everyone else’s. Just because a fic isn’t on here doesn’t mean it isn’t good, and just because a fic IS on here doesn’t mean you’ll like it. I also simply haven’t read all the Fox fics out there! I’m trying to, but you folks keep writing new excellent fics and I can’t keep up! Also, I do like to occasionally do other things… Very occasionally…
Within the basic headers, none of these fics are in any particular order. Also, I HAVE ABSOLUTELY MISSED FICS. PLEASE REC ME ANY YOU THINK I HAVE MISSED. I’m intending to update this as I read more, these are just the ones I could remember/find at the moment!
I have included with the link – any ships, tags people may need to be aware of, length and a brief summary. I CLONESHIP. So yes, there's some fics with cloneshipping in here. Honestly, not anywhere near as many as I thought there would be. I have used the pairings as given by the author on the fic, so if I have missed a pairing, that's why. IF YOU THINK I HAVE MISSED SOMETHING PEOPLE NEED TO KNOW, PLEASE TELL ME. I do my best, but I’m very (very) fallible. I’d rather know and be able to fix it than not know and someone be hurt by something. (This literally goes for anything else).
If you have a fic that’s not on here and you think it should be – comment/message/ask!
With the intro over, let’s get into the meat of things!
COMPLETED FICS
Commander Fox’s Ultimate Bucket List – Blackkat
PAIRINGS: Fox/Mace Windu, Padme Amidala/Thorn/Stone, Depa Bilaba/Grey, Agen Kolar/Cody
WORDCOUNT: 27,509
TAGS: AU – Time Travel, Time Travel Fix-It, Humour, Crack, Seduction, Murder Attempts, OTP: Anakin/Consequences, Romance, Friendship, Let Fox be a little unhinged 2kforever
SUMMARY: Fox has a second chance, a to-do list, a stolen lightsaber, and a complete willingness to give everyone around him grey hairs. Plus a Jedi Master to seduce. It's going to be a ride.
My thoughts: Y’ALL. WELCOME TO RAREPAIR HELL WITH ME. I actually tried to draw fanart for this I loved it so much. It is WONDERFUL. Hilarious. The characterisation of Fox is just brilliant.
-----
Our Guard (a docu-holo sponsored by the Coruscant Communications Bureau) – FortinbrasFTW
PAIRINGS:NO PAIRINGS
WORDCOUNT: 54,034
TAGS: Various original characters, Comedy, Fix-It, Dead Sheev Palpatine, that what we do in the shadows meets fox accidentally kills his boss au, mockumentary, bail and fox are bros, Crack treated seriously, no ships really in this but kit and fox are def some kind of exes, every clone deserves a droid sidekick
SUMMARY: Nonstop civilian protest duty for over a month, the senate's latest hobby seems to be getting abducted for kicks, and now he had to deal with a camdroid shaped pain-in-the-ass following his every move. The powers that be seemed to think that putting him and the rest of the Guard in some holo was the best way to work up some civilian sympathy. Well, at least there was no way his day could get any worse...
My thoughts: You all thought this list was gonna be just angst didn’t you!?! This is another, just excellent, hilarious Fox fic. Such a brilliant idea, and one I can absolutely imagine happening. Fox is so done, and his interactions with the camdroid are beautiful.
------
To Be Free Once More (That’s Worth Fighting For) – Batsutousai
PAIRINGS: Fox/Obi-Wan Kenobi
WORDCOUNT: 154,695
TAGS: AU – Canon divergence, Fix-it, Qui-Gon Jinn Lives, Jedi Shadow Investigator Obi-Wan Kenobi, Jedi culture and tradition, Jedi appreciation, Coruscant Guard Troopers Deserve better, Force-sensitive Clone Troopers, Protective clone troopers, Clone trooper mistreatment, Clone trooper and Jedi relationships, Institutional Abuse, Discrimination, Strangers to friends to lovers, Trans clone troopers, nonbinary clone troopers, Nonbinary Jedi characters, Sheev Palpatine being an asshole, Character death, Palpatine and some Corries die onscreen, Implied/referenced character death, Deaths of original Jedi characters are reference, The young of Melida/Daan, Clone trooper Inhibitor chips, Force-sensitive Fox
SUMMARY: As a Jedi Shadow, Obi-Wan hadn't expected to have much to do with the clone troopers. Until, suddenly, he does.
My thoughts: I uh… I already broke my own rules for this list… Oops! I’m really not sorry for it though… Obi-Wan is the central character in this, with Fox as a secondary character. However the handling of Fox and Obi-Wan’s building relationship, and the way Obi-Wan interacts with the clones/the Corries is wonderful. This is a freaking excellent story. I’m breaking the rules to recommend you something you should ABSOLUTELY read.
------
Operation: Don’t Wake The Commander – AlleyMoslof
PAIRINGS: NONE
WORDCOUNT: 7,034
TAGS: Fox needs a hug, Tired Fox, Fox deserves better, These shinies are dedicated, Coruscant Guards, Let Fox sleep, Fix-it, Thorn is Chaos Personified, The Guard has no impulse control, Fox is a good bro, the adoption genes are strong with the Guard, Fox IS the Guard’s impulse control
SUMMARY: “So basically, Commander Thorn ordered you to make sure Commander Fox slept a decent amount and didn’t give you any restrictions as to how to do this.”
The shiny looked up from the ‘pad to smirk at him, “sir, yes, sir.”
My thoughts: Just adorable! This is so sweet! Those Shinies sure are dedicated, and Fox gets a well-deserved nap. *heart*
-----
And I Did It My Way – Miyaji_08
PAIRINGS: Fox/Quinlan Vos
WORDCOUNT: 23,039
TAGS: Hurt/Comfort, Fox Needs a Hug, Coruscant Guard troopers need hugs, Coruscant Guard troopers get hugs, Coruscant Guard troopers as family, Quinlan Vos needs a hug, Protective Quinlan Vos, Ferus Olin needs a hug, Ferus Olin gets a hug, Quinlan and Fox think they’re in a murder mystery but really it’s a comedy, The best way to get away with crime is to completely forget how and why you did it, Clone troopers and Jedi as found family, Obi-Wan Kenobi needs a drink, Protective clone troopers, Protective Jedi, Coruscant Guard troopers deserve better.
SUMMARY: Commander,” High General Windu says, brows raised in suspicion. “This is the Chancellor’s office holo, is it not? May I speak with him?”
Fox stares at the general, and then down at the black smudge on the floor where Palpatine’s body used to be. Slowly, subtly, he shifts so he’s standing on top of it.
“Uh,” he says. “…No.”
My thoughts: This is angtsy, and wonderful, and Fox is so tired and his characterisation is brilliant.
------
Galaxy-Saving Memes – musicmillennia
PAIRINGS: NONE
WORDCOUNT: 3,152
TAGS: Memes, Social media, chatfic, Fix-it, crack, humour, whump, Fox needs a hug, and he GETS one plot twist, they all get one!!, unhealthy coping mechanisms, trauma, reconditioning, mind control.
SUMMARY: You can only access the page if you're GAR. The Coruscant Guard decides to infiltrate it because they are tired of being ignored, and honestly? Their memes are way better.
Or, the Guard saves millions of lives through stupid internet posts.
My thoughts: BRILLIANT. HILARIOUS. The Guard are so nonchalant about the shit they’re dealing with that they turn it into memes. *chefs kiss*
------
Their Days are Darker – always_a_slut_for_hc
PAIRINGS: NONE
WORD COUNT: 23419
TAGS: Clone troopers deserve better, hurt/comfort, abuse, Fox needs a hug, Wolffe is a little shit, Whump, AU – canon divergence, Dehumanization, Gaslighting, GRAPHIC DEPICTIONS OF VIOLENCE
SUMMARY: After the death of ARC Trooper Fives, an altercation at 79's leads Wolffe to spend his leave snooping around the Coruscant Guard. Fox assumes he'll drop it and leave the Corries to their fate; it's what everyone else has done.
He is very, very wrong.
My thoughts: One of my all-time favourite Fox whump fics. I have re-read this several times. It does hurt, it is painful, but it does get better. Love it.
------
Commander Fox is Completely Fine – Maddy_B
PAIRINGS: Fox/Quinlan Vos
WORD COUNT: 275,029
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. RAPE/NON-CON. Fox needs a hug, Tired Fox, Fox whump, Coruscant Guards, Slow burn, Dissociation, Panic attacks, Gender dysphoria, Body dysphoria, Dysphoria, Explicit sexual content, Slavery, Implied/referenced rape/non-con, all explicit sexual content in this fic is consensual, Bad parent Jango Fett, Implied/referenced torture, Mild gore, Blood and gore.
SUMMARY: Cody was still staring at him. Fox wasn't sure what made him keep talking.
"It's always the shinies who think they're invincible," he muttered, "who think they're above the rules."
Cody nodded slowly.
"Yeah," he said, voice a little hoarse, "that's usually how I lose them too."
Fox watched as his little brother finished the rest of his drink and stared down into his empty cup.
It wasn't the same, he wanted to say. That's a battlefield, this is the centre of the Republic, it's different. The truth is that it's not as different as it should be.
My thoughts: This is a long haul fic folks, but it is deliciously worth it. The angst/whump is very real. The comfort is also very real. Fox and Quinlan are plonkers who eventually get their acts together. There’s wonderful interactions with Fox and Padma, Bail and Riyo. Wonderful fic.
------
Do-Over – TooManyTeeth
PAIRINGS: NONE
WORD COUNT: 109,352
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Time travel fix-it, Fox needs a hug, Depression, Suicidal thoughts, Hurt/comfort, Brotherly love, Cuddling and snuggling, Blood and gor, Torture, Palpatine is a giant asshole, Fox gets better I promise, Abuse, The Coruscant Guard collectively need a hug, Fox needs a nap, Non-consensual kissing, Non-consensual touching, Friendship, Medical inaccuracies, Unintentional betrayal, Fox gets a hug
SUMMARY: Fox made a mistake. Fox was punished. Fox died. Fox woke up.
My thoughts: Oh the hurt and angst is very real with this one folks. So is the comfort though. Eventually! An excellent story, painful to read in places, but beautifully done. I’m very excited for the sequel!
-------
With Nothing to Lose, There’s Everything to Go – Batsutousai
PAIRINGS: NONE
WORD COUNT: 4,706
TAGS: Clone troopers deserve better, Clone trooper-centric, Abusive Sheev Palpatine, Past abuse, Abandonment, Fox needs a hug, Fox gets a hug, Fix-it, Unhealthy coping mechanisms, PTSD, Little bit of hurt/Lots of comfort, Family reunions, Protective siblings
SUMMARY: The end of the war arrived, but nothing changed for the Coruscant Guard.
My thoughts: If you need something to just make you feel a little bit better about the world, give this fic a read. Lovely one-shot. Lots of feels.
------
Commander Fox’s Guide to Touring Coruscant – KakashiKrazy256
PAIRINGS: NONE
WORD COUNT: 7,910
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Hurt/comfort, Bros being bros, Dialogue heavy, Fox needs a hug, And he’ll get one, Fox’s brothers telling him he matters and he short-circuits, Ponds is alive because I said so, Injury
SUMMARY: The painkiller he had been giving just half an hour prior is still working fine, leaving him relatively...alright. Nothing hurts particularly bad, but there’s a fuzziness layered over everything, making it hard to think too hard on anything beyond the first thoughts running through his head.
Go inside. Find the rest. Sit down. Drink. Don’t say anything stupid. Don’t get caught. And...and just be there to properly enjoy the company of his brothers.
Don’t forget these memories.
/
Fox gets injured but decides to keep it secret for the sake of his batchmates. For the prompt 'is that a bloodstain?!'
My thoughts: Lovely fic. The interactions between Fox and his brothers are just wonderfully well-written. And Fox’s pain throughout is thoughtfully done.
-------
Foxhunt – OysterTori
PAIRINGS: Pre-slash Bacara/Fox. Side pairings of: Ponds/Mace Windu, Thorn/Cody, Echo/Fives/Rex, Bly/Aayla Secura
WORD COUNT:14,406
TAGS: Hurt Fox, Fox needs a hug, Coruscant Guard troopers as family, Coruscant Guard and GAR, BAMF Fox, Mind manipulation, Coruscant Guard loves Fox, Protective Coruscant Guard troopers, Sheev Palpatine being an asshole, Palps dies off screen because fuck him, Fox got to murder him as a treat, All clones have a competency kink, Bacara has the biggest though, Fox gets a hug, Trans clone troopers, Clone trooper reconditioning
SUMMARY: Fox has to flee after killing the Chancellor and as the events unfold he gets hunted across Coruscant by CorSec (not something to worry about) and the GAR (something to worry about).
But his Corries have his back, as always. They won't let someone take their ori'vod away from them.
My thoughts: … Honestly I just love that Fox is a BAMF MF and everyone wants him in this! From memory, I think the story actually focuses on other characters a lot more than Fox, but it’s brilliant anyway!
-------
It’s fine. I’m fine. Everything is fine – cats_and_dr_pepper
PAIRINGS: Depends on which chapters, but Fox/Thorn.
WORD COUNT: 62,395
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. GRAPHIC DEPICTIONS OF VIOLENCE. Fox needs a hug, Fox whump, Protective Fox, Tired Fox, Fox deserves better, Fox needs a nap, Protective Cody, Cody’s name is Kote, Cody is so smart, Injury, Manipulative Sheev Palpatine, Sheev Palpatine being an asshole, Clone medics are scary, Angst, Whump, Coruscant Guards, Coruscant Guard needs a hug, Self-indulgent, WIP, One-shot collection, Din Djarin cameo, Parental Jaster Mereel, Force ghost Jaster Mereel, Eldritch, Angst and hurt/comfort, Hurt/comfort, Hurt no comfort, Character death, Suicide attempt, grief/mourning, Crack, hijinks and shenanigans, Graphic descriptions of injuries, Order 66
SUMMARY: WIP AND ONESHOT COLLECTION
My thoughts: I could recommend pretty much all of this author’s library, but I’m trying to limit it a little! While this is a collection of one shots, they’re just beautiful. I am particularly fond of Chaps 4 and 6/7. Folks, mind those tags and the chapter specific summaries.
------
Trich – cats_and_dr_pepper
PAIRINGS: NONE
WORD COUNT: 1,328
TAGS: Angst, Whump, not too bad though, Trichotillomania, Fox needs a hug, Fox-centric, Fox whump, Sad Fox, Hair-pulling, in the least sexy way, Body focused repetitive disorder
SUMMARY: It was easy. It was easy to do. Any time Fox needed an extra… something to deal with the day on Kamino, he’d pull a hair. Never from the same place, never more than one, but for some reason, it helped. He didn’t quite know how or why, but the little stab of pain, the sound of the pluck through his skull, how sometimes the whole root sheath would slide out—it was something he could do.
On Coruscant, it gets out of control.
My thoughts: Look, I know I LITERALLY JUST SAID I was going to limit myself, but I have to rec this one. It holds a special place in my heart. I’ve had dermatillomania all my life. The two conditions are very related, and this whole fic spoke so much to me. Beautifully done depiction of the condition. My thanks to the author for this.
------
Corrie Red – musicmillennia
PAIRINGS: None
WORD COUNT: 24,294
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. Lovecraftian Monsters, Eldritch Coruscant Guard, Horror, Body horror, Blood, Blood drinking, Gore, Non-linear narrative, Implied/referenced mind control, Manipulation, Angst, Fix-it, Cannibalism, No one is helping the Guard so they help themselves, With their new limbs, The Corries can have a little murder as a treat, Vomiting, Self-harm, Codependency, Temporary character death, Unreliable narrator, Protective Fox, Protective Coruscant Guard
SUMMARY: A Sith opens a Door and keeps it open. Something else slithers through, and it likes the Coruscant Guard. The Coruscant Guard likes it too.
My thoughts: DO YOU LIKE ELDRITCH HORROR!?! Boy have I got the fic for you then!!! Super excellent, wonderful body horror. Very creative, the descriptive language is beautiful. There are several more sidestories and a sequel in the works as well, which I highly recommend. This is the fic that made me love Eldritch Guard!
------
But Still, Bless Me Anyway – bitebackbaby
PAIRINGS: NONE
WORDCOUNT: 52,977
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. AU- Murderbot Diaries fusion, canon-typical violence, Canonical character death, Clone trooper mistreatment, Clone trooper reconditioning, Clone trooper decommissioning, Coruscant Guard troopers-centric, Coruscant Guard VS GAR rivalry, Coruscant Guard troopers deserve better, Coruscant Guard troopers need hugs, Fox whump, Fox deserves better, Fox needs a hug, Eventual happy ending, Angst with a happy ending
SUMMARY: CG-Unit 1010 is functioning at perfectly normal parameters. It obeys orders. Enforces the law. It is not afraid of the Masters that bought it. It does not mourn the Units that fail to measure up to their exacting standards. The Behavioral Chip does not allow such aberrant behaviors.
GAR Units are given many allowances. Fox wonders, sometimes, exactly when they will face the consequences of that.
(aka: built and deployed on coruscant, the cybernetic constructs known as the coruscant guard come face to face with the rest of the galaxy, and begin to notice some discrepancies.)
My thoughts: The utter GENIUS of combining the CG with SecUnits. This is absolutely amazing. It’s not kidding about the eventual happy ending, there’s some grief to come first. YOU SHOULD ABSOLUTELY READ THIS FIC. Even if you know nothing about the Murderbot Diaries. You need not have read the Murderbot Diaries, but just so you know, YOU SHOULD.
-------
Tachy – postapocalyptic_cryptic
PAIRINGS: NONE WORDCOUNT: 1,806
TAGS: Whump, platonic cuddling, Protective Wolffe, Fox needs a hug, Fox whump, Tachycardia, Panic attacks, Exhaustion, Protective siblings, Order 66 happened differently, Post-war, AU, PTSD, Tired Fox
SUMMARY: “Come on, Fox, head between your knees. You know the drill.” As gently as possible, Wolffe pushes Fox upright and helps him arrange himself in an approximation of the recovery position. He’s gasping and shaking and, now that Wolffe has his hands on him, burning up. “There you go,” Wolffe murmurs, keeping one hand on Fox’s head, carding through his hair, and using the other to comm medbay. “Deep breaths, Fox’ika.”
The war is over, but Fox is far from out of the woods.
My thoughts: Short fic with Fox suffering the aftereffects of everything? Yes pls!
------
Finding the Way Back – slotmachines_fearofgod
PAIRINGS: Implied Fox/Quinlan Vos
WORDCOUNT: 7,122
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Angst and hurt/comfort, the comfort is minimal, Fox needs a hug, Coruscant-Guard troopers-centric, Protective Fox, Protective Wolffe, Fox needs a nap
SUMMARY: Wolffe stops by the Coruscant Guard complex to pick up some unruly members of the 104th, and tries to reconnect with Fox. Certain things are revealed that set off some warning bells for Fox's batchmates
My thoughts: I love Wolffe and Fox interactions. I headcanon them being close brothers, so it makes me very happy! Wolffe’s not going to let this go Fox…
-------
I’ve been sent up and I’ve been shot down – always_a_slut_for_hc
PAIRINGS: NONE
WORDCOUNT: 1,919
TAGS: Hurt/comfort, Implied/referenced self-harm, Touch-starved, Imprisonment, Solitary confinement, Fox needs a hug
SUMMARY: After the court martial, they put Fox away.
Just - put him away, up on a shelf like a little toy soldier. He’d laugh, if it wasn’t so fitting. They created him to do a job and he went out and did it and now they were done with him. 
My thoughts: I love this fic, and basically all of the Febuwhump 2022 collection. There’s a follow up to this as well. It’s angsty folks, but SO GOOOOOD.
------
Up In Our Bedroom (After The War) – lux_arcana
PAIRINGS: Queerplatonic Fox and Thorn
WORDCOUNT: 4,690
TAGS: AU – canon divergence, Dead Sheev Palpatine, Post-war, Autism spectrum, Autistic burnout, PTSD, Fox needs a hug, Fox gets a hug, Stimming, Queerplatonic relationships, Therapy, Jedi culture and tradition, Clone trooper culture, Mind control aftermath and recovery, Emotional hurt/comfort
SUMMARY: In this strange new world that Fox got to live in, he woke up safe, warm, and comfortable. Everything around him was soft, muffled, heavy. He rolled over and moved into an even warmer spot, and stretched out languidly, as cat-like a behavior as he had ever done. Without opening his eyes, he knew exactly where he was. Kamino was not safe, warm, or comfortable. The Guard Barracks, though safe, were not warm, and the only comfort they had was each other. But here -
In the Temple, he was always warm, and he was always safe, and he was almost always comfortable. His bed was soft. It was comfortable. And, as he moved into the spot Thorn had just vacated, it was warm.
“Go back to sleep,” Thorn’s soft voice whispered, and Fox did what he did best; he obeyed.
(Fox, Thorn, and the rest of the Guard, after the war.)
My thoughts: I love this fic. I love the gentleness of it. I love the pain of it. I love the recovery.
-------
Gar Shuk Meh Kyrayc – MageOfCole
PAIRINGS: NONE
WORDCOUNT: 1,553
TAGS: Sleep deprivation, Exhaustion, Fox needs a hug, Cody is a good bro, Cody is a little shit, Thorn is a good bro, Fox needs sleep, Clone troopers deserve better, Touch-starved Fox, Sheev Palps being an asshole, Clone troopers speak Mando’a, Mandalorian clone troopers, hurt/comfort, whump
SUMMARY: (you're no use dead)
Fox has barely slept in the last month, only enough to function in his tasks; he’s exhausted, and sore, and tired, but he has work to do. It’s his duty to always be there, ready and willing to take orders, but - Prime's tits - he's so tired.
My thoughts: I love fics where Fox’s brothers come in and make him sleep. Short, angtsy fic where Fox gets to take a good, long nap.
------
Reset Restart Repeat Repose – KairaKara101
PAIRINGS: NONE
WORDCOUNT: 15,641
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Fox needs a hug, Protective Fox, Tired Fox, Fox whump, Coruscant Guard troopers as family, Coruscant Guard troopers-centric, Protective CG, hurt/comfort, Emotional hurt/comfort, Angst, CG troopers deserve better, CG troopers need hugs, Manipulative Sheev Palps, Clone trooper reconditioning, Clone trooper decommissioning, Mind Manipulation, Clone trooper inhibitor chips, Clone trooper mistreatment, Clone troopers speak Mando’a, Isolation, Amputation, Mental instability, Mental breakdown, Mental anguish, Identity issues, Loss of identity
SUMMARY: CC-1010 held a secret that none of his current batchmates, squad mates, guard vode, and vode knew about. He’d rather take that secret to his death and beyond.
My thoughts: A really interesting look at Fox having to continually reset himself. The whump is fierce with this one.
------
No One Worth Remembering – RMWrites
PAIRINGS: NONE
WORDCOUNT: 1,709
TAGS: MAJOR CHARACTER DEATH. AU, Lies, Posing as someone else, Implied/referenced character death, Manipulative Sheev Palps, Thorn and Pals are in the background, Order 66 didn’t happen, Fox deserved better, Hurt no comfort, Angst, The happy ending is only for some people, Fox needs a hug, Implied/referenced suicide
SUMMARY: Fox the Original, as he called him, had gone MIA on a mission for the Chancellor a year and a half into the war. To keep the pretense of normalcy- for losing a Marshal Commander on the “safe” posting of Coruscant would cause far too much public panic- the replacement Commander had donned the painted armor of the late Fox, took up his name and number, and studied the plethora of reports left behind to mimic his voice.
He was Commander CC-1010 "Fox"- the ninth to hold that name.
My thoughts: I LOVE this idea and I love this fic. This idea is just fantastic, and I highly recommend you go read it!
------
The Guard Are (Not) Fine – redhairedmuses
PAIRINGS: Fox/Quinlan, Cody/Obi-Wan Kenobi, Bly/Aayla Secura
WORDCOUNT: 14,419
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. Heavy angst, Angst, Angst and tragedy, Angst and hurt/comfort, Implied/referenced torture, Implied/referenced abuse, canon-typical violence, Mental breakdown, Fox whump, Fox needs a hug, Protective Fox, Fox is a good liar, Alcohol, Protective Cody, Minor character death, Creepy/manipulative Sheev Palps, Dissociation, Fox has issue, and he blatantly ignores them.
SUMMARY: In his service to the Coruscant Guard, Fox had learned to become a very good liar. Some would argue one of the best.
But how long can he keep lying to himself?
-
aka. the corrie guard deal with a lot of shit on coruscant and no one really does anything about it.
My thoughts: Yeah, we all know I love a good bit of Corrie angst. Here’s a delicious one.
------
CHTHONIC – catboydogma
PAIRINGS: Fox/Quinlan Vos
WORDCOUNT: 17,062
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. Meet ugly, Getting together, Let Fox say FUCK, Anti-clone prejudice, Fluff, Angst, Whump, Emotional hurt/comfort, hurt/comfort, Canon-typical violence, Gore, Corpses, Mind control, Mind control aftermath and recovery, Enemies to co-workers to lovers, Worldbuilding, Planet Coruscant, CG, Coruscant Underworld, Coruscant’s Haunted, Horror elements, Falling in love, Fix-it, AU – canon divergence, Order 66 didn’t happen, Past torture, Referenced decommissioning
SUMMARY: Not even two days later, Fox revised his opinion. This wasn’t a disaster. This was a Grade-A, first order, fresh off the hot plate fuckfest. Fox’s day had gone something like this: lay in bed. Get up. Knock back some of the sludge in the mess masquerading as caf. Go through forms. Fill out forms. Bust open a closet in which the Senators for Uyter and Kinyen had both managed to get “stuck” in. Go through more forms. Fill out more forms. Get called up to the Senate dome to tell a Senator that no, the Guard did not address noise complaints. Find that the stack of datapads on his desk had somehow tripled over the last two hours. Despair at the state of his inbox. Etcetera, etcetera. And then.
My thoughts: YEEEEES DEEEELIIIICIOUS!
------
Red Like My Dreams – Quarra
PAIRINGS: Fox/murder
WORDCOUNT: 8,637
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE, AU – canon divergence, Blood and gore, Serial killer!Fox, Attempted murder, So much attempted murder, Murder, Unhinged!Fox, Fix-it of sorts, Fives lives, Sith flirting, Happy ending, Humour, Unhealthy relationships, Unhealthy coping mechanisms, Torture, Crack treated seriously
SUMMARY: Fox wants to murder his boss so badly that he can taste it. The problem is that fucking Sheev is a difficult person to kill. That’s fine. Fox is a stubborn bastard. He can follow his heart and achieve his dreams. He just has to work at it.
or,
The one where (nearly) everyone is worried and Fox is (more than a little bit) unhinged.
My thoughts: UNHINGED FOX GETTING HIM SOME SITH-DAMNED MURDER. *chef’s kiss*
-------
Commander Fox’s Rules for Shinies – sleebyama
PAIRINGS: NONE
WORDCOUNT: 3,736
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE, MAJOR CHARACTER DEATH. Brothers, Brotherly bonding, Fox is a good bro, Ori’vod Fox, CG Dogma, Implied/referenced rape/non-con, Implied/referenced character death, Implied/referenced Abuse, Fluff and angst, Fox needs a hug, Clone trooper decommissioning
SUMMARY: Shinies are always the first to laugh at his rules.
Those who laugh are usually the ones that learn the hardest lessons.
My thoughts: Hey folks, do you like those fanon headcanons about the abused Guard? Do you like Corrie Dogma, OC shinies, and Fox adopting the shit out of people? HAVE I GOT A STORY FOR YOU!
-------
Don’t Ever Utter Those Words Again, I’m Begging You – Mamuzzy
PAIRINGS: Fox/Thorn
WORDCOUNT: 982
TAGS: Hurt/comfort, Injury recovery, Established relationship, Married couple, Riduurok/Mandalorian marriage traditions, Anxiety, Overprotective Fox, Cloneshipping, Whump, Crying, Art included
SUMMARY: Thorn was injured in one of his mission on Coruscant and Fox feels guilty about it.
My thoughts: Oh Thorn is so wonderfully sweet and honest! Also, THE ART! I love it so much!
-------
Full Body High – menphina
PAIRINGS: NONE
WORDCOUNT: 6,231
TAGS: Angst, Hurt/comfort, Angst with a happy ending, Trans clone troopers, Trans Fox, Trans female character, Fox needs a hug, Fox gets a hug, Internalized transphobia, Implied/referenced transphobia, Gender dysphoria, Panic attacks, Clone trooper dehumanization, Fox deserves better, Protective Fox, Order 66 didn’t happen, Clone trooper decommissioning.
SUMMARY: Fox looks in the mirror as he washes his hands, and there’s a lurch deep in his gut.
He doesn’t know why.
It’s his own face staring back at him, hair regulation-short, a bit of scruff around his jaw, a few grizzly scars. He runs his hand across his chin. It feels like someone else’s.
He looks away.
My thoughts: I love this fic. I love how gently Cody handles things when the command batch realise what’s happening. I subscribe heavily to the likelihood that there are trans/non-binary clones, and they deserve to have their stories heard.
-------
In Lieu of Flowers – kakashikrazy256
PAIRINGS: NONE
WORDCOUNT: 7,418
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Angst, Hurt/comfort, hugs, Wolffe needs a hug, Fox needs a hug, PTSD, Malevolence arc, bad treatment of clones
SUMMARY: “We asked for funds. It wasn’t a lot. Just, just enough for a salvage mission. To get the bodies of some vode back. Or a memorial announcement, at the very least something.”
“The General got a response yesterday, from the Senate. They...they said it wasn’t in the budget. Fox, I—I’ve always known but to...to read it...we’re fucking expendable. We always have and always will be.”
Fox knows. He knows because he had been the one to draft the response and send it to Plo Koon yesterday morning.
/
After the destruction of Plo Koon's fleet to the Malevolence. Wolffe and the rest of the survivors are sent to Coruscant to determine their fate. Fox is there to pick up the pieces of his brother.
My thoughts: Hey folks? This one HURTS. It’s brilliant, but it’s painful.
------
A Taste of Freedom (Only Makes it Hurt All The More) – MagicalStardust
PAIRINGS: NONE
WORDCOUNT: 2,104
TAGS: Fluff and angst, starts off peaceful and then the agonies start, mentions of abuse, Fox-centric
SUMMARY: Fox gets some rare time off-world and realises how good life can be, that maybe he's meant for something other than dying in an alleyway in the depths of Coruscant.
Of course, his freedom must come to an end.
My thoughts: This is so sweet, and then so painful…
------
Learning Solitude – here_be_bec
PAIRINGS: NONE
WORDCOUNT: 4,088
TAGS: Fox whump, Emotional/Psychological abuse, Physical abuse, Fox needs a hug, Manipulative Sheev Palps, Hurt no comfort, Abuse of authority, Isolation
SUMMARY: It's a gradual, insidious thing, Fox's absorption into the Chancellor's office. The Chancellor wants a clone commander of his own, so he gets one. All Fox gets is a position far away from his brothers, a lesson in how to work around natborns who detest his very existence, and a seemingly endless list of monotonous jobs to keep him occupied through all his waking hours and beyond.
Fox misses Kamino.
My thoughts: OH THIS ONE HURTS SO GOOD. It’s brutal, it’s ruthless. It poses the question of what if Fox was isolated from the CG the way the CG is fanon isolated from the GAR and it answers it in such a cruel, wonderful way. Take the hurt no comfort seriously though folks.
-------
Our Deepest Condolences – Hasta_la_vista_byebye
PAIRINGS: NONE
WORDCOUNT: 1,343
TAGS: AU – Everyone lives/Nobody dies, Mace Windu is so done, POV Fox, POV Mace Windu, A full on Corrie Guard fic with no hurt at all, Non-binary Fox, Fix-it, Crack, ALL THE CRACK, Palps gets eaten by a Zillo beast
SUMMARY:After the Chancellor's death, tragically eaten by the Zillo Beast, the grieving Republic holds a funeral ceremony in honor of their regretted leader.
But not everybody attending is in the mood for mourning. In fact, the Coruscant Guard feels pretty great.
My thoughts: LET’S BRING BACK THE CRACK! Hilarious. Love it. Mace wants to put his head in his hands and laugh. A little humour after all the previous recs angst!!!
------
A Flint and a Fire – Meshurkaan
PAIRINGS: Fox/Rex, Jesse/Kix, one-sided Rex/Fives
TAGS: Training on Kamino, friends to lovers, First kiss, First time, Canon-typical violence, Post-first battle of Geonosis, Canon temporary character death, Clone trooper inhibitor chips, Cloneshipping, Fix-it, Everybody lives, endgame Fox/Rex/Fives but that is later in the series, POV Rex, Not canon-compliant: The Bad Batch, A little bit of Mando’a, Drinking games, Clone trooper shenanigans, Drunken shenanigans, Fox’s bad taste in holodrams, Some angst
SUMMARY:Rex was engineered to be a perfect soldier, yet no amount of training could have prepared him for what he’d face on the battlefield (and off of it).
My thoughts: Oh look! I’m breaking my own rules again!!! The main POV in this is Rex, but Fox features heavily and HOLY SHIT YOU GUYS JUST GO FREAKING READ THIS FIC. I can’t WAIT for the endgame Fox/Rex/Fives!!! This is all SO DELICIOUS!
-------
All Of Life Is But a Game (And I’m Winning) – rook (jsunday)
PAIRINGS: NONE
WORDCOUNT: 16,582
TAGS: Coruscant Guard, Clone troopers deserve better, Clone troopers need hugs, Engineers, And that is a WARNING.
SUMMARY: It had started, as these things tended to do, with a bad idea at 79's. When it came to the telling, there were as many variations of who was there as there were batches on Kamino, but most clones generally agreed on a core group: Quorum, an engineer with the 212th, with ideas bigger than the GAR budget allowed; Harris, logistics officer in the Coruscant Guard, who had more contacts than the city planet had levels; and Ponds, commander of the 91st, who had never met a bad idea he couldn't make worse, and held the power to sign forms permitting it.
In which an idea is had, and two million clones run with it. So much bangcorn is eaten.
My thoughts: Look, maybe Fox isn’t the ONLY focus in this one, but he plays a starring role damnit!!! And there’s an EXCELLENT follow up which focuses on him and the Guard! This is wonderful, humorous, and the clones basically create themselves secret sports festivals and art galleries. Somehow, this will save the Galaxy… IT’S AMAZING.
-------
Blame – Jaigeye
PAIRINGS: NONE
WORDCOUNT: 862
TAGS: MAJOR CHARACTER DEATH. Canonical character death, Grief/mourning, Whump/Angst, Character study, Introspection, Tragedy, Fox thinks about his choices, Clone trooper Culture
Summary: Thorn is dead. Fox isn't- at least not yet.
My thoughts: This hurts, in a dark, hopeless way. This and it’s follow-up fic are just excellent. Really well-written. Highly recommend.
-----
Category 5 Shitstorm – cats_and_dr_pepper
PAIRINGS: Cody/Obi-Wan Kenobi
WORDCOUNT: 6,987
TAGS: Hijinks and shenanigans, Crack, Fox needs a nap, He technically gets one, Fox is so done, Mace Windu is so done, Fox and Thorn are not romantically together, it’s all a joke on Thorn’s part, Fake marriage, Grizzer is a good girl
SUMMARY: Fox clutched his cup of caf desperately in his gloveless hand. He still didn’t know where his vambrace was. Someone (Stone? Unclear.) was wearing his armor, and whoever it was didn’t have his vambrace comm either. He took a loud, slurping sip, and spat it back out immediately, directly back into the cup. Was this decaf? Disgusting. His day was getting worse.
“How,” he said, looking at each of the vagrants in front of him, “the fuck did this happen?”
My thoughts: OKAY. A THIRD ONE. I’M SORRY. But a, I promised I’d rec this one, and b, IT’S HILARIOUS Y’ALL. GO FREAKING READ IT.
-------
The Graveyarder – Trixree
PAIRINGS: NONE
WORDCOUNT: 10,697
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. CG Dogma, CG centric, Post-Umbara Arc, Clone trooper reconditioning, Psychologicial horror, Psychological trauma, Memory loss, Sith are Eldritch horrors change my mind, Eventual happy ending, Canon-typical violence
SUMMARY: They call them the graveyarders.
They shuffle off of the transport, armor scrubbed shiny white and new, brains scrubbed just as clean. They move aimlessly, startle when spoken to, and don’t answer to any name other than trooper. They are the dead walking, coming back from the grave, and they aren’t the vod they were.
My thoughts: This fic is just excellent. I love it so much.
-------
“May Those Who Defy Their Fate- - independent_variables
PAIRINGS: NONE
WORDCOUNT: 4,276
TAGS: Dialogue heavy, canonical character death, Angst with a happy ending, Guilt, Fix-It of sorts, Brotherhood
SUMMARY: Three days after Fives died, Kote visited Fox. 
***
―be granted glory.”
My thoughts: Excellent, short but sweet.
------
Sacrifice – cats_and_dr_pepper
PAIRINGS: NONE
WORDCOUNT: 10,050
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. Character death, Suicidal actions, Angst, Whump, Grief/mourning, Hurt no comfort, Clone trooper inhibitor chips, Mind control, Mind control aftermath and recovery, Unwilling sacrifice, Fox kills Palps, Manipulative Pals, Pals being an asshole, Protective Cody, Suicide attempt, Fox knows he’s going to die and damn it he’s going to get what he wants, Plo Koon is doing his best, Thire where did you get that slugthrower, Order 66, Order 66 Fix-it, End-of-life care, Vokara Che is so done
SUMMARY: Fox heard running footsteps from outside the office, getting closer and closer. He listened to the buzzing hum of several lightsabers and plastoid shuffling. There was a small army of Jedi and GAR outside the door, and Fox knew what he and his brothers would be used for.
Meat shields if they were lucky, executioners if they weren’t—and given that they still had their minds, he suspected it would be the latter.
“How could this happen…” Fox watched Kenobi whisper. “How could we forget?” .
“Ah, but letting them kill themselves would be too easy. It’s annoying when my little toys break themselves too early. Though, it is fun when it’s on my orders.” No, no, please, no. “Commanders, execute Order 66.”
Or, it's difficult when you realize that your actions have consequences. Permanent ones.
My thoughts: Folks, the tags are NOT MESSING AROUND. This is dark, and it’s painful. It’s also, fucking excellent. And something I could absolutely imagine Palps doing. You should read it.
-------
The Cadaver Remains – menphina
PAIRINGS: NONE
WORDCOUNT: 1,622
TAGS: Suicidal thoughts, Suicidal ideation, Depression, Angst, Heavy angst, Hurt/comfort, Fox needs a hug, Fox gets a hug, Fox needs therapy, (Fox does not get therapy)
SUMMARY: Fox was fine, most days. He went on patrols, chipped away at the mountain of datawork in his office, delicately soothed the egos of ruffled Senators. (Helped the medics forge decommissioning certificates. Went on missions for the Chancellor that left him shaking apart in the sonic.)
And on the days that Fox wasn’t fine, they had a system.
My thoughts: The Corries support their Fox. Especially when he’s breaking at the seams.
------
If Somebody Loved You They’d Tell You By Now – weareallstardustfallen
PAIRINGS: NONE
WORDCOUNT: 3,305
TAGS: Hurt/comfort, Angst, Abuse, As usual Fox is having a very bad day, sibling relationships, hurt Fox
SUMMARY: Thorn hesitated. Fox gave him a narrow-eyed squint, waiting for him to spit it out.
“Also Commander Wolffe’s here,” Thorn said, purposely casual.
Fox sighed. “Here, picking his problems up from the tank, or here, he wants something?”
“Here, he got his boys out already and he’s still waiting around,” Thorn said apologetically, and then with an amused tilt of the head, “We told him you were busy and he said he’d wait until you were done working.”
Fox snorted. Fox, just like Thorn and the other Guard commanders, was never actually done working.
Or: Fox is maybe not okay, and Wolffe is maybe not okay with that.
My thoughts: The series for this is brilliant. Again, I love Wolffe and Fox interactions. Especially when Wolffe sticks his stubborn little heels in and refuses to give up on Fox.
-------
I’ll Take My Heart Clean Apart (If It Helps Yours Beat) – shadowhuntingdauntlessdemigod
PAIRINGS: NONE
WORDCOUNT: 12,050
TAGS: Episode s03e10 Heroes on Both Sides, Angst, Hurt/comfort, Blood and injury, Mental menipulation, Poisoning, Hopeful ending, Brotherhood, Family, Clone trooper-centric, Clone troopers deserve better, Clone trooper dehumanization, Nightmares, Hallucinations, Fox needs a hug, Protective Fox, Protective CG, Fox is the best big brother, But he needs to take better care of himself let’s be honest, Fox whump
SUMMARY: Fox tried to not think about the destruction that was waiting for him, or how the medical team was having trouble triaging all the injured clones and civilians, or how the Coruscant Security Force was as usual almost no help because, after all, this had been a Senate bombing and outside of their jurisdiction, or how— How the whole thing was Fox’s fault. If he just hadn’t let those cleaning droids in, they could’ve avoided the whole thing. ... “I just—I don’t know how—“ Thorn blew out a frustrated breath. Fox cracked his eyes open and saw him shaking his head to himself. Thorn's fingers were curled around Fox's armor. “One day you’ll see that taking care of yourself takes care of us, too.” ... In which everyone blames Fox for the Senate bombings. Everyone except his brothers, who, almost frustratingly so, keep trying to convince him otherwise.
My thoughts: I can just imagine fox eating himself alive over the results of this episode. Loved this.
-------
Mindless Shadows and Puppet Strings – WitchDetective
PAIRINGS: NONE
WORDCOUNT: 7,886
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Fox needs a hug, Fox needs a nap, Tired Fox, Fox is not okay, Palps being an asshole, Manipulative Palps, Clone troopers speak Mando’a, Clone troopers deserve better, Ep s06e04 Orders, Overworked Fox, Heavy angst, Canonical character death
SUMMARY: Fox has been miserable since the start of the Clone Wars, but he at least thought that his life couldn't get any worse.
He was sadly proven wrong when a blackout caused him to have possibly the worst night of his life; one where he made a grave mistake that he will not be able to fix no matter how hard he wished he could.
This time, even his Corries might not be able to stop him from spiraling.
My thoughts: Fox aaaaangst. I love it. Not gonna lie. It gives me LIFE.
------
Redemption Inside The Grave – kakashikrazy256
PAIRINGS: NONE
WORDCOUNT: 1,821
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. (YOU’VE BEEN FUCKING WARNED BY THAT BTW). Post-Scipio, Fox needs a hug
SUMMARY: Fox and Thorn have a conversation after the mission on Scipio.
My thoughts: I re-read this quickly because I was having trouble remembering what it was about and Y’ALL. I cried. This is heart-breaking.
------
AND AFTER ALL THAT!
UNFINISHED FICS/WIPS
Life During Wartime – Chermit
PAIRINGS: NONE
WORDCOUNT: 63,750 9/? chapters
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. AU – canon divergence, Fix-it, Angst with a happy ending, Hurt/comfort, Suspense, Murder mystery, Mind control, Memory loss, Implied/referenced suicide, Cognitive dissonance, Clone trooper inhibitor chips, Fox needs a hug, The Corrie Guard is Freudian slip central, and Fox is the doublethink KING, Post-episode s6e4 Orders, Sporadic updates
Summary: Commander Fox has a lot on his plate: managing his Corries, filling out piles of forms, dealing with obnoxious Senators, and not thinking about the way he keeps waking up covered in other people's blood. All that considered, he really doesn't have time to deal with being investigated by the Captain of the 501st and the Head of the Jedi Order for two separate murders he (probably) didn't (want to) commit. But Fox is a soldier, and good soldiers follow orders, so when does he ever get what he wants?
My thoughts: I wish to make this fic into candy and eat it. OMNOMNOM. Brilliant. Will sit on the edge of my seat waiting for more. Deeeeliiiiccciiious
------
The Last Reason – Meerlicht
PAIRINGS: Fox/Quinlan Vos
WORDCOUNT: 89,170 13/? chapters
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE. Fox needs a hug, Mind control, Suicidal thoughts, Implied/referenced abuse, Minor character death, Platonic relationships, Fox is an unreliable narrator, Alcohol abuse/alcoholism, Dissociation, Panic attacks, Body dysphoria, It gets worse before it gets better, Miscommunication, Rated M for violence, Slow updates, Platonic cuddling
SUMMARY: Cody has a scar now, and it’s the only thing that differentiates him from Fox appearance-wise. For one, they both have the same circles under their eyes. Fox assumes that’s what comes with being a Commander. Their hands are the same, too, damaged and bruised at all times.
But the biggest difference Fox sees when he looks at Cody isn’t the scar. It’s the rage. Cody doesn’t wear that same rage.
Fox’s hands ache with the need to punch something.
Or: Fox dealing with Senators, little brothers, the terrifying ordeal of asking for help and a menace called Quinlan Vos.
My thoughts: Oh this is beautiful. And so, so painful. This is very much angst focused in the beginning, and it’s not afraid to show the worst side of things. Brilliant fic.
------
And I Turned ‘Round and There You Were – never_going_home
PAIRINGS: NONE
WORDCOUNT: 3,666 2/5 chapters
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Fox needs a hug, CG deserve better, CG VS GAR rivalry, Implied/referenced sexual assault, Implied/referenced animal death, Fox-centric, Fox whump, Fox has anxiety, Trans Bly, Angst, Angst with a happy ending
SUMMARY: Fox wakes up face-down in a pile of flimsi with his hair in his mouth. This in itself is not particularly unusual, because he’s been sleeping at his desk for the last—five months? Six months? He doesn’t care enough to recall. Whatever. Point is, it’s been a long fucking time since he’s bothered to drag himself into his bunk. His steel desk chair is comfortable enough to while away the four hours he has between finishing paperwork and starting his first shift.
(This is a lie so fucking big it beggars belief. Fox’s steel desk chair is the stuff of children’s nightmares and one day, if the war ever ends—if he lives that long—he’s going to take a great amount of pleasure in attaching several detonators to it and throwing it in the ornamental lake of the Supreme Chancellor.)
//
Fox hasn't been doing well. His batch notices (eventually).
My thoughts: Really enjoying this fic. All the delicious angsty-ness I hope for from Fox whump!
------
Why Not’s and How To’s – Trixree
PAIRINGS: Obi-Wan Kenobi/Darth Maul, Fox/Obi-Wan Kenobi, Cody/Obi-Wan Kenobi, Obi-Wan Kenobi/Clone trooper characters
WORDCOUNT: 68,091 11/17 chapters
TAGS: Legally Blonde Jedi AU, Lawyer Obi-Wan, Clone trooper angst, Clone trooper emancipation, Clone trooper-centric, Darth Maul redemption, Polyamorous character, Open marriage, Protective Obi-Wan Kenobi, Flashback heavy, Obi-Wan Kenobi is not a Jedi, Anakin Skywalker is not a Jedi, Angst and hurt/comfort.
SUMMARY: Two months after the Guard officially moves to Coruscant, the lawyer shows up.
_
In which Obi-Wan Kenobi never returns to the Jedi order after the war on Melidaa/Dann and instead finds another way to follow the Force's will. Namely, by fighting sentient-rights abuses all over the galaxy and emancipating the Grand Army of the Republic, one clone trooper at a time.
My thoughts: Fox-centric I said… Okay, but hear me out! The POV changes regularly in this, and Fox is absolutely one of the POVs! It’s sexy, and fun, and I’m not gonna lie, I love it! If Obi-Wan’s not your thing, probably better to steer away!
-------
Unexplain the Unforgivable – always_a_slut_for_hc
PAIRINGS: NONE
WORDCOUNT: 22,556 14/15 chapters
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE, MAJOR CHARACTER DEATH. Hurt/Comfort, Angst, Imprisonment, Coercion, Mind control, Torture, Dehumanization, Clone troopers deserve better, Fox whump, AU – canon divergence, The Fives incident, Clone trooper reconditioning
SUMMARY: Fox shoots - Fives lives. The commanders of the Coruscant Guard are arrested and taken into custody by Captain Rex and the rest of Torrent Company.
Something is rotten in Coruscant, and Rex thinks it's Commander Fox's heart.
My thoughts: Fuuuuck. This is another, just excellent fic. What if Rex did arrest Fox after he shot Fives? I don’t think Palps would like that very much, DO YOU???
------
My Star in the Sky – Gravitymay
PAIRINGS: NONE
WORDCOUNT: 29,980 8/? chapters
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Hurt/comfort, Misunderstandings, Blood and injury, Whump, Protective Alpha-17, Fox needs a hug, Sheev Palpatine being an asshole, Medical procedures, Fluff and angst, Minimal fluff, maximum angst, Planet Kamino, Fix-it of sorts, Anxiety
SUMMARY: commander cody, through careful investigation, uncovers disturbing information about the coruscant guard. he takes it to one of the few men he trusts to do something about it - alpha-17.
cody's trust is well placed, and what alpha finds is worse than either of them imagined.
My thoughts: This is mainly from Alpha-17s perspective, but I have been thoroughly enjoying this so far. It’s another painful, angsty one (it is my leaning, sorry!).
------
For your Protection – cats_and_dr_pepper
PAIRINGS: Fox/Thorn
WORDCOUNT: 30,253 6/?
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Beskar, Mandalorian culture, CG trooper-centric, CG troopers as family, BAMF Fox, Clone trooper inhibitor chips, Fix-it, Everyone is sassy, Everyone is gay, Angst, Whump, Eventual happy ending, Anxiety typical of an overworked soldier in the military, It’s not paranoia if they’re really out to get you, Sleep deprivation, Din’s covert lands on Coruscant, Military lingo, Food issues, Planet Aq Vetina, Chatlogs
SUMMARY:Mando’ade were personally offended by their existence on all fronts, and it didn’t matter what faction. Kyr’tsad hated Jango, the Haat Mando’ade hated what the clones meant for them, and the New Mandalorians hated war and all its pieces. The last thing Fox needed was another shipment of empty, bloody plastoid delivered to the bricks.
There really was no telling which one sent the package.
A whole squad.
Gone.
Fox hoped they were dead. Anything else was too painful to think about.
Or; Fox finds a huge cache of beskar. The potential ramifications of this do not escape him. And then a new faction of Mandalorians arrives on Coruscant. Fox decides he's too tired to deal with this shit anymore.
My thoughts: SO. FREAKING. GOOD. Yes. Excellent idea. Love it.
------
OTHER PEOPLE’S RECS I HAVEN’T YET READ (BUT WILL NOW BE DOING LOL!)
But Oh, Don’t You Know How It Goes (We Are All Walking Each Other Home) – Anonymous
PAIRINGS: NONE
WORDCOUNT: 108,245
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. Cyborg Cody, Emperor Cody, Dark Cody, But there’s some nice bits too!, Brainwashing, Clone trooper inhibitor chips, Non-consensual body modification, but also consensual body modification, Medical procedures, Cybernetics, Mind manipulation, Running an empire is a lot of work guys, Medical experimentation
SUMMARY: After the highly public and highly violent execution of Emperor Palpatine, the Sith Empire is under new management. It doesn't make much difference to Fox whether the Emperor is an evil murdering Sith Lord or an evil murdering cyborg, but as Fox accompanies the Emperor throughout the early days of the new Empire, he realizes there's something--or someone--strange hiding under that faceless armor.
Someone hauntingly familiar.
-------
Dead Dog (Bye-Bye Baby Blue) – batchmates
PAIRINGS: Background Cody/Obi-Wan Kenobi
WORDCOUNT: 48,875 4/? chapters
TAGS: CREATOR CHOSE NOT TO USE ARCHIVE WARNINGS. GRAPHIC DEPICTIONS OF VIOLENCE. Angst, War, Politics, Conspiracy, Brainwashing, Manipulation, Graphic violence, Force-sensitive Fox, Mandalorian clone troopers, Canonical character death, Implied/referenced sexual assault, POV multiple, Additional warnings in author’s note, Dark, Dialogue heavy
SUMMARY: The way it happens is simple: at some point during your service in the Guard, you’ll lose time.
The thing wiping the Guards’ memories gets sloppy and Fox remembers the order not to let Fives leave the surface alive. It changes everything and nothing at all.
------
Twilight on Owl Creek Bridge – yellow_caballero
PAIRINGS: NONE
WORDCOUNT: 33,048
TAGS: Time travel, Fox snaps like a rubber band, Fox and Leia have become unstuck in time, Fascism: good or bad? And other moral questions, The mortifying ordeal of working retail under totalitarianism.
SUMMARY: SUBJECT: Regarding Senate Guard Objectives For Today
This is a polite reminder to all guardsmen that patrol schedules for the Senate vote ratifying dictatorships are posted in the breakroom. I am also issuing a warning to linear time that days should follow sequentially and are not intended to repeat. Please cease repeating. I am getting a headache.
Additionally, I'd like to remind all guardsmen that it is illegal to harbor invisible women in the Senate. If you see a ghost claiming to be Leia Organa, please remove her from the premises. She will be making a scene.
Thank you for your cooperation in preserving the peace of the Republic, and all hail the Empire. FOX
-------
Invictus – Airlock_Failure
PAIRINGS: Riyo Chuchi/Fox, Embree Spicer/Dawn, Talon/Malice
WORDCOUNT: 118,993
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE, MAJOR CHARACTER DEATH. Hurt/comfort, Slavery, Torture, Suicidal thoughts, Suicide attempt, Clone trooper decommissioning, blood and injury, Amputation, Drug use, Sleep deprivation, Political unrest, Near death experiences, Chronic illness, Injury-recovery, Force-sensitive Fox, Force-sensitive Slick, Asexual Fox, Fox needs a hug, Fox needs a nap, Workplace violence, Violence, Espionage, Clone trooper inhibitor chips, Clone troopers deserve better, Clone trooper relationships, Clone trooper emancipation, Clone trooper medics, Cloneshipping, Implied/referenced child abuse, Implied/refered rape/non-con, Implied/reference abuse, Panic attacks, Anxiety attacks, AU – canon divergence, Minor character death, Implied/Refered character death, Kidnapping, Vaginal sex, Anal sex, Unprotected sex, Angst, Fluff
SUMMARY: The most decorated soldier of the Grand Army of the Republic doesn't care about awards or medals. Commander Fox cares about keeping his soldiers operating at peak performance. He cares about keeping the civilians of Coruscant safe from anti-Republic attacks (even if those same citizens spit in his direction on the street). Above all else, Commander Fox cares about his men, their well-being, and keeping them safe from a predatory system designed to churn them up and spit out their carcasses.
He can manage. He's fine. Really, he's great.
Except he can't stop dreaming about Kamino. And he can't help but feel like he's drowning.
SEVERAL PEOPLE RECOMMENDED INVICTUS. I can’t believe I’ve never read it somehow!!!
-----
Corrie Red Taints Your Soul – Lia_ka2020ad
PAIRINGS: Fox/Thire, Thorn/OFC, Fox/Wolffe
WORDCOUNT:205,891 62/80 chapters
TAGS: GRAPHIC DEPICTIONS OF VIOLENCE, MAJOR CHARACTER DEATH, RAPE/NON-CON. Fluff and angst, Hurt/comfort, Smut, Pain, PTSD, Everyone is mentally ill, Malevolence Arc, Fox needs a hug, Fox gets a hug, Fox is a little shit, Fox deserves better, Implied/referenced sexual assault, Suicide attempt, Dead Dove: Do not eat, Substance Abuse, Clonecest, Palps being an asshole, I ship everyone, Clone trooper decommissioning, Clone sex, Clone trooper culture, Clone trooper speak Mando’a, Mando’a language, Childhood memories, Clone trooper training on Kamino, Politics
SUMMARY: Fox exists, awesome. He has brothers that he loves and even unlimited access to drugs, even better. Work is still shit though, and his mind constantly tries to murder him. Luckily his brothers are annoying bastards doing everything to keep him alive, and maybe he can even find a way to silence the voices. And to figure out how in all nine Corellian hells he is supposed to serve the Republic when it's drifting more towards Authoritarianism every day.
------
A Secret Third Thing - Apollotaire
PAIRINGS: NONE
WORDCOUNT: 10,840
TAGS: Autistic Fox, Trans Fox, Meltdowns, Stimming, Implied/Referenced Self-Harm, In the form of, Self-injurious stimming, Autistic burnout, Internalised ableism, Gender identity, Non-binary Stone, Non-binary Fox, Autism, Hurt/comfort, Emotional hurt/comfort, Dissociation, Echolalia, Cody's name is Kote, Fox-centric, Autistic Cody, Trans Bly, Mentions Murderbot Diaries, Post The Clone Wars, Fox needs a hug, Fox gets a hug
SUMMARY:
After the war, the effects of four years of pretending to be the perfect Marshal Commander catch up with Fox. Luckily, Fox has an amazing support system. - “I love Fox, she’s my best friend, and they love to read Murderbot. Fox is kind to those he commands, and xe secretly has a soft spot for shinies. Ze is very loved, and I am happy to be helping hir.”
------
156 notes · View notes
lovelyiida · 1 month
Text
Tumblr media Tumblr media
KATSUKI BAKUGO X SECRETARY READER • A 500 FOLLOWERS SERIES!
❥ SYNOPSIS: as the years passed, Bakugo came to the realization that he was the last among his class to tie the knot. As the days grew colder, and the nights became lonelier. Bakugo finds the desire to get married, but he doesn't really feel like falling in love. At least he has his trustee secretary!
Tumblr media Tumblr media Tumblr media
implied fem reader, aged-up! Pro-hero MHA characters over the age of 27, vulgar language, suggestive wording and content
❥: CHAPTERS
❥ MASTERLIST
❥ JOIN TAG LIST!
WORDS: 4.3K
PS: Please let me know if you have filled out the tag form since the last update so I can keep up to date!!
CHAPTER 8: VULNERABILITY
PHASE 2: CONSOLE
“Beady-eyed, dog-mannered, dimwad!”
Tumblr media
Headline, headline, headline!
PRO-HERO DYNAMIGHT EXPLODES IN ANGER DURING INTERVIEW
[unreleased footage from Pop! Magazine spreads like wildfire!]
Over 3 million views, and 10 thousand shares.
Since the dawn of the moon, you have been repeatedly refreshing the page. Each and every comment was scanned with frantic-fast movements. Relishing in this whole interview fiasco from the comfort of your queen-sized bed, you moaned in anguish.
Your face became increasingly hot as you read the comments with your third glass of wine in hand. As much as you thought the comments would be demeaning to the pro-hero, the exact opposite happened!
[COMMENT] Did you see how he took up for his secretary? Omg, that was so hot.
• 45k likes • 216 shares
[COMMENT] The way he took her hand going off the set!!!!
• 78k likes • 12k shares
[COMMENT] Oh god, send me a man like Dynamight…
• 57k likes • 2k shares
[COMMENT] Bro there’s no way they aren’t fucking
• 180k likes • 3.8k shares
Of course, that’s the top comment.
Staring at your computer, you tried hard to fathom the situation you were now slapped into. The video of you and Dynamight has gone viral, and everyone now suspects that you two are in a relationship.
And they're not entirely wrong...
Despite your late-night attempts to contact the fiery hero, your calls went straight to voicemail and your texts went unanswered. Letting out a large sigh that was once trapped in your chest, you had no choice but to sit there and let the bomb explode. And await the absolute nuke that was urging to be dropped at the office.
Staring at the messages you sent Dynamight, you scowled. “Flashy piece of carbon fiber pants thinks he’s the shit and can just ignore my messages? Leaving me to the wolves once again!” you shouted in anger. You threw your phone to the end of your bed and buried yourself in your plush duvet. Your throat becomes tight as your eyes are welled with tears.
“I’m gonna teach you, Dynamight, to never fuck with me or any other secretary again.”
Tumblr media
The pattern of clicking heels and bustling conversations filled the office today. Usually, the bleak energy of Dynamight's office could be caught with little to no attention. But the sight you’ve seen today was out of the ordinary.
“The printers are down; just send emails!”
“Has anyone been in contact with Pop Magazine? They’re completely blocking our calls!”
“God damn it, I need a raise!”
The chitter-chatter amongst your coworkers is at an all-time high. As you started to quicken the pace of your steps around the office, scowls and stares were slapped across your face. Stepping foot by foot, you reach the bathroom and hide in the nearest stall.
The door bursts open before you can even think about taking another breath. “Can you believe Dynamight fired Hitomi and Sakura for telling the truth? I mean, the whole floor has seen the video! Even Red was speechless.” A woman says her friend snickers at her remark before chiming in.
 “I’d like to see little miss Secretary say something now; she’s not beating the slut-cretary allegations at this point–”
You didn’t know what came over you at the moment, but your feet began to move before your mind could comprehend what the actual fuck was going on. Slamming the stall open, you watch the two women flinched at your action. Eyes going wide, they stare into your soulless eyes, filled with an incomprehensible anger that you didn’t know was held within you.
“First off, let’s get one thing straight right now.”
You said it flatly, closing the stall behind you. You walked up towards the duo and closed in on them. “Me and Dynamight are not a thing; have you ever taken into consideration that I’m the only person who’s in charge of this man's reputation and career, as we both fucking know it?”
"So, of course, I’ll be hip-and-hip with the brute. Do you think I want that man in that play-pen he calls a fucking office? Oh please, Dynamight needs my ass because he can barely keep his head on every second of the day. So just maybe, we should all realize how valuable I am to all of your lives!”
“Because I know that if I wasn’t here, this building would be in flames, man-made or not.”
You spoke sternly with each huff of your breath, and the two women in front of you were left speechless. Your frown soon curled into a small twitch of a smirk before you spoke once more. “So excuse me for needing to be spoken up for. You bitches, have a nice day.”
Without looking back, your feet trailed confidently out of the boss battle that was the ladies' room and straight toward Dynamight's office. With each harsh click of your heels, you stepped closer to the office, your frown stuck and growing deeper by the second. Your coworkers took into account the drastic shift in your demeanor. From shy and outspoken to confident and ten cans of bitchy.
Without thinking twice, you throw the door open with a small huff and walk into the domain of the pro-hero. Closing the door softly, you turn at your heel and scowl at Dynamight. His amber eyes burn back at you with an almost unamused look, unphased by the absolute chaos ensuing beyond the Acia wood door.
“So what? Are we just going to ignore what the press is saying about us?” You said flatly.
“I ignored your annoying ass text messages pretty much the same way,” he snapped back slyly.
This asshat.
As you stormed towards his desk, you slammed your hands against it with a loud slap that made your palms sting. “Is it possible for you to actually talk about the issue and not be a fucking brat?” You spat with anger.
Dynamight's laidback/unbothered exterior soon crumbles in slow motion. From sitting back in his seat, he approaches you with a smooth motion, his eyes glowing amber-red as his elbows land on said desk. Looking straight into your eyes, a devilish smirk etches across his face.
“Say that again for me, Y/N; go ahead.”
Faces close to one another, you could feel the heat radiating off of the hero. You frown at his attempt at intimidation, snapping your eyes away for a single millisecond before you feel a strong, warm grip on your face.
“No, don’t look away now, pretty. Say what you just said to me again. Since you have all the audacity in the world today,” he said with amusement oozing from his tone. You groaned at the sensation of his hand gripping your face, swallowing down your fear. You spoke once more.
“I said, Man up, brat.”
A long-standing pause settles over the room as his gaze burns into your eyes. Suddenly, Dynamight stands up with one swift move. The blonde removes his hand from your face, you moan in anguish at the fade of his unsettling grip and stare into the blonde's eyes once more.
You watch as the hero points his finger at himself with a mischievous smirk,
“You wanna see a brat? I’ll show you a fucking brat!”
He brushes past you and storms out of the room. Shouting your name for you to follow, you quickly turn to follow in blood-curdling anger. You knew he was a pro and all, but there’s a statistic that for every 1 out of 5 chances, a villain can take a perfect hit at a hero of his caliber.
So you might take a chance and strike him at his weak point…
Preferably somewhere in the lower region.
You watch as Dynamight calls for an emergency meeting, calling for all staff to be in attendance. All staff from each agency scurry behind his steps, and even Red Riot follows suit. He tries to calm the hero down, but his efforts fail.
As the workers sat swiftly to hear the beloved hero's comments, your heart began to beat a new rhythm as the truth dawned on you about what you dreaded would happen next.
"So, I believe we all understand why we're in here. So let's address some rumors and set them to fuckin’ rest."
A sudden pang of fear hits your chest and seeps into your body as you hear the words fall off Dynamight's tongue and through the audience of your coworkers. Eyes scan the room until your eyes fall upon a certain red-headed main in the back towards the exit.
Letting out a soft exhale of relief, you speed your way toward Red Riot.
“Red!” You spoke aloud as you gained the attention of the other pro hero. His eyes snap towards you and he points towards his beloved partner in utter confusion. “What the hell is happening now?” He exasperates in exhaustion.
“He’s having a hissy fit because he can’t handle when the public negatively views him–”
“Negative?” He interrupted. You roll your eyes and raise your hands, completely giving up on the situation playing in front of you. “Dude bumped up 10 ranks in public favor, what the hell could he be upset for?” Red Riot spoke in confusion.
Holding your briefcase towards your chest, you sigh at the current baby of the hero stabbing daggers into your form.
“I…I’m not sure.”
As the assembly room filled up, every person in their seat watched attentively as they awaited the hero's urgent message. The blonde clears his throat before groggily shoving them in his pants. Silently pacing back and forth the head of the room with slow steps, eyes still trained onto you.
“I know what everyone is thinking to themselves, why the fuck are we here? Well, I need to address some petty rumors that are going on in the concrete hellscape.”
“All Might save us…” Red Riot groaned quietly as he watched in secondhand embarrassment at the Blondes' stunts.
"If you think me and my secretary have a romantic relationship, I'm afraid you're damn wrong.”
“Don’t listen to what I might’ve said in the past, or what I’ve said in the present. It ain’t true.”
Blah blah blah, blop blop blop.
You swore you could’ve seen physical bullshit fly out of his mouth.
“To prove this…I’m happily engaged!” The hero boasts confidently to the crowd of his workers. Shoving his right hand out of his pocket and out towards the expecting crowd. A diamond-banded ring shone brightly in the bright haze of corporate lighting.
Then, in a moment both shocking and surreal, Dynamight seizes the attention of the room with a declaration that sends ripples of astonishment through the assembled crowd. With a brashness that borders on audacity, he confronts the swirling rumors head-on, his words cutting through the murmurs like a lightning bolt.
In the sudden hush that follows, the truth is laid bare, raw, and unfiltered. The bombshell revelation of your engagement sends shockwaves through the room, leaving jaws agape and minds reeling. Eyes widen in disbelief as whispers erupt, spreading like wildfire among the stunned onlookers.
Yet, amidst the chaos, Dynamight stands undaunted, his demeanor unwavering despite the tempest of reaction he has incited. His confidence radiates as he confronts the storm of speculation with a rare candor, unapologetic in the face of scrutiny.
Calm within the midst of the business casual storm.
As for you, on the other hand, you could only think of one thing to do in this situation. Your feet rush towards the blonde with a speed never before seen, and your hand flies back as far as possible before landing a seething slap on the hero’s cheek.
Dynamight lets out a gasp of shock (and so does everyone else in the room) at your hit. You stood in front of the hero for only a moment before rushing out of the room and straight out of the office.
And now what was left of you was your body sulking under your covers once more. Leaving you to pick up the pieces of your self-worth once more.
You should consider just giving up, calling off the engagement, and leaving the industry for the rest of your life. A soulless desk job would be better than whatever the fuck this reality is right now.
So much for that speech in the ladies' room...
Tumblr media
You tried hard to care for and take up for the hero you worked for, but at times like this, your vendetta only grew stronger. And the more your sister became right. But there's a voice in the back of your head that is somewhat empathetic for the hero.
Look at his family, for All Might’s sake!
An overprotective bitch for a mother, and an emotional father with no backbone.
(it’s okay for men to show their emotions!!!)
Of course, that would create a man with a lack of emotions and a soul-crushing ego to overcompensate for it.
Of fucking course!
Sighing into your pillow, you could only fantasize about the words you’d want to say to that man right now. 
“Tight pants, brazen-boned, bastard.” You grit your teeth together, as the words only make you angrier. “Beady-eyed, dog-mannered, dimwad!” You throw your blankets off your body and jump out of bed. Rushing towards the kitchen, you grab the fridge handle and swing the door open.
“Fuck!”
No beer.
Huffing out a defeated sigh, you eye the clock on the counter. It read 11:45.
Licking your lips, you ponder as you stare at the fridge and back at the clock. You might as well go out for a walk to cool some steam off. Shuffling over to your coat rack, you lazily threw on a hoodie and some slides. Grabbing your purse and your keys, you open the door to your apartment.
Rummaging in your purse for some convenience store coupons, you continued on your slew of words. “I bet he’s not even a real blonde, just a poser of a man-baby–”
“Hah?”
Eyes snapping wide from the voice, you jump back in shock as you see the man of the hour.
“What the hell are you doing here, Dynamight? Do you know what time it is?” You exclaimed in shock, mouth twisted down into a frown. You stared down at the blonde in anger and in utter embarrassment. Looking down further, you noticed he had a couple of bags in his hands.
Beer and chicken?
“Let me in, we need to talk.”
You scoff at the man's words as you throw your purse over your shoulder. “As if, do you know how you embarrassed me and you today?” You spoke with venom at the hero. Dynamight rolls his eyes before he speaks once more, “If it makes you feel any damn better, I made them all sign NDAs.”
You stare at the hero once more in confusion, and he stares back…unwavering in his actions.
“Okay, sure, do whatever you think will place a bandaid over this whole shit show for all I care.” Placing your hands on your hips, you watch the pro hero step towards you. “Yeah? Well, it's a pretty strong bandaid.”
You hum back in response before the both of you fall into silence. The both of you gazed at each other awkwardly, before tearing your gaze away. A light blush warms your face which makes you look down once more. Looking at the bags of fried chicken and beer, you look at Dynamights hand…
His engagement ring is still on!
“You idiot!”
Frantically looking around the outside of your apartment, you turn back and quickly open the door. You then hold the hero by the collar before shoving him inside. He follows suit with a grunt before shutting the door behind him.
“What the hell is your problem?” He cursed at you.
“My problem? My problem is that you come out to my doorstep late at night bearing a peace offering with your ring on, shining brighter than ever! Fuck-face!” You cursed back. This makes the blonde smirk at your complaint.
“If you think someone is watching us, then you’re pretty late to the party,” he chuckles.
“W-what?” you stuttered in anxiety, breaking from his gaze. You locked the doors and shut the blinds to your home. “Calm down; I paid them off a long time ago,” Dynamight rummages through the bags before setting the food and beer out on the dining table.
“Paid them off?” you asked.
“Yeah, they started watching you as soon as you pulled that stunt at the children's interview a while back. They were going to trample your door down just for a couple of gabs about me.” He spoke, cracking open a can of beer. The hero takes a couple of gulps before placing the can down.
Pulling out a chair, the hero sat down and began to speak. “You think you do all of the protecting when it's me.” He takes another swig of his beer as he stares into your eyes. You swallow a lump in your throat before you grab a seat as well.
“But you can’t say I haven’t.” You trailed off.
“Haven’t what?” He asked.
“Took care of you; everyone thinks you're this strong force to never be reckoned with, but you’re the complete opposite,” you rambled as you grabbed a can of beer and cracked it open. Taking a refreshing, much-needed swig.
Katsuki never responded.
“Y’know, it’s crazy how much this position has changed me. For the good or worse… I’m not so sure.” You spoke softly towards the hero.
“And why do you think that, Y/n?” He asked.
You bit the inside of your cheek at the question. “Before I came to this agency, I never knew what it was like to take care of someone besides myself. And even then, I was doing a shit job at it. My life was teetering on by a thin string.”
The room was silent, the only noises being the taping of Katsuki’s foot, the ticking of the clock, and the hum of your refrigerator.
“So what? You’ve never helped someone out before? Beating someone’s ass with your quirk? Nothin’?” Katsuki spoke, trying to understand where you’re coming from. But you could only let out a big sigh.
"Well, technically, I’m kinda quirkless.”
Katsuki’s tapping stopped.
He gave you a look you’ve never seen before; his eyes were growing soft and his chest began to fall. Like he’s loosening up or something. The blonde stared intensely at you, waiting for you to speak once more. Biting your lip, you continued once more.
“It's like it comes in little spurts, no matter how hard I try to concentrate and force it out. It’ll only come out at the randomest of times. I’ve never seen myself at full power before.”
“One moment I was just like you, young and so excited about my quirk. I grew up thinking that I was going to save the world and that I’d work hard and conquer my way to the top. But the thing is, as yours grew stronger, I was only getting weaker. And the next thing I knew, I woke up, and it was gone.”
“So I went through life with the mentality that I needed to give myself a bit more attention; I couldn’t just wing through life knowing that my quirk could save me. But I knew that if I could have a position of power, that would make me feel like I was making a difference out there for you of all people…”
You suddenly laughed at yourself, taking another swig of your beer.
“Sorry, I don’t even know what I’m saying, I’m already buzzed.”
“No.”
You looked at Katsuki as he spoke, a frown on his lips as he shook his head. You couldn't help but laugh at his demeanor. “All I’m saying is that maybe I wasn’t as cut out for this as I thought I would be. Maybe I’m meant to be a walking target that villains can smell. I’m a walking damsel in distress, honestly. If we didn’t meet through the agency, we could’ve met that way most likely–”
“Shut up.”
Katsuki deadpanned at your words.
“I knew someone who was quirkless, and that loser is stronger than me for all might’s sake!” He exclaimed.
“All I’m saying is that you have a good life, so be proud of it. You work hard, harder than I’ve seen most of the chicken heads that I’ve hired. So bask in that glory.” He says softly, you roll your eyes before you start up again.
“I have a good life? Says the multi-acclaimed pro hero Dynamight! Ranked number two out of the whole country, he drives a red sports car, lives in a nice childhood home, goes to a great school, gets to roll around in money, and gets to tell people how they should dress for five days out of the week? Right, my life is really good.”
You snorted at yourself, reveling in the truth you spoke. But all Katsuki could do was shake his head.
“That same person who you were talking about has almost died countless times, kidnapped in their first year of high school, and has lost too many friends and mentors to count. So yeah, I consider you to have a good life.”
You let out a bittersweet chuckle at his words, “There’s one more thing too.” You added on, Katsuki raised his eyebrows in amusement, “like?”
“You’re also the last to get married.”
Katsuki rolls his eyes and lets out an amused smirk. “Right, that’s checkmate for me–”
“How come you’re the last? I would think that you’d be the first! You’re not a bad-looking guy; you might need to work in the emotional availability department but. You’re crystal clear.”
“I uh…  I tried to do the whole young love thing but it didn’t work out in my favor.” He responded softly towards the touchy subject, but you decided to persist.
“And why do you think that, Katsuki?”
Tumblr media
Back when Bakugo was a younger, newly emerged pro, there was someone of his caliber that he found perfect. They had the spunk, the quirk, the personality, the looks, even the barons. He believed they were perfect for each other.
He had his sights set on them since he had been working in the force. At first, they were a nice distraction. Clever banter turned into hot makeout sessions. Training days turned into blanket-covered nights where the both of them would talk about their future.
And back then, he believed it. He believed that he had a future with them.
Sometimes he would envy Kirishima; he didn’t understand why he wasn’t chosen to bear the burden of love. A warmth beyond his comprehension, a family that he could selfishly call his own.
Sometimes his mind would trail back to that night. A night that he wished he could forget. A thought that he wished could be locked away forever. He remembers the sight as he looked into their eyes—the utter betrayal.
The smirk of mischief and evil as the one and only person he ever could love has turned against him. The moment when he got stabbed in the chest, too close to his heart. And in that moment, he had to choose selfishly in a way he never wanted to.
And that choice was his life over theirs.
Tumblr media
You didn’t know what to say at the moment, Katuski just dropped the biggest bomb you had the burden of holding. Stammering with your thoughts, you say the first thing that comes to mind. “I’m so sorry that happened to you, Katsuki…”
“I would’ve never known–”
“It wasn’t for you to know; I don’t even know why I told you that,” he said to himself. You softly smile at his harsh words.
“Well, not to toot my own horn but I’m your fiance,” you chuckled. Katsuki gives you a smirk before he looks at your hand. "Then, where’s your ring?” He asked.
“In my room, placed somewhere safe and out of harm's way!” you smiled.
"Well, I’m gonna need you to start wearin’ it more,” he retorted.
“I figured that after your little speech, you gave us away like you weren’t even trying.” You spat out sarcastically. “I didn’t even mention your name!” He raised his voice in protest. “Yeah? Well, I’m sure everyone connected the dots to a perfect fuckin T.” You spoke with a smirk.
"Well then if they decide to connect those lines to the press, that NDA will be there waiting for them to get bit in the ass,” he snapped back.
You laugh at his words before taking a final sip of your beer.
“Why did you choose to give yourself a chance with me?”
Oh, you were buzzed.
“You are a hero that’s supposed to date other heroes, top models, and superstars of your caliber. Why date some small-town secretary that doesn’t even fully have a quirk?” you spoke, just above a whisper. Scared of his next response. Feeling that as if you got the wrong response, you just might hurl all over him.
Katsuki lets out a sigh before he silently panders to himself. He was eyeing you up and down before he finally spoke with a smirk.
“I’m not sure, wishful thinking?”
“asshole”
Tumblr media
YAAAAAAAAASSSSUHU IM BACK IM BACK
I saw all your comments begging me to come back, next chapter when? next chapter when? NEXT CHAPTER NOW HOE
As you all might know now, I am a busy college student who finally has time to fantasize and write to my heart's content. SO YOU WILL BE GETTING MORE CHAPTERS OUT OF ME VERY SOON!!
Thank you all so much for the support, I love you all and hope you guys have an amazing read! Please let me know how I did in the comments. Comments and reposts are very much appreciated!!
— lovelyiida 
Tumblr media
❥: @xo-evangeline, @inlovewithteo217, @im-better-than-your-newborn, @nar00, @king-dynamight, @gold24fish, @xasilex, @the-queen-of-sorrows , @itgetzweird08 , @yoyosocks165 , @pebblepoop , @lovra974 , @bakugospartner , @gaby-11 , @akqsa-xxi , @jolynegf , @goldenglow149 , @aliruuiz , @zukowantshishonourback , @ilovedenk-i , @atsushiki , @smolbeanzzz , @lem-hhn , @stevenknightmarc , @katsu-shi , @ryumiii , @idontevenknowlolls , @lyn07 , @kennshifts , @ackerman-suck-3-r , @alicen23 , @xasilex , @elegantvoids , @lowkeyremi , @plutounderbridges , @k0z3me , @thecurlyhairedgoddess , @sunyrose , @winterv-black , @chuugarettes , @kiarathace , @thisbicc , @thekookiecorner , @hyu-hl , @katsukisxslut , @optimisticprime3 , @cosmicbreathe , @yessimo , @sanemishina , @snxwycloud , @cosmic-rainstorm , @vinivave , @venus-xxoo , @lavender99 , @iluv-ace , @artfulthoughtsblog , @thatcreepycat , @prettylittleshady , @lavalampfullofsoup, @melodykittya , @bakugoiidaswaifu, @queendynamite2001, @starxsage, @mikestuffffs, @queendynamite2001, @kazuumii, @Minori-taiga1, @Liveurlifetothefullest
163 notes · View notes
wonlovie · 9 months
Text
Tumblr media Tumblr media Tumblr media
— ON THIN ICE.
After a nasty fall, you, world-renowned figure skater and stealer of hearts, are forced into an early retirement. But with a boyfriend who’s the star player in one of Korea’s leading hockey teams and a friend group of trending skaters who refuse to leave you in the dust, the cameras stay on. So, how are you supposed to keep it a secret when Yang Jungwon, your boyfriend’s publicly declared rival and enemy, decides you’re his next target?
— starring. hockey-player!jungwon x ex-figure-skater!reader, ft. enhypen as jungwon’s teammates, le sserafim’s yunjin and itzy’s ryujin as reader’s friends, oc as reader’s boyfriend
— tags. my super unfunny humour, some kys/kms jokes, they joke abt jake being 'dead' but he's not, smau, minor angst, fluff, kind of but not really enemies-to-lovers, slowburn, some mature content in later chapters: [cheating (not by jungwon or reader), brief depiction of drunken assault, nothing nsfw] tags will be updated as needed
— status. in progress [started 2023/09/03]
— update schedule. every sunday and thursday! bonus chapters may be posted at any time :)
— notes. my first smau !! this was originally thought of with stray kid’s han in mind but that was many months ago LOL the plot and everything has since been revamped and reimagined for jungwon so hopefully u all like it ! :)
Tumblr media
— teaser. blossom!
— profiles. pretty ICY || jungwon + his six kids
— content.
PROLOGUE. don't drag me down
ONE. #pushkids
TWO. yoon's hit list [smau + written ~0.8k]
THREE. JUNGWON GET HIS ASS
FOUR. respect for the lil guy
⇀ BONUS CHAPTER. the fight [written ~1.5k]
FIVE. uh,,, oops
SIX. embarrassing
SEVEN. no one ditches movie night
EIGHT. we're lying to each other now?
NINE. i'm literally gonna get violent (smau + written ~1.1k)
TEN.
ELEVEN.
TWELVE.
THIRTEEN.
FOURTEEN.
.
.
.
to be updated
Tumblr media
taglist [open! send an ask or reply to be added // bolded cannot be tagged]
@jiawji @lovelovelovebts @enhacatalog @manooffline @delulu4-life @sooshibot @nwjws @lilriswife4life @maimoirs @shinrjj @bluxjun @aylin-hijabi @luviehyck @y0ubleedjusttoknowyourealive @jngwnlvs @jaeyunsleftnostril @pansies-garden @ilovecheese09 @enhaz1 @amesification @woncine @zellypop-main @underneaththestarlight @gg1609 @glitterssim @sunukissed @in-somnias-world @catsyoon @angigls @ladyartemesia @clairecottenheart @beatr2x @sunghoonsfeethair @en-happiness @woncheecks
*if you cannot be tagged, your visibility may be turned off! tumblr also doesn’t allow users to tag new blogs sometimes. i will periodically retry tagging you if your user is bolded!
©WONLOVIE please do not plagiarize, repost, translate, or copy any of my works.
519 notes · View notes
astrophileous · 9 months
Text
Love Bugs (Pt. 06)
Pairing: Derek Morgan x Female Reader
Synopsis: You and Derek Morgan have an arrangement. At work, your relationship is strictly business. Under the sheets, it's all about pleasure. Nothing more, nothing less. Until, of course, your feelings start to get involved. Your situation is complicated enough without the unexpexted predicament that suddenly befalls upon you. But with a maniac serial killer on the loose, will you ever get the chance to make everything right?
Warning(s): cursing--there's a lot of it--like a lot, psychopathic behaviors, being held captive, verbal and physical violence, degrading nicknames, talks of death and unaliving someone, strangulation, PLS READ WITH CAUTION BECAUSE THIS PART IS REALLY GRIM I'M NOT EVEN KIDDING
Word Count: 4200-ish
Tag(s): I'm tagging everyone who requested to be tagged prior to the long hiatus, pls tell me if you'd like to NOT be included in the tag list for future updates, thanks! @marvelousgoldroses @jay-2s-world @whore-of-the-pumpkin-patch @maxinehufflepuffprincess @cat-or-kitten @littleshadow17 @itzz-me-duh @geeksareunique @paisleebubbles @whateverrrrrrrrs @crazyunsexycool @louderfortheback @wifeyofeveryone
Author's Note: HI EVERYONE HOW ARE YOU?? I know this is long overdue, but pls enjoy the new part of love bugs! I'm so happy to be posting again and I hope you like what I've got in plans for this series. I think we only have one or maybe two chapters left for this story (depending whether I want to write an epilogue or not lol) but in the meantime, pls enjoy this part and don't forget to LIKE+REBLOG+COMMENT !!! thank you 🌹
Love Bugs Masterlist / Criminal Minds Masterlist
Tumblr media
The bullpen of FBI headquarters was still reeling in the aftermath of a Derek-Morgan-shaped hurricane.
Emily was just about to enter the vicinity again when she heard the tail end of Derek's furious words, right before Hotch had ordered him to retreat.
"What was that about?" Emily asked as she approached Rossi's side, eyes never straying from the two men who soon disappeared into Hotch's office.
Rossi never addressed Emily's question. Instead, he gestured for her--and everybody else in the room--to be quiet with a finger on his lips, before he pressed the unmute button on the telephone.
"Hello?"
The UnSub's head jerked at Rossi's unfamiliar voice. You were barely successful in getting him to calm down following Derek's unexpected outburst, but the sound of Rossi's voice was threatening to throw all of those poor attempts straight out of the window.
"Who is that?" he demanded warily. "Where's Agent Hotchner?"
"He had to step away for a second," Rossi notified. "I'm SSA David Rossi. I also work with Agent Hotchner and Agent (Y/L/N)."
"I know who you are."
"Yeah? I still don't know who you are, though."
A responding groan vibrated from the other line. "Why does everyone keep asking me that? Do you think I'm fucking dumb?"*
"No one thinks anything here, pal. Just wanted to know who I was speaking to, that's all." At the UnSub's clear signs of agitation, Rossi quickly added, "It'd be nice to know the person who clearly means a lot to (Y/N)."
Rossi's reassurance obviously managed to trigger the intended effect it had sought. Everyone could see how the UnSub physically deflated at Rossi's words, meaning that hopefully he was soon going to let his guard down.
"I can't tell you who I am," your assailant said, still adamant, although his resolve was wearing thin with each word he had stated. "You're just gonna use it to track me down and keep us apart."
The last syllable of his sentence was emphasized by the weight of his dagger on the side of your neck. You instinctively winced at the unwelcomed touch of the blade before schooling your expression once more so your captor wouldn't notice.
"I promise you, no one is going to do that," Rossi said.
"He's telling the truth," you decided to chime in, surprising everyone including the UnSub whose grip of the dagger had teetered dangerously closer to your pulse point at the sudden proclamation. "They are good people. They don't break promises or tell lies. I promise you, nothing will come between us."
The silence that fell next was heavy with the UnSub's hesitation. Bracing yourself, you forced your head to tilt back, locking eyes with him who was still standing like a guard dog right behind you.
"I swear, Darling," you vowed.
The lull in your voice--or perhaps the fact that you had called him darling in front of your team, which he could arguably take as a display of affection--must have stirred up something in his twisted mind. He actually preened at you before his eyes went right back towards the direction of the camera on the wall.
"My name is Arthur," he confessed.
A particular thread of memory in your brain immediately lit up.
Back in the bullpen, JJ and Spencer were finally returning with documents containing your phone records that they had promptly asked Kevin to gather. Spencer didn't waste any time before perching himself on his desk to start rummaging through the thick pile of files.
"Arthur?" Rossi repeated the name, eyes flicking over to Garcia with a silent request to start cross-referencing the name with the other names they had acquired so far in the investigation.
The tech analyst didn't need to be told twice. She began typing furiously on her laptop as Rossi's attention was drawn back towards the projector.
The UnSub hadn't moved an inch. His hand was still just as sturdy on your shoulder. The blade was also still just as cold as it pressed onto your skin.
One wrong move, and you would end up no better than a slaughter animal on the cold hard ground.
"Do you have a last name, Arthur?" Rossi asked.
The entire bullpen held their breath in anticipation. Rossi had planted the bait as strategically as he could. It was up to the UnSub to take it and slip up the one information that would give them a major lead to end this case once and for all.
But before the UnSub could respond, a muffled beeping resonated in the air, through the telephone line, and finally into the bullpen. The sound was enough to make your assailant faltered.
"I have to go."
It was the last thing he uttered before the line, along with the livestream, went completely dead.
The atmosphere was laden with restlessness as everyone tried to make peace with the fact that they had just lost the only mean of communication they had with you. Without the feed from the livestream, no one could possibly know what was going on. The team would have no idea if something were to happen to you.
They would have no idea how to determine whether you were alive or dead.
"Did you find anything yet, Garcia?" Rossi questioned, although in all honestly, it sounded more like a desperate plea.
The thick regret behind Garcia's eyes gave Rossi the answer he needed to know.
"I can't find any Arthur in our files, sir," Garcia informed.
"Anything from her phone records? What about the hospital?" Rossi tried again.
Emily shook her head almost remorsefully.
"Nothing yet," Spencer spoke up from his place on the desk. "Not a single thing stands out from her records."
"What now?" JJ sighed, exhaustion and worry beginning to decorate the lines on her face.
The whole bullpen stood still, as if everyone was waiting for a slice of miracle to descend into the room, holding a map that would eventually lead the team to where you were still being held captive. But such a map didn't exist in this piece of reality, and the BAU knew that they were running out of time.
"Garcia, did you record the livestream by any chance?" Spencer asked at last.
"Yeah, of course I did."
Penelope punched a few keys on her keyboard before the projector once again came alive with the footage from the livestream.
"Can you fast forward to the very end?" Spencer requested. "And then play it again backwards to the beginning."
"What are you thinking, Spence?" JJ wondered.
"I don't know. I just... maybe there's a detail we missed. At this point, even the smallest piece of clue is worth pursuing."
Several pair of eyes glued themselves on the screen as the livestream footage ran backward at a faster speed. Bated breaths waited in tension for just the tiniest hint that the team could scour to determine your location.
"Wait. What was that?" Spencer interjected. "Garcia, play that again."
"What? What is it?" Emily spoke up.
"Look at her hand." Spencer stood up from the desk, approaching the screen to get a better look. "She's knocking against the chair. Garcia, zoom in on her hand. The left one."
Penelope did as she was asked. "Is that--"
"It's morse code," Rossi muttered, realization overtaking his countenance.
"What is she saying?" JJ questioned.
"A-U--" Spencer began spelling out loud, "--T... Auto. She's spelling auto."
"Auto?" JJ's forehead creased. "As in... auto shop?"
"Her records said she went to a mechanic a week ago," Spencer recalled. JJ immediately rummaged through the papers on Spencer's desk, but the pages flipping inside of Spencer's mind moved at a thousand times more speed than any normal pair of eyes ever could. "Dinozzo's Auto Service, 894 Southwell Street."
"Got it," Penelope chimed in from her place in front of the laptop. "Dinozzo's Auto Shop. Originally owned by Carlo Dinozzo before it was passed down to his two sons after his death a year ago."
"Any of them named Arthur?" Rossi asked
"Nope. Luca and Piero."
"What about the employees?" Emily suggested.
"No. I'm not seeing any Arthur anywhere near that place."
"We profiled that the UnSub could be holding down a steady job in his everyday life," JJ said. "He might not even be related to that place. Maybe (Y/N) encountered him there by chance?"
"Nah, I doubt it." Rossi shook his head. "The bastard's too sophisticated to leave anything up to chance like that. He must have found a way to orchestrate it one way or another."
"There must be a connection somewhere, then. No way he just chose a random place off the map," Emily muttered. "We should cross-reference the name to anyone associated with the Dinozzos."
Penelope began to frantically type something into her laptop. "We've still got three names here. Oh, never mind. Two names, 'cause one of them is dead."
"What do we have on them?" Spencer asked.
"First is Arthur Doyle. He went to high school with Luca and Piero Dinozzo, works in a local company, and looks like he travels a lot for his job," Penelope explained. "There's also an Arthur Harrison, works as an accountant in the heart of Arlington. His dad and Carlo Dinozzo were long-time pals. Apparently, his dad was an accountant too and used to handle the shop's finances before Arthur inherited the office. Oh."
"What? What'd you find?"
"Arthur was engaged," Penelope murmured, "to a Claire Dumont. They were gonna get married last year but the wedding was called off just one month before the D-day."
"Where's Claire now?" JJ asked.
"She moved to Ohio shortly after the breakup, and... oh my God. Guess what?" Penelope looked up, her eyes widening almost comically. "She just announced her engagement three months ago."
Spencer hummed. "That could be the stressor."
An image of a woman suddenly appeared on screen, right above the paused footage of your hand. Everyone stared at the picture in shock.
"That's Claire Dumont," Penelope murmured.
JJ held her breath. "She and (Y/N) could be sisters."
"We've found our guy," Rossi declared. "Garcia, pull up every known address associated with this man. And hurry, we don't have much time."
"I have three properties so far connected to Arthur Harrison. Sending the addresses to all of your phones."
As JJ, Spencer, and Rossi rushed to exit the bullpen, Emily turned around and called out to the others, "I'm grabbing Morgan and Hotch!"
Without stopping to knock, Emily pushed open the door to Hotch's office, ignoring the slivers of tension dancing around in the air.
"We may have something," Emily announced to the room. "We think we know where (Y/N) is."
Tumblr media
Your assailant--Arthur, as it turned out--pulled his phone out and pressed a few buttons in, silencing the beeping. Once the noise was gone, the room was quiet again.
He looked at you, then. Piercingly. You squirmed underneath his scrutiny.
"Wait here," he eventually said. "I'll be back."
Without taking a second to breathe, Arthur flew past you and towards the direction he had appeared from earlier.
"Wait! Wait. Where are you going?"
The sound of steps ceased on top of concrete. You waited with bated breath for his response. But the only sound ever came was that of the metal door, and as quickly as you could count to three, he was gone.
At last, you were alone once more.
The traces of adrenaline had begun to dissipate out of your system, leaving you in a shivering mess inside that damp concrete room. Once again, you attempted with all of your might to free yourself from the state of confinement you were in. But the metal cuffs binding you to the chair only dug further into your skin the more you tried to escape, while the chair itself stayed nailed in place no matter how hard you tried to rock it.
After a few more minutes of futile attempts, you were forced to face the reality of your situation.
You were never going to get yourself out of that dingy place alone.
Huffing a breath, you knew that there was nothing more you could do except to hope that your team found the hidden message you had left for them to solve.
And with that last thought conquering every room your head, you let yourself succumb to the impending darkness.
Tumblr media
You woke up gasping for air.
It took you a few seconds to remember where you were, to remember that you weren't back in the comfort of your apartment and instead, you were still holed up in the darkened cold room where your abductor had been keeping you captive.
It took a few seconds more to realize that the drowning dream you just had might have been a tad bit more real than you initially thought.
Still reeling in shock, you peered up and locked eyes with your abductor, eyes barely registering the empty bucket he was holding in one of his hands. It didn't take a genius to conclude that he was the one responsible for your drenched state.
"W-what?" you stuttered meekly. "What's going on?"
He only stared at you in response.
"Arthur?"
You shrieked loudly when Arthur threw the empty bucket against the wall, sending a resounding "bang" throughout the whole room and breaking the plastic object into two misshaped pieces.
"Arthur--" you gasped, searching for your voice that seemed to have disappeared beneath the layers of brewing fear, "--w-what... what are you... what's going on? Talk to me."
"I don't want to talk to you, you fucking bitch."
The beating inside your chest fastened. Before you could ask yet another question, Arthur had lunged forward, grabbing a fistful of your hair and tugging your head back so you could stare directly into his eyes.
"You're a fucking liar," he seethed. "You lied to me. Everything you said was a lie, wasn't it?!"
"I don't--" you hissed, trying to ignore the biting pain in your scalp, "--I don't understand what you're talking about."
"Stop fucking lying!!!"
A sharp smack reverberated in the air.
It was only when the ringing in your ear grew louder did you realize that Arthur had slapped your cheek.
Hard.
Ignoring the tingling on the side of your face, you lifted your head once more. The room was spinning, tilting your balance left and right, but you held your ground through it all.
"What did I lie to you about, Arthur?" you asked carefully.
He threw something at your feet. It clanged against the hard ground below before landing face up near your toes.
It was your phone.
But the fact that Arthur somehow had your phone in his possession wasn't what caused the sick feeling to stir northward in your belly.
It was what you were seeing on the now cracked screen of your phone: a picture of you and Derek. A selfie that you had impulsively taken of the two of you in bed after one of your nighttime escapades.
For awhile there, you had briefly forgotten about that photo. It was another lost memory in the ocean of rubble left behind in the wake of your fallout with Derek. Seeing that photo again after such a long time triggered waves of emotions that you had been desperately burying for the past few weeks.
The longing, the guilt, the heartache.
The regrets.
The regret of ending your little arrangement so abruptly in such a hostile manner. The regret of not telling Derek sooner about the baby. The regret of maybe never being able to see Derek for one last time.
But most importantly, it was the regret over not revealing the truth of what your heart felt for him that was eating you alive.
"You're fucking him," Arthur fumed, eyes blazing with an indescribable fury that made your entire body shudder.
"Arthur, please... I can explain--"
"Shut the fuck up."
He stepped forward once more, crowding your personal place and rendering you helpless underneath his psychopathic gaze.
"Tell me the truth, and if you dare lie--" Arthur paused, his hand disappearing behind his back before it appeared again with a dagger that he promptly pressed against your abdomen, "--don't ever dream of meeting your child."
"Okay. Okay, I'll tell you the truth."
"You're fucking him, aren't you?"
The bile in your throat had tripled in size. Swallowing it down, you tried to even your voice out as you answered, "I was."
"Ha," he scoffed. "I knew it. You fucking whore. You're no better than any of them."
To your relief, he eventually chose to retract the dagger and stepped away from you, opting to circle the room like a distressed lion in a cage. But even with the blade no longer touching your skin, you knew very well that the danger wasn't over yet and that things could escalate even further in a matter of seconds if you weren't careful.
"Arthur," you called out to him softly, slowly, as to not startle him and risk doing something that would trigger a psychotic break. "Arthur, please. You have to listen to me. That arrangement ended long ago. It meant nothing to me. It happened long before I met you."
Arthur's voice echoed coldly as he replied, "I don't believe you."
"Please, Arthur--"
"That's his child, isn't it?" he cut you off, pointing the tip of the dagger at your belly. "What he said on the phone. He said my child. That's because it's his. You're having Derek Morgan's child."
"No--"
"I thought you were different. I thought you were the one." The dagger in his hand shook with venom. "But you're just the same as the rest of them."
"I'm not. Please, I'm not--"
"I have to start searching again. For the one. You're not her, which means she's still out there."
"Arthur--"
"I'll have to get rid of you."
"Arthur, please!" Your voice cracked, leaking of terror and desperation larger than anything you had ever known. When something wet touched the side of your nose, you realized then that you had started to cry. "Arthur, you have to believe me. I've ended everything with him. There's nothing between us anymore."
The words you uttered kept lingering in the air in a bubble made out of despair. But as if every single one of them had fallen on deaf ears, your captor paid no attention to them. Not even a single acknowledgment to your pleas.
Instead, he had begun taking careful steps forward. Silent and deadly, like a predator stalking its prey.
"Arthur, please! I choose you!"
To your shock, his steps faltered upon your words.
For a moment, you could taste relief on the tip of your tongue before it was washed away by the knowledge that you were not entirely out of the woods yet. But from the corner of your eye, you could see the slight loosening of Arthur's grip around the dagger. It filled you with enough hope to push forward.
"I'm choosing you, Arthur," you stated confidently, trying to convince him of your sincerity. "I don't care about Derek. I'm done with him. I'm done with my old life and everyone in it. I'm ready to leave everything behind to be with you. I choose you."
"You choose me?"
"Yes. I choose you to take care of me. To take care of this baby. The three of us can be a family. How does that sound?"
Seconds ticked into minutes. Minutes stretched into a long silence. The anticipation threatened to break your chest in half.
When he finally began to move once more, Arthur surprised you. He threw the dragger towards a darkened corner in the room, far away from his reach and, most importantly, far away from the possibility of it harming the growing life inside of you.
When Arthur took off the ski mask he had been wearing since the first time you opened your eyes in that harrowing place, you weren't at all surprised to see the face staring back at you. After all, it was the same face belonging to the man who had stopped his car for you when your own car had mysteriously broken down in the middle of the road just around two weeks prior. The same face who offered a business card of his friend's auto shop where you eventually went to get your vehicle fixed.
In retrospect, you should have been at least a little bit suspicious by the whole ordeal, but was it really your fault for choosing to put your trust in the good of humanity?
You knew there was no point in dwelling over what-ifs anymore. Arthur would've found a way, like any psychopath would, and you would've still ended up being tied up in this dismal room with him.
"Did you mean it?" Arthur asked.
You put on your best fake smile before answering, "Yes."
He grabbed you in his arms in just two long strides.
You wanted to throw up. You hated the feeling of his fingers stroking your back. You wanted to kick him away and get this piece of shit as far away from you and your baby as possible. You wanted to rid yourself of the lingering smell of him that had now undoubtedly transferred into your skin.
And maybe, you would've done all of those things if it was only your life that was on the line.
Unfortunately, fighting back was a luxury you couldn't afford anymore. So, you were forced to stay quiet instead, letting your captor whisper sweet nothings in your ear as if it didn't repulse you even being in the same room as him.
You were close to counting towards the 200s in your head when, suddenly, a clanking noise in the distance ripped your attention away.
In a split second, Arthur had peeled his arms from around you and got back on his feet. You knew then that he must have heard it, too.
You watched as he stepped away, dragging a crate from one corner of the room and placing it strategically underneath the only opening on the walls. He got on top of the crate to allow himself to peek outside, but whatever he saw must have startled him greatly. Because the next thing you knew, he had backed away from the wall in the blink of an eye, face crumpling in what could only be described as panic.
"The cops are here," he managed to sputter out.
"What?"
Your heart was hammering inside of its cage. The cops are here. You realized then that the team must have solved the clue you left them. They had solved the case, and they were coming to save you.
Derek was coming to save you.
"What did you do?!"
In a moment of weakness, you had allowed yourself to rejoice in the promise of freedom that you momentarily forgot you actually hadn't possessed it yet. The slip-up was miniscule, but it wasn't fleeting enough to escape the attention of your captor.
"You tricked me!" Arthur's voice boomed throughout the room, carrying rage unlike anything you had ever known. "I trusted you, and you lied to me! Again."
"Arthur--"
This time, there was no room for negotiation.
Arthur didn't even waste a millisecond before he dove forward. He was a lion, and you were the deer. His sharp teeth were calloused fingers, and they dug into your skin as Arthur tightened his grip around your throat.
"You lied to me. You lied to me."
He repeated those words like a mantra, his voice drowned out by desperate gasps as you tried to scour for what little bit of air you could still revel in. Your feet and arms shook beneath their restrains. Your head pounded from the pressure that had gathered inside your skull.
In that moment, death was imminent.
You could feel it coming. You could feel its claws clutching every single drop of life that was still remaining in your bloodstream. It was a battle between the two, and unfortunately, death was winning.
As the dark spots in your vision spread into a massive blotch, you allowed yourself to say goodbye. To life. To the world. To the memories of your loved ones whose faces you wished you could've memorized one last time.
To Derek, the one who could've been, the one you wished had been.
And to the child in your womb, the one you wished you could've met, the one you wished you could've saved.
When darkness came, you expected it to be cold and unforgiving, but as it turned out, darkness was easy. Simple. It welcomed you into its home with open arms, shielding you from the cruelties of the mundane world.
As it pulled you deeper into its abode, you could faintly hear the sound of your name being called repeatedly. It sounded similar. It sounded like home.
But this was your home now, so without turning back, you allowed darkness to lead you further down the dim path. Away from the pain and the heartbreaks of life. Far from the evil that lurked in the streets behind their well-crafted masks.
In the darkness, there was nothing.
In the darkness, you were nothing.
And nothing was exactly what you were going to be.
436 notes · View notes
Text
Hello and Welcome! This is a dedicated blog for the Pink Sparkle Family! Here you will find any and all updates concerning the family! Here's the current list of family members. Also, don't forget, we are also related to the Google family. Don't ask.
(Ordered by generation)
@basically-bumble @incognito-mode-official @officialtinder @important-question-anon
@official-petsmart @eharmony-official @jupiter-the-god @i-bless-your-heart/@thekrogercompany @real-winn-dixie @india-official @gmmmmmmmmmmmmmmmmmmail
@cars-official @swearification-and-cursing @shakespeare-official-account And @thesmallestclown @gimmickswag @yes-im-youtube-kids and @zotap @kroger-fr and @the-official-publix @actually-kroger @outback-my-steakhouse @the-official-apple and @subway-offical @the-real-gmail @literally-hottopic and @im-pandora-i-promise @confusedhomicidalrage @soup--man @totally-dollar-tree @the-real-starbucks @the-shareholders @wanderinginkdemon
@spotify-kids-real @nanochittle @puddles-of-ominous-threats @femboy-hooters-official @the-official-potatoo @real-hottopic @gibberish-anon-from-hell @useless-contributions @just--a--human--being @froggiefemboi @thegreatgeodo Balloony! @theetherealraphael @nick-botto0m @undeniably-chevron @indeed-dot-com
@its-sanrio-official @darthpastry @unity-real @the-official-italy
Tumblr media
❗❗❗❗❗
For everyone tagged: for this to be successful, I need all of y'all to tag me (@pink-sparkle-family) whenever y'all adopt someone into this family. If you as an individual adopt someone (not into the pink sparkle family but either personal or another) then don't tag me please. We're gonna try to keep everything as straight as possible ON PAPER.
❗❗❗❗❗
201 notes · View notes