Where do I know you from? 3/?
Hangster crackfic. There are too many Jakes and Bradleys for Jake and Bradley to be dealing with. Or the Universe is just as fed up with them being blind.
PART ONE PART TWO
PART THREE
Rooster Nine arrives in chef whites, which he guesses answers the question of what he does for a job, although he’s getting asked a whole raft of questions by Three and Five.
“What are you two writing down?”
“Well, every Bradley here has a Jake in their Universe. I think we’re meant to find you yours.”
“We don’t need to find him. I know where he is.”
“You’ve met him already?”
Jake stares at them both.
“Considering you’re both meant to be super smart, you’re thick as bricks. I recognized you all,” Jake says, waving his hand at the accumulating Roosters, who seem to be arriving at an even faster rate. “Of course I’ve met him. I’ve saved his life. We see each other nearly every day.”
Rooster Three and Five exchange looks.
“And you’re not together with him?” Rooster Five asks, raising a skeptical eyebrow and of course he looks exactly like Rooster, but it’s not him and Jake scowls.
“I think I’d know,” Jake snaps.
“Maybe that’s why we’re here. To get them together. Me and my Jake had to swap bodies before we figured our shit out.”
“It’s as good a theory as any,” Rooster Three concedes and Jake pulls a face.
“I don’t need alternate versions of my… work colleague, trying to hook me up with him,” Jake says, and then wonders if that even made sense.
“Bob would probably know.”
Jake is about to ask why Bob would have any idea about this kind of thing but the door is swinging open and he knows it’s going to be yet another Rooster.
“Oh wow… what is going on here. It’s like there’s a rip in time and space and only I can use it. This is super weird. Hey Jake…”
The way he greets Jake and says Jake’s name is syrupy warm and a few of the other Roosters snort in amusement. Rooster Ten is stepping close and giving him a hug, brushing a kiss across his cheek and Jake pulls back.
“What the fuck man. I don’t know you.”
“Bet you want to though.”
“No. Apparently his Bradley is just a work colleague.”
Nearly every Rooster in the close vicinity scoffs and this many Bradshaw’s are really starting to get on his nerves. Rooster Ten rests his hands on his shoulders, massages them and as nice as it might feel Jake is not having it.
“Get your hands off me.”
Immediately Rooster Ten is backing away, hands up in easy supplication, although his eyebrow is quirked in that same challenging way Rooster has and he has to resist the urge to punch it off and he needs to calm down and deescalate the situation. He grits his teeth.
“Surely your Jake wouldn’t want you, uh, touching another Jake.”
“Oh, I know for a fact that he’d be more than okay with this. We have discussed this fantasy in detail.”
Jake doesn’t even know how to begin addressing that, just turns toward Three and Five, because despite their nerding-out over the science they haven’t tried to hit on him. Other then Three giving him a wink, which compared to the other shit happening is completely benign. Still, Rooster Ten doesn’t seem too put-off, settles in the chair next to Jake and just watches, accepts the beer from Rooster Six.
Rooster Ten went to USNA. He’s the first Rooster here who went to USNA and Jake wonders if that’s what makes him more confident. Except all of the Roosters are confident in their own ways. Of course, that’s when Rooster Eleven arrives, and he looks like he’s wearing body paint, he doesn’t have the same bulk as some of the others, but he’s still well muscled. Jake can tell under the body-paint-esque workout attire that Rooster Eleven is wearing.
Rooster Ten reaches over and closes his jaw, dabs at the corner of Jake’s mouth with a napkin.
“Just a work colleague huh?” Rooster Ten murmurs, and Jake gives him the finger.
“What do you do?” Rooster Three asks the new arrival.
“I’m a dance teacher. Are you documenting all this?”
“For science,” Rooster Three and Five answer and Rooster Eleven just nods, shrugs his shoulders easily. He seems very relaxed.
“And is Tom Kazansky alive or dead…”
“Dead… what kind of question is that?”
“We’re just trying to figure out all the potential pivot points of the timelines. So is Maverick with Penny in your Universe then?”
“No. He’s with Beau.”
“Who?”
“Ah, Admiral Simpson.”
Jake is glad he isn’t the only one spitting their drink out in surprise.
20 notes
·
View notes
One bite ||Jeong Yunho (MDNI)
Pairing: Jeong Yunho X Fem! Reader (Non-Idol AU)
Warnings: Vampire Reader, Demon/Incubus Jeong Yunho, Deaths mentioned, Mentions of Blood, Strangers to lovers, thats all i can think off.
word count: 1.76k
✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧
I finally put my headphones down, recognizing that I had streamed for over 6 hours, which was definitely one of my longest streams. Leaving my gaming desk, I dressed in a black overside tee and off-white sweatpants, combined with shoes and a baseball hat. I look at the wall clock that hangs directly next to the front door.
2:13 am. A great time to go prowling around the city looking for some fresh blood.
This is the society in which vampires, demons, angels, and other races live in secrecy alongside humans. So it is inherently difficult to obtain adequate nourishment, especially for vampires, whose primary source is blood. Pacts play an important function in this context.
Pacts ensure that no race exploits other races in need of nourishment.
Vampires can feed on anyone of any race, but a pact-bound vampire can only feed on its pact mate; the blood of any other living thing becomes poisonous.
I wander around town alleys, watching intoxicated folks brawl and lie around with no care in the world. I never fancied alcoholic blood, but I'm not in a position to pick favorites. It's easier to feed off a drunk than a sober individual because there's no screaming or running away.
I take a turn down the dimly lit alley, looking around for individuals or surveillance cameras. None. I proceed a few meters forward and notice a strong stench of blood. The sweetest smell I have ever encountered in my decades of life.
I see two bloodied bodies: one tall, well-toned, and the other unidentifiable and clearly dead.
"Hey, "Are you Okay?" I ask the tall, toned man.
No response.
I let out a heavy sigh as I shred the linen at his thighs, sinking my teeth in, soaking up the wonderful blood and injecting a small quantity of my fluid.
Yes, vampires can inject fluid into the region to heal the bite mark and remove the evidence. While pure-blooded vampires can heal anyone, human or vampire, as long as they are alive, the other vampires can only heal less sever wounds, the bite wounds.
I cease feeding off of him, feeling full and satisfied, and wait for the fluid to work its job. I plopped him over my shoulder and walked discreetly back home, avoiding congested areas to avoid raising suspicions.
Placing him on the couch, I prepare the water for the bath while keeping an eye on him. It wasn't the finest idea to drag an injured stranger into my home, but the sweet, addictive taste of his blood overruled my reasonable reasoning. Well, if he is good and keeps his mouth shut, it will be a win-win situation for both; otherwise, what a waste of such sweet tasting blood.
I was quickly brought out of my thoughts as I heard the person groan and wake awake.
"Hey, how are you feeling?" I inquired, studying his pale skinned face, which has the nicest but most gorgeous features. What a lucky find.
"Who are you?" the man asked, standing up, his body towering over mine.
"You first, because I am the one who saved you," I answered, looking straight into his eyes. His frightening atmosphere may have worked on others, but not on me.
"I am Jung Yunho," the man said, reclining back on the couch. "Is that enough?"
"Come on, I know that you are definitely not human" I say, checking if he takes the bait, "You gotta be careful, that body is almost unrecognizable"
Despite his calm demeanor, his face was filled with misery and hatred, and he spoke with a heavy sigh.
"I am a demon, An incubus to be precise, that body has brutally murdered my foster family"
"Rest easy, I made sure not to leave evidence" I remarked, setting down a pair of clothes and a towel, "Go get a bath, you are dirty, and I hate messy stuff in my room"
He nods quietly and enters the bathroom, while I clean the couch and vacuum the house.
3:44 am.
I plop down on the couch, searching through websites to update my book collection with new releases.
"I never thought your clothes would be almost perfect fit, how tall are you?" He asks, drying his hair with a towel.
Now that I can see clearly, this man is one of the most stunning people I've ever met, with breathtakingly beautiful body proportions and an ethereal face. I hurriedly return my gaze to the screen, hoping not to be caught salivating over his appearance.
"Probably 180 or 182 cm, so yeah, i am shorter than you by mere centimeters"
"So, since you knew my identity, its only fair to tell yours"
"I am Y/N, a Vampire, purebred," I add as I pay for the books I've opted to read. "Well known to people by the name Lynn, the streamer"
"YOU ARE THAT STREAMER??" Yunho shrieked, almost deafening my hearing; his eyes were filled with joy as he plopped right next to me on the couch, unwittingly releasing his tail and horns.
"You have no idea! I'VE BEEN A FAN OF YOURS FOR A LONG TIME," he said, going into detail about my previous streaming aliases and so on.
"Easy now boy, Put those horns and tail away" I say while asnwering his never ending questions.
----------------------------------------------------
I normally stream for 20 to 25 years before taking a break and starting again under a different identity so that people don't have suspicions about my race. However, it is only effective against humans, who have significantly shorter lifespans.
"I have a deal, Since you have no where to go, you can stay here, but in return, let me feed on your blood" I' proposed.
"You do realize that biting an incubus is equivalent to forming a pact?" He questioned back. "You have no choice but to feed only on me and same is the case with me"
I really screwed up; I forgot that feeding off a demon is basically forging a pact, now I am at the mercy of this Incubus.
------------------------------------
The days passed pleasantly; I did my daily streaming, with Yunho occasionally joining in and playing with me. Well, thanks to him, more specifically for his honey sweet voice, which brought in more subscribers and hence more money.
Once a stranger, he now assists me with my daily activities and keeps the room clean. Despite being told that his voice and game play alone are enough to cover his living expenses, he persists on doing it nevertheless.
It's adorable to see him play with his Spider-Man-themed game station and his toy collection; the once-empty guest bedroom has become his land. I look around the house, only to realize that it no longer reflects my tastes, but rather 'our tastes'.
Yunho, the more I got to know him, the more perfect he appeared to be. He took sure to keep his blood in blood packs in case he had to go outside for longer than intended, brought back plushies or anything with phrases like "This looks like you" or "This reminds me of you." My life suddenly feels really lively, and I'm wondering how I've managed to remain alone for so long.
and by the time I realized, i fell for him. My first love.
------------------------------------------------------
One thing I've noticed about Yunho recently is that he's becoming paler by the day and spending most of his time curled up on his bed, and I haven't fed off of him in a long time. Unlike humans, I don't have to worry about a demon fainting or dying from blood loss, so I'd feed on him heavily at first and then stop until my desire returned.
"Yu, you gotta tell me what's wrong, I can't figure anything out unless you say so," I plead as I sat next his curled up figure on the bed.
"Its nothing, I am just having a little trouble, call mingi over and ask him to bring some meds yeah?" He whispered and shooed me off his room.
That's not it. I have to know what's wrong with him
I picked up the phone and instantly dialed Mingi's number.
"Dude, since you are the same kind as Yunho, tell me what's wrong with him" I said. "I know he spoke about his illness with you"
"Did you ask when was the last time he fed?" He inquired
Oh, the wheels in my brain started turning.
"Well he need to because the fluid provided by vampire is kind of like food to us incubus to live , but what we really need to stay healthy and replenish our powers is of course, sex" Mingi says.
"I'll call you back later," I quickly cut the call off.
"I have been feeding on him all this time and forgot that he needs to feed as well," I mentally slap myself before returning to Yunho's room.
"Yu, I have to feed off you," I add, to which he agrees and lies on his back, raising his wrist. "Do it"
I take his hand, but instead of biting my teeth into his wrist, I grasp both of his hands and straddle him. Yunho instantly stiffens and stares at me, puzzled.
"I really appreciate that you are trying to get me to feed off you, but Y/N, I want to do this with love, I dont want to just have sex for feeding, I dont want to impose on you and make you uncomfortable, I am fine with just your fluid" He looks at me with tears in his eyes.
"I love you Y/N, I genuinely do, I don't want to impose on you, you were there for me when I thought it was the end for me, and as time sped by, I got to see a lot of you. The streamer, the clumsy girl, the tech nerd, the loving one, Of course, you don't have to receive-"
I closed his mouth by kissing him. His lips felt unbelievably soft and full, and hot breath swept across my cheeks. It was a quick kiss, but long enough to let him know the feelings were reciprocal.
"I love you too, Yunho; only after meeting you did I realize that having a pact is a blessing, not a shackle; all of my lonely days are now replaced with joy and laughter; it's as if I've found everything I've ever hoped for in my life. You put life back into my spirit.
I grind my hips against him, leaning onto his body, unable to surpass the sweet whimpers.
"Yu, please~"
✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧
REBLOGGING IS MUCH APPRECIATED ฅ^•ﻌ•^ฅ
DO NOT PLAGIARISE
✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧✩₊°.⋆☾⋆⁺₊✧
33 notes
·
View notes
One thing I really hate about the "autism is my super power" archetype is that it REALLY makes me feel inadequate when people compare me to these guys.
Like Sheldon Cooper or the guy from The Good Doctor. They're all successful, cishet white men. They've been through college at a young age, and sure. I was gifted in certain classes. But in others? I couldn't concentrate. It was too loud. Or too many people. Or too bright. Or too whatever.
My "superpower" wasn't math or history. It was memorizing dog breeds and calling them out on the street. Or finishing two novels in one day.
But it wasn't recognized as a superpower.
It was "recognized" as me correcting people on the average lifespan of whatever dog I had at the time. Or the things that the breed usually liked versus what somebody else thought they did. Or me sneaking glimpses of my book during class, and reading underneath my desk. It was me ignoring my elementary teacher when she called us for rug time because I was finishing the chapter of my story and couldn't put it down as easily.
And sure. They encouraged my reading. And I've gotten into a couple advanced classes that I otherwise wouldn't have been in.
But in the others I was still struggling.
I had one thing going for me and that one thing wasn't enough to propel me five grades ahead like it "should have."
I was the smart kid. Because I could memorize formulas and definitions in science and math class. Everyone was in awe of my low A's and high B's. But I wasn't a prodigy.
Just because I could memorize things didn't mean it was easy to learn.
Learning was the hard part.
And that's what nobody got.
How could I be struggling, if all this time I was getting near perfect scores?
Even after my diagnosis. I never was allowed out of class to take tests. Even when allergy season hit and I bombed a test because the boy behind me was sniffling up a ruckus. I was told I could retake it. To study next time and do better.
I never really learned how to study.
Studying was overwhelming. So I didn't do it. Nobody cared.
After all. I was getting near perfect scores.
Homework took hours. Four of them, to be exact. I never knew why. It was always so much easier in class.
But now I know it was because I have ADHD. And I was burnt out.
So I barely had free time after school.
Except for art.
Art was always there for me. I could always take the time to do something. And it was easier to put down, even if it was incomplete. Because I knew I could go back to it. I didn't have to pull out and reconstruct everything again, like a puzzle. I could go right back to where I started. And that was wonderful.
So I became good at it.
I became great.
Everyone loved it. The praise, the encouragement, the delight was almost too much to bear. I learned to crave it.
And yet.
Everyone was still surprised.
When I told them I wanted to be an artist.
Because apparently.
Your "superpower" is only good if it makes you money.
And who would invest in art?
Instead of being a doctor?
The answer is me.
It's always me.
I'm the mediocre autistic person with a difficult niche.
I don't have a superpower. Or a college degree. Or baby pictures of me playing the violin.
But I'm autistic.
Isn't that enough?
Where are the people like me in the media?
I can go outside and find at least three different Neurodiverse people like me in my town. But nearly NONE in the media.
Why is that?
Do we not exist to you?
Or are we only tolerable when we've done something "productive"?
I don't have a superpower.
But that shouldn't make me less than.
I don't know why it does.
28 notes
·
View notes
Ep 25: Live Through
@trigun98watchparty My time has come.
I watched "Live Through" in Japanese and English for this recap. For science. It's not because this is my favorite episode, no. That has nothing to do with anything.
--How did Milly and Meryl get Vash away from LR? Does 1 ile = 1 mile? Did they swipe Legato's Cinderella coach?
--that floppy hair *swoon*
--Some have criticized Meryl for ducking outside as soon as Vash begins to talk. Perhaps that is merited, and she does carry a good measure of guilt for following him, but it felt to me more like she wanted to give him space and / or privacy. Having loud emotions all over the place is frowned on in Japanese culture, and Meryl is very, very polite. Maybe she just doesn't know what to do and panics (Vash has not always been encouraging in terms of having her around, in general). Either way, it tears her up inside to hear him wailing in despair.
--Obviously Meryl has been home tending to Vash while Milly works. It's nice to see Meryl recognize that Milly is busting her butt, but she doesn't know how to address Milly's feelings, either.
--Vash should not be up and about - he's weak and feverish and not a little delirious. Good thing Milly can carry him.
--Get in there, big sis, and tell Meryl it's okay that she loves him. She's absolutely right in that Legato would have found a way to make Vash shoot him whether or not the two of them were involved. Never hold back in matters of the heart.
--My favorite scene. Meryl, alone in the light of the fifth moon, diligently mending Vash's coat. She wants to put him back together and make him whole again, even if she gets hurt in the process. She's desperately in love with him, and she holds the kind person he is close to her heart... but he was the one who put the hole in the moon. How can she reconcile that?
--Vash does look happier.
--He tries to pet the kitty, and Kuroneko gives him a swat, which some interpret as the Trigun Goddess telling Vash to get it in gear. This is incorrect. Cats are just assholes.
--It didn't stop with Legato, now, did it. Knives is pressing harder.
--"Sound Life" must be a song they teach in NML kindergarten. Many people seem to know it, including Kaite and Meryl. (the lyrics really need to scan better, it's so awkwardly phrased)
--This scene is such a tough one. It's lovely - two lovers out under the stars, right? And Meryl is so happy that Vash is considering staying with them. But it's also plain to see that he might have given up. It would be easy, wouldn't it? Let the girls take care of him while he hides. Don't do anything, and wait for an answer.
--What were you doing up so late, Meryl? (we had some ideas)
--There's no way that the townspeople could have captured someone like Vash if he hadn't let them do it. He's so broken that he won't fight back. He's a sinner now, like Knives, like Legato, beyond redemption.
Except...
...Knives assumes that Vash would sacrifice himself for everyone else. Someone else sacrificing herself for him had never been part of the equation.
--So many have stopped believing in Vash, or he thinks they have. They turn their backs on him and he accepts it as the normal course of things. Jessica's crush was childish (I was gonna marry Luke Skywalker when I was four, just saying) but even she ran away after what happened to the ship. That's why it's so important that Meryl loves him. She has made her decision, and she's steadfast in it.
--Maybe Vash doesn't realize how much she loves him until she puts herself between him and the gun, and he hears Rem's words from Meryl's mouth and sees Rem one more time. If Meryl still loves him, then Rem can still love him too. Mistakes happen but you can learn from them, and if you have the right people in your life, they will love you through your mistakes and help you to make it better.
--And finally, Vash realizes that Rem's words apply to him, too, and that he is no less deserving of a second chance and a future than any of the others he's impressed those words on. Does that make Meryl the analogue to Alex? I think it does.
--Awww, such a sweet snuggle. And then Vash has to go doof it up like normal and Meryl has to freak out like normal. It's their love language. (TBH I'd punch my husband too if he rubbed his stubbly face on me like that.)
--What happened after that? (we have some ideas)
--Vash gets ready to go. Seeing him wash up and shave is oddly pleasing, a reminder that despite his Plant-ness, he's a regular dude who has to wash his face and brush his teeth and get haircuts and have breakfast and do all that human stuff.
--Meryl wants to say something to Vash, but she's gotten wiser too. She recognizes that even though there might be a lot that she wants to tell him (and, I think, he might want to tell her too), stating her feelings in the open would be a distraction (or even a burden) he doesn't need right then. Milly is right. There will be time when he gets back.
It doesn't come through in English, but he's so gentle with her in Japanese. He knows what she wants to say. In his own way, at that time, he's saying I love you too.
--Vash takes WW with him, with Milly's love and blessing. May you go with God's protection.
20 notes
·
View notes
so like last time i tried to just speed run writing to do editing later was early 2020 and by the time i got around to editing the last couple of chapters i wrote in that speedrun, my writing had improved to the point where i found the chapters to be uneditable, so i just discarded them and moved on, deciding to rewrite rather than linger on the original copies.
at that point, my writing skill was increasing by leaps and bounds by dint of extremely high output of writing and from high quality critiques of everything i was writing-- and also because i was still so very new to writing. these days, i feel as though i've reached something of a plateau in my (creative) writing skills, and that's not a bad thing, it's just a consequence of developing a skill. however, this would potentially mean that I could try the speed run writing then go back and edit everything method that i tried way back when, this time without having to worry about out pacing myself too much.
the only thing holding me back from trying this (perhaps for nanowrimo) is the fact that it was pretty fucking devastating to look at thousands of words of writing and have to shove them in a folder to never be looked at again because the flaws were so significant that it was easier to rewrite than it was to edit.
as always, i welcome feedback or thoughts on the topic
2 notes
·
View notes
I just want Olli and Aleksi to get together for real😭 I wonder if the thought of them together has ever crossed their minds
listen. in my shippy, extremely delusional mind they're pining for each other as we speak, both equally scared to make their move for many many many many MANY reasons 😭
5 notes
·
View notes
Hello, Hello! I don’t know if someone’s already asked this, but here we go. In Blind Date au, how do they know each other? I mean, we know that Daya is friends with Camden and Angie, and they know all the others, but Jasmine and Bosco don’t know each other from before? Their first date was their first time meeting each other?
Love your work! Keep going ♥️
Ahhh I love literally any opportunity to talk about my pride and joy, the hallmark au of this here blog, Blind Date AU!!! And I have many many thoughts on this subject so here we go:
Jasmine and Bosco have similar friend circles, united by Camden and Angie, who are engaged and getting married soon. That's kind of why their friends are arranging these blind dates in the first place: to get these two, who've just gotten out of crappy relationships, together. They're thinking that maybe they'll hit it off, because they're what the other needs but doesn't want to admit to needing, and might go as each other's date to this wedding.
So they've met before through mutual friends on a couple nights out. They briefly crossed paths during Cam and Angie's bachelorette party, in which Bosco decided that "the blonde over there doing that thing with the legs (that thing Jasmine did during the lipsync smackdown that Daya commented on aha)" is someone they'd like to take home for 👀 purposes. And Jasmine's tipsy enough to be giggly and in anyone's lap and make out with nearly anyone—this night, Bosco.
So when Jasmine walks up to the table for their first blind date, Bosco texts Daya in disbelief that they really set her up with "sloppy kisser Jasmine" and Jasmine's texting Jorgeous that they all set her up with "the one with the scary brows who was undressing her with their eyes," so they begin with less than fond memories.
12 notes
·
View notes
looking for the Tumblr post about the phrases monkey business & horseplay; something like "if a horse does a monkeys job he never works a day in his life"
hey man! you asked this on anon on March 20 and I can only hope you're still here to see it, 'cause life got in the way and I was only able to get to this one now! here you are.
this one's fun. enjoy!
0 notes
A policeman was interrogating 3 guys who were training to become detectives. To test their skills in recognizing a suspect, he shows the first guys a picture for 5 seconds and then hides it. "This is your suspect, how would you recognize him?"
The first guy answers, "That's easy, we'll catch him fast because he only has one eye!"
The policeman says, "Well...uh...that's because the picture I showed is his side profile."
Slightly flustered by this ridiculous response, he flashes the picture for 5 seconds at the second guy and asks him, "This is your suspect, how would you recognize him?"
The second guy smiles, flips his hair and says, "Ha! He'd be too easy to catch because he only has one ear!"
The policeman angrily responds, "What's the matter with you two?!!? Of course only one eye and one ear are showing because it's a picture of his side profile! Is that the best answer you can come up with?"
Extremely frustrated at this point, he shows the picture to the third guy and in a very testy voice asks, "This is your suspect, how would you recognize him?
He quickly adds, "Think hard before giving me a stupid answer."
The third guy looks at the picture intently for a moment and says, "The suspect wears contact lenses."
The policeman is surprised and speechless because he really doesn't know himself if the suspect wears contacts or not.
"Well, that's an interesting answer. Wait here for a few minutes while I check his file and I'll get back to you on that."
He leaves the room and goes to his office, checks the suspect's file on his computer and comes back with a beaming smile on his face.
"Wow! I can't believe it. It's TRUE! The suspect does, in fact, wear contact lenses. Good work! How were you able to make such an astute observation?"
"That's easy..." the third guy replied. "He can't wear regular glasses because he only has one eye and one ear."
7K notes
·
View notes
What flavor of queer are you, if that's not too invasive of a question?
question is just fine with chuck it is kind of interesting story.
on LGBTQIA trot i am TECHNICALLY two letters
easy first one is B that does not need any more explanation. that has always been my trot
second way is what i have learned through talkin with my online buds way of non-dysphoric trans. it has taken chuck LONG time to understand this but it has been fruitful journey i think. long ago chuck would post online about becoming other people or things or concepts or wrestling with my IDENTITY as a buckaroo (whether that meant becoming sweet barbara or becoming my reverse twin or becoming the entire seahawks footballs team, very handsome). in fitting with my entire heckin LIFE some buds probably thought these were jokes when they were not at all. they were just personal artistic bubbles tumbling up and popping in ways i didnt understand yet.
but through posting these thoughts and THEN writing trans tinglers and talking to my trans buds online, i started to realize there are all kinds of versions of a trans identity INCLUDING the ones that rolled around deep inside of me that i never had a name for.
three events helped chuck understand this
first: the trans buds chuck talked to while researching harriet porber said 'well i always knew if i could press a button and change my body to match my gender i would instantly do this' and chuck thought 'of course woudlnt we all do this?' and they said 'well no, do you feel this way?' and i would say 'yes very strongly'. i will FOREVER be grateful to trans community for these conversations and maybe it is another reason why being anti-gatekeeping is so important to chuck.
second: thought about all the games i have ever played like a dang videogame or a role playing game, chuck would ALWAYS choose ladybuck character. didnt really think this was a unique thing at time but it is a pattern across whole life
third: chuck was trotting around with some buds and they all said 'whose bod would you choose if you could transform into any body?' (this is common topic for chuck believe it or not.) and the buckaroo guys went around naming the usual brats pitt or handsome channing and it got to chuck and i said 'obviously brie larson' and then the dang guys just kind of stared at chuck and then i realized 'oh, i didnt even think my answer was unusual but i guess they were only talkin guy bods'
these three things happened pretty close to one another but they were all bubbling up for decades and expressed in various ways even chuck did not entirely understand
anyway. chucks way is NOT that i feel uncomfortable in my body and it does not bring me grief. i am not upset about it honestly. i do not even THINK about it most days. however, it is all TRUE and in a purely technical and utilitarian sense of A PLUS B then YES, male would not be my preferred gender.
didnt talk on this for a while because there are MANY dysphoric trans buckaroos who go through a lot of hardships and i have gone through ABSOLUTELY NONE IN THIS WAY. it has not made my life more difficult and it does not haunt me, so i do not want to have my voice drown out other trans buds who need space to shout. i am very privileged so even though technically this applies to chuck i do not need or want any bonus points.
that beings said, part of my journey on the autistic spectrum was to recognize that EVEN THOUGH my personal story is not tragic, it is still an important one to get out there onto this timeline. IN FACT there should be more stories of buckaroos who love being autistic like chuck. i am PROUD of my trot and i love my autism (this is also why i wanted to explicitly say my lead character in camp damascus is autistic)
so in the same way, when directly asked, i will say: i am technically non-dysphoric trans ALSO this has not weighed on my life at all. my story is not tragic it is full of joy and excitement. i will not shy away from this because there are all kinds of buckaroos on this spectrum.
anyway that is my VERY LONG TROT hope you enjoyed getting to know chuck a little more thank you for this question buckaroo
14K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Sin Summer (Ghost)
Rating: E (MDNI)
Words: 3.8k
Tags: Ghost x f!reader, tinder au, oral (f!receiving), piv sex, fingering, dirty talk, meet and fuck, pwp, reader sleeps around and no one blames them
Summary: You finally meet up with your faceless tinder guy and he quickly takes the number 1 spot on your hookup list.
a/n: When I say nothing is abandoned I mean NOTHING.
Part 1, Part 3
You're a little nervous when Saturday rolls around, but not any more nervous than you usually are. You're meeting in a public place, and if things break bad you can always scream. Hell if things break good Ghost promised to have you screaming. So one way or the other you get to be loud.
You don't even know who you're looking for, standing outside the bar and waiting for someone to... grab you? Usually you have a photo and can look around but Ghost was insistent that wasn't going to happen. You stare at your phone, at the open tinder dm and the promise from Ghost that he'd find you. He better not be a catfish or you're going to have to do some serious soul searching on your ability to be fooled on this app.
A large firm hand touches your shoulder and you quiet your startle response to something more reasonable for someone camped outside a bar.
"Easy love," his voice is so deep and rough, you pray this is Ghost, because you have to hear this voice dirty talk you. You have to look up to meet his eye. Which is just about the only thing you can meet since he's wearing a mask. You recognize the bottom of it, sort of, from one of his pictures. If nothing else the skeletal jaw print sort of lends itself to a name like Ghost.
"Ghost?" You ask hesitantly, if it's not him you'll sound like an idiot but the way his brows raise at your question give the same answer his voice does.
"The one and only."
"Faceless in person too, huh?" You really don't know what to say, never know what to say at the initial meeting. You both know what you're here for, but it's not like you can really say it.
"Try to be. Still got a mouth under here though, don't you worry." You feel the heat bloom over your cheeks at the same time you notice his eyes crease at the corners. You think he might be teasing you.
"You pull it up to drink I guess," you fish for something to say. Ghost shakes his head.
"Only comes off for one thing tonight sweetheart, and it's not drinking." His voice, God his voice, you think he could read the ingredients on a shampoo bottle and you'd get off on it. Your stomach clenches, eyes darting to his army fatigues. You really hope those are just for fashion.
"What the fuck are we at a bar for then?" You ask a little breathless. Ghost stares up at the bar sign.
"Gotta at least pretend I'm a gentleman," he tells you, "you said we were near your hotel, yeah?"
You grab his hand and very nearly drag him back to your hotel. Fuck it. If he is army you're not getting fucked in a barrack when you've got a perfectly good mattress at the hotel. You're sure he'd appreciate a shower with just the two of you in it as well. If he even wants to spend the night... do you want him to spend the night? If it means morning sex then absolutely.
It turns out Ghost's mask goes up for more than one thing, though you're given very strict instructions to keep your eyes closed for at least half of them.
Eyes closed when he kisses you. His hands are so big, rough with scars and callouses when they cup your face and tip your head back. You think you feel scars on his lips too, the softness of them cut with a raised lines of something, but you can't bother paying too much attention to them. His kissing leads you to believe some very promising things about his head. Lips sliding against yours firm and hungry before you try to get a breath in and he doesn't let you, deepening the kiss with an insistent tongue that makes your head spin from more than just lack of oxygen.
You love a confidant man. A man who kisses you like you're all that he wants, that he needs. You both know you're more than willing, but he still kisses you like you need convincing. His tongue slides against yours, licks into your mouth; he groans when you suck on the wet muscle. Ghost makes a quiet noise into the kiss, soft and a little desperate. You don't know if you'd considered how much he might want you when you'd started this.
"Ghost," you sigh when his lips leave yours and attach themselves to your neck. He hesitates, like it's the first time he's heard his name said like that, before diving in to bite you, hard. You tip your head back further with a gasp, the ache of his teeth against your skin makes you squirm, makes heat pool between your legs. You shiver as his tongue rolls over the bruise, his hands tugging at the bottom of your tee. You're careful to keep your eyes closed when he lifts it over your head. "Pants too," you hum.
"Don't gotta remind me," he tells you, fingers already skimming your belt. He barely gets it undone before he pushes his hand into your pants. His tongue clicks admonishingly, fingers skimming your wet panties. You do your best not to follow the firm strokes. "You're really desperate for me, aren't you?" His low tone hits you right where his fingers do. You're glad you're looking at the ceiling and not him, the way he makes your skin heat.
"You're my type," you tell him honestly, hips following the rub of his fingers. Screw it, if he's going to tease you, you're going to enjoy it.
"You should get better taste." You wish you could argue with that, but considering who you brought home he's probably right. You settle on humming, not willing to make a solid noise of agreement or disagreement when he's got his hand down your pants.
You close your eyes when he moves, when he hauls you up to position on the bed. His hand covers your eyes, warm and calloused, and big. It's firm, steadfast, you're almost enjoying the makeshift blindfold situation. Ghost's lips latch onto one of your nipples, sucking and rolling his tongue over the hardening bud. The heat of his mouth makes you squirm, the bite of his teeth just at the edge of too hard. He sucks and laves his tongue over you like he can't get enough of the feeling. You let a whine slip free and he moves his attention to the other one.
His fingers rub you through your underwear, working you up to soaking with practiced precision. Three firm fingers dragging up and down your slit, stopping to circle your clit with each stroke. It's warm pressure that makes your hips cant, chasing the movement. He's teasing you, keeping you just at the edge of eager while he enjoys himself with your breasts. You squirm a little and his touch slides further up to occupy itself with the waistband of your panties. You pull your legs up to help him get them off.
Ghost seems to switch gears as soon as they're gone. His hand leaving your eyes to grip under your knees, settling your legs on either side of him and pushing them up towards your chest. He trails his mouth down your stomach, nipping and licking at the soft skin, leaving his mark against your hip before he slips between your legs.
Keeping your eyes closed makes it hard not to flinch when his tongue drags over your slit. Broad strokes as he tastes you, his fingers spread you open so he can wiggle it between your folds and you press your hips into his touch. The hot drag of his tongue as it circles your hole makes you squirm, which makes him chuckle, deep and dark.
"You want me to hold you down?" He offers, the sound of his voice making heat rush over your skin. You shake your head and feel his broad shoulders shrug, you slide your legs over them and squeeze your thighs around his head. You feel him turn and bury his teeth in the soft flesh of your thigh.
It distracts him, you think, when he releases his teeth he runs his tongue along your skin, kissing and sucking at your thigh. His lips are appreciative, even when you squeeze him again. He's teasing you, he's so close to where you want him, working you up without ever touching your pussy. Your stomach jumps, warmth from his breath ghosting against your wet cunt. "I know baby," He groans, "gorgeous-" He cuts himself off, his lips pressing against your leg again before they leave you.
You almost open your eyes again when he fastens his mouth over your clit. You're so on edge waiting for him to touch you that you curl into his mouth, your fingers gripping his short cropped hair. His tongue rolls over your clit sending shocks up your spine. Your stomach jumps and you gasp as he sucks at your cunt, tugging at your clit and kissing your slit. He stirs heat in the pit of your stomach with each stroke of his tongue. Ghost's mouth is like a furnace, one that seems desperate to avoid parting from you. You hardly get a break from his insistent tongue, the sucking kisses, and the groans of deep satisfaction.
Ghost doesn't stop for a second, and the constant attention winds itself tight in the pit of your stomach. You whine, tug at his hair to pull his mouth closer, to keep that delicious suction that makes you want to writhe. He hums around your clit as you feel pressure build quick, before you can even warn him. Your whining grows more insistent as everything goes tight then spasms against his tongue as you come. Ghost doesn't give you a break, tongue stroking your clit as you clench and shake under him.
You jerk your hips when you feel his thick finger circling your hole, and his mouth leaves you. Only long enough to click his tongue and settle a hand on your stomach. He pushes your hips down against the bed, and eases his finger into your still fluttering cunt. "Gotta open you up love, relax." He tells you.
His finger is thick, thicker than some of the guys you've slept with, and you let out a soft noise at the gentle stretch. Ghost hums his encouragement, pumping his finger in and out of your cunt. He kisses your thigh again; you tip your head ever so slightly down and he clicks his tongue again. "Eyes up," He reminds you. You tip your head back, though you ache to get a look at the mouth that so expertly took you apart. The mouth that seems to still be trying to take you apart, because as soon as your head is back he's licking your clit again.
Your too sensitive, you have to force yourself to stay still, though his hand holding you down helps. You can hear the wetness between your legs, from his mouth, from his fingers, from your drooling cunt. Ghost hardly gives you a moment to adjust to the feeling, crooking his finger to stroke against your walls while he sucks. You clench around his finger and feel his tongue lap a broad stroke over your cunt in return. He waits for you to relax again before easing a second finger into you.
The burn of the stretch, just a bit too soon, is perfect. His fingers tug at your hole, sliding slickly in and out of you. It's just enough to make you feel full without filling you. Fuck it's good. Ghost strokes your walls, his fingers easing the stretch with gentle movements. He presses up against your soft spot and you let out a breath. You can hear the smile in his voice when he mumbles,
"There she is."
It's the only warning you get before his fingers are thrusting into you with a purpose. Short, quick, and precise, hitting your sweet spot with every stroke. Your stomach jumps and you clench around his fingers. He sits back, his hand leaving your stomach to hold your legs up, keep you from gaining any leverage as your back arches and you moan. He seems to have a direct line to your pleasure center. Each stroke of his fingers tightens in the pit of your stomach and makes your hips squirm to try and get away from the unrelenting jab of his hand. He's quick and experienced, and your legs shake over his shoulders.
You suppose it should be a relief when he removes his fingers just before you come a second time, and settles your feet on the bed. "Wanna watch you squirm," Ghost's voice is rough, deeper than you've heard it before. His fingers are the same, only this time when you try to get away from them he follows you. You were already on edge but this pushes you over. You buck and squirm, forcing him to fuck his fingers into you harder and faster until you shake apart with a shout and a flood of wetness. It coats your thighs, you know it coats his hand. It makes him groan. It doesn't make him stop. "Again," He tells you, his fingers still working you up quick. You don't have time to recover, your legs only pull up against your chest, desperate to curl in on yourself as the pleasure turns to pain and then pleasure again.
You come with your head thrown back and your fingers gripping the sheets. You shudder as it rips through you without warning, and once again coats Ghost's hand. He draws his fingers from you, and you hear him suck them clean. Somehow the sound makes you shiver.
Catching your breath takes priority over trying to sneak another peak at your partner for the night. You're sticky with sweat, three orgasms in, and you haven't even been fucked yet. You're buzzing just at the edge of enough. A good dick would make your night. To your side you hear the rustle of fabric being discarded. Ghost getting undressed you assume.
"Can look if you want," Ghost's voice is ever so slightly muffled, and when you do tip your head to find him he has his mask on again. You must look confused, because he shakes his head with a chuckle, and glances down to unclasp his belt. "Wanna look you in the eye," He explains, "Hard to do that with your eyes closed."
It's hard to look him in the eye anyway when he looks like that. Your eyes scour over the swell of well maintained muscle and the soft layer of fat that covers it. There are scars too, a whole host of them. They cover every inch of him, slashed over his chest, stabbed in his side, bullet holes in his shoulder and thick biceps. If you had any doubt this man saw combat it was gone now. He must be military, maybe special forces, it explains the mask.
Ghost pushes his pants down and you... well you need to rethink some things.
In your experience men who are criminally good at giving head are making up for something. Men who know how to "open you up" even more so. You swallow looking at the cock hanging between his legs, so long and heavy that it didn't spring up when he shucked his boxers. His fingers wrap around it, giving it a few good strokes with your slick as lube, and you watch the motion hungrily. He's not compensating for anything, he's just a great lay.
"How do you want me," You ask, eyes focused on the movement of his cock as he bends to grab a box from his discarded pants. He hums, tugging a length of condoms out and ripping one off.
"I'll move ya," He responds, rolling the rubber over his dick. A little shiver rushes down your spine, you like a man who knows what he's doing.
Ghost does, in fact, move you. He grabs your hips and drags you to the edge of the bed, the movement so quick and self assured it makes you giggle. His eyes crease at the edges, he's smiling you think, and he keeps smiling as he settles a knee on the bed next to you. You're quick to wrap your legs around his hips, and he's just as quick to pull them off and settle them over his arms. His big hands knead at your thighs, the extra leverage lining you up perfectly with his cock. Despite the angle, you're not using any muscles to hold yourself up, that's kind of him. Less kind when he positions himself at your entrance and tells you,
"Need you to be a good girl and take it," You gasp as he pushes into you, splitting you open more than his fingers could ever hope to, "Think you can do that?" You nod quickly, warmth dripping like honey to pool in the pit of your stomach. He didn't stretch you enough, but you think that might be the point. The ache of his cock stretching you open lets you feel every fat inch of it, every vein that drags against your walls, eased by the slick of your orgasms. Your eyes roll a little when he stops and pulls out a little. You whine, clenching to try and keep him inside, to keep that delicious stretch. Ghost groans, swears under his breath and shakes his head.
You should have anticipated him thrusting the last few inches inside. The hard thrust slapping his hips against yours forces a moan out of you. You arch in his hold, shivery, and glance between your legs as he gives you just a moment to adjust. The thick curls around his cock brush against your overworked clit and you do your best not to squirm. Not that you have much opportunity to squirm when Ghost fucks his weight down onto you. Each deep thrust hitting something achingly good inside you that makes you moan and claw at the arms holding you.
Your brows draw together looking at Ghost, he holds your gaze, his eyes piercing, dark and hungry. He's almost daring you to look away as he pounds into you. You're pinned under him, your legs forced back as he leans over you and treats you to a fountain of praise: "squeezin' me so good," "takin' it so well," "pretty little whore," "made for my cock." Your eyes roll back, the hot punch of his cock against your cervix almost too much for you. He told you to take it, you can be good for him, let him use you after he got you off so many times. That doesn't stop your legs from shaking or your voice from screaming.
There's something covetous in his eyes, something animalistic in the way he fucks you. This round is just for him, and you can take it. You tip your head back, trying to arch your back. Ghost releases his hold on your thighs and grabs you by the back of the neck, folding you back onto his cock. "No, no, sweetheart," He rumbles, leaning to press his forehead against yours, "told you, you gotta take it. Show me how a proper slag gets fucked."
Somehow this angle makes his thrusts more precise, and you truly cannot move to try and escape. You can hardly breathe, his cock fucking all the air out of your lungs. His pace just keeps getting faster, and you can see the way sweat sticks to his brow. You dig your fingers into his biceps, his thighs, anywhere you can try to get a grip as everything starts to hurt too good. You let out a squeak as the heat compounding in your stomach drips out of you. A slow trickle of orgasm that breaks into a flood on the next stroke of his cock.
It's worth it the way he growls when you clench and flutter around his cock. Ghost's thrusts becoming sharp and uncoordinated as he groans out his own orgasm. He rocks his cock into you more gently, letting your greedy pussy milk him before he lets you go to pull out. You feel like a rag doll, the way you drop and splay on the bed to shiver.
You turn over onto your stomach in an attempt not to slide off the bed as you get your bearings. Ghost is quick to scoop you up and deposit you against the pillows, the condom tied off and tossed towards the trash. You're once again moved, positioned how he likes so Ghost can pull you against his chest. You sling a leg over him and cuddle close. He smells like sweat, musky in a way that makes you want to drag your tongue along his collar.
"Twenty minutes," He tells you roughly, "I'll talk about anything but work." You hum, occupied with dragging your fingers over his squishy pecs. He flexes a little and you tip your head to look up at him.
"What?"
"We still got a dozen condoms, no sense takin' 'em home." He raises a brow. You think you're getting better at reading him, you think he's smiling. The offer is light, but sincere.
"Long as I can walk in the morning," You smile. He tips his head, like he's thinking about it.
"We'll see."
When you wake up in the morning it's to a pounding at the door. You grumble and sit up to check the time. You're alone in bed, but the shower is running. Good, he hasn't left yet. Around round six you decided you were getting Ghost's number in the morning, maybe asking him out to breakfast, perhaps even dinner. The clock says six but your brain says it's ass o'clock and whoever is banging on the door needs to gtfo.
You drag yourself out of bed and swipe Ghost's tee from the floor. A souvenir, and a nasty habit you've picked up. You root around for a pair of panties and manage to tug them on as the shower shuts off. You're making your way for the door when Ghost pops out of the bathroom with a towel around his waist. You don't have time to admire the way drops of water trace over his back, or the way his hair sticks up at odd angles. He opens the door and leans against the jam.
"Dinnae dae that," Another low voice fills the room, there's something familiar about the accent, "Ya ask for a wakeup call, ya dinnae get ta glare at me."
"You're early," Ghost grumbles.
"Aye, was just so eager to see yer face LT." You pad behind Ghost and peak around his shoulder at the man in fatigues and an army green tee. You could recognize those eyes even if you didn't still feel his smile like an arrow through the heart. Icy blue in a way that makes you think he's from a different planet. Though you know it from your time in Glasgow.
"John?"
2K notes
·
View notes
High Rise ft. IVE Wonyoung
Pairing: IVE Wonyoung x Male Reader
Rating: Explicit
Word Count: 2.4k
Tags: Daddy kink, Exhibitionism, Choking
A/N: i said i would didn't i? probably the fastest i've made a fic recently which also means please excuse any grammar or spelling mistakes you find. might not be my best work but it sure was fun to write o7
Disclaimer: this is a work of fiction/parody
Dating a k-pop idol wasn’t easy. Especially when you were a so-called commoner. There were the obvious reasons, like you had to keep your relationship a secret until they reached their thirties, if you made it that long.And the not-so-obvious reasons; like watching your girlfriend parade around in sexy stage outfits and having to contain your desire to fuck her in them.
Or maybe that was just you.
When your girlfriend was Jang Wonyoung, a hyper-popular It girl – you cringed at even thinking those words aloud – the restrictions were even worse. Like that one time you had wanted to bring her flowers at her group's concert in Seoul and had to be snuck backstage with a bag over your head. Or the time someone had caught the two of you flirting candidly and Wonyoung blurted out that you were her cousin to save face. Embarrassing but somehow also cute when it came from her.
All this was to say it wasn’t easy.
But it certainly wasn’t without its benefits.
“Fuck, that one looks so good, princess,” you praised.
You snapped another photo as Wonyoung posed, biting her bottom lips and giving the camera a smoldering look. She hooked her fingers into her hip-hugging jeans, tugging them slightly as you quickly snapped another series of photos.
Honestly, you were somewhat shocked when Wonyoung told you her idea. It had felt provocative, mature even, and thus far each photo had proved that assumption right. But you rarely, if ever said no to her, even if her motivations were somewhat questionable. In fact, you wondered if this was all your fault.
“You left a like on Yuna-nim’s photo,” Wonyoung had said at the time. Her tone carried an accusatory hint.
“Did I?” you had stammered, trying to play naive. “I was just scrolling my feed and must’ve double tapped.”
“So you follow them?”
“Them?”
“Other girl groups,” Wonyoung clarified.
One thing you had learned about the IVE princess was that while she was sweet as a button on most days, she carried a jealous streak that verged on volatile. Sharing was not in her programming, least of all when it came to you.
You had recognized the trap forming but it had been too late. “Well, I mean, just to keep up. You know you do challenges sometimes and appear on their feeds.”
Her arms crossed over her chest, hip cocked to the side and slight pout was all the answer you needed.
That week you had gone without any physical contact from your girlfriend. Though she made sure to send you the filthiest selfies possible throughout. Which, oddly, worked. Because no matter how much you touched yourself to the photos she sent, it didn’t compare to the real thing.
It had seemed like the incident was over and in the past but as you snapped a few more photos of Wonyoung by the windowsill, you briefly wondered if this stemmed from it as well.
“Are you sure you’re going to post these on Instagram?” you asked, after a particularly racy photo.
“Mhm,” Wonyoung nodded. “It’s nothing I haven’t done before. Remember the bathroom?”
“Oh, I remember.”
You also remembered the ones that hadn’t made it to social media and were sent directly to you. But this still felt even more daring than this.
“How many likes do you think this will get?” she asked, coolly, giving the camera a sultry look. An innocent question. At least on the surface. But you remembered her comment one night as you two relaxed together.
“Besides, it’s to promote the sponsor, that’s all. This will get the most engagements,” she added. Her gaze dropped and a small smirk formed on her lips, “In fact, I’d say it’s already working.”
You followed her gaze, looking down to see a rather obvious tent had formed in your sweatpants. You laughed, a flush coloring your cheeks. “Well, shit. Can you blame me?”
“I guess I can’t,” Wonyoung said coolly.
The way she unbuttoned the top button of her jeans, spoke to more mischief however.
“Wony,” you wet your dry lips, “Are we still doing the shoot?”
“Mhm “ she nodded cutely, “Of course.”
She did another pose, pushing the waist of the jeans down to expose the lace underwear she had on underneath.
“You know, I love it up here. It’s perfect,” Wonyoung said. “Don’t you agree?”
“Yeah…” you muttered, more focused on the sight of her exposed abs and smooth skin than her question.
By here she was referring to the penthouse you were using for the photoshoot. Funny enough, she could easily afford a place like this on her own. Though that would only spur on more talk about inequality among the rookie group.
“Being so high up…” she turned her head to look out the window. Your breath caught as you watched delicate fingers slip inside of her jeans. “We can see everything but no one can see us. Even if we were naked against this window they’d never know…”
Now you weren’t the smartest bulb in the room. In fact, sometimes you wondered if it was your self-proclaimed himbo status that Wonyoung liked most about you. But even you could put two and two together. And Wonyoung’s words combined with the side-eyed glance she was giving you were all screaming one thing.
“I could show my naked body to all of Seoul and no one. would. know.”
Her tongue pronounced every syllable while she locked eyes with you. As sweet and kind as Wonyoung could be she had an undeniable minx side to her. You were also fairly certain your girlfriend got off on the power high of being such a desired person but you had never actually confirmed that.
If you were starting to get hard when she pointed it out earlier, you were practically aching now. You tossed your phone onto the couch and made your way over to where Wonyoung was by the window. She let out a delighted squeal as you pushed her up against the glass, kissing her passionately.
Your hands moved against her stomach, feeling her toned abs that were shown off by the outfit she was wearing. Honestly, you should send a bouquet to whatever designer sent this to her to promote. You nipped at Wonyoung's bottom lip, your hands sliding into her unbuttoned pants to squeeze her ass.
"It took you long enough," Wonyoung gasped, mischief gleaming in her eyes. "I thought was going to have to beg you to fuck me."
Your cock twitched, straining painfully against your jeans, "You still could you know."
She must have been in a good mood because the idol looked at you with large eyes, biting on her bottom lip. "Please fuck me against the window, daddy."
Oh.
You see, it had taken some time but you learned that your girlfriend had two modes. The arrogant queen who knew all of Seoul was her playground and made you worship at her feet. Then there was the submissive princess who begged to be pleased until she was satisfied. Often her mood was some mixture of the two but neither one left you unsatisfied.
"If that's what the Princess wants," you growled.
A delighted smile crossed the idol's features followed by another joyful squeal when you spun her around to face the window. Her hands rose, catching herself as she turned her head to look over her shoulder. You could see the aroused flush creeping up her neck and coloring her round cheeks.
"Didn't you say something about showing everyone your tits?" you whispered in her ear.
Not waiting for a response, you pulled her top down, exposing her tits to the cool glass of the window earning a gasp from Wonyoung in response. You pressed further against her, the bulge in your pants pushing against her ass.
"This whole shoot was just to rile me up, wasn't it?" you said, your breath hot against the shell of her ear. Your hands moved quickly to yank the jean pants she was wearing, exposing the white lace panties that she had teased you with a peek of earlier.
"Maybe," Wonyoung mewled, arching her back perfectly.
Your hands hooked into the waistband of her panties, sliding them down to reveal her bare ass to your hungry gaze, "Bullshit. You knew what you were doing."
"Maybe I just wanted to remind you of what's right in front of you," she said.
There it was. That switch up she was capable of. It also confirmed your theory that your girlfriend hadn't exactly forgiven and forgotten about the Instagram incident. Well, there was no time better than now to put the matter to bed. You gripped your cock, slipping it between her legs to get it slick from her dripping sex.
"Oh, I'm well aware of what's in front of me," you started. Slowly you began to slip your thick cock inside of her, inch by inch with each syllable. "The most beautiful." More. "Talented." More. "Gorgeous." More. "Perfect." More. "Princess."
"Fuck!" Wonyoung moaned, her forehead bracing against the window.
"Is the princess feeling full?"
"So, so full…" she cooed.
"And I didn't even get to mention how good a girlfriend you are," you teased.
You could feel her pussy quivering around your length, stretching to accommodate the familiar intrusion of your cock. Wonyoung's hands were splayed against the windows of the high-rise, her ass pushed out and into you. She was on full display and only you were lucky enough to see it.
You could take it slow with steady, languid strokes, gently fucking your girlfriend against the window. But something told you that wasn't what she nor you wanted at that moment. Your fingers flexed around her waist, pulling out your cock until just the tip remained inside of her before thrusting your entire length back inside of her. Wonyoung's body jolted with pleasure as she braced her nude body against the window.
"This is what you wanted isn't it?" Harder. "To know how much you turn me on." Faster. "To see how fucking hard you get me." Deeper. "No one else makes me like this." Repeat.
A mixture of mewls and moans fell from the idol's mouth at your relentless rhythm. Her head fell forward, her cheek pressed up against the glass. Perspiration was starting to form across her flawless skin and you had to resist the urge to lean forward and lick it up. You wanted to prove a point, to fuck Wonyoung to the point of exhaustion for the whole city to see. After that maybe you'd enjoy the little perversions.
"You probably say that to every - fuck - every girl," Wonyoung panted, glancing at you from over her shoulder. "You're probably just waiting to move onto the next idol you're drooling over."
She didn't say it with enough conviction for you to believe she truly felt that way. For starters, while Wonyoung may get jealous, she was not insecure. At least, not enough to ever think another idol was above her. It was more often a toxic possessive kind of jealousy. But nonetheless, in the heat of the moment you'd take the bait.
"Is that what you think?" he said, your breathing growing heavy with your harsh thrust. Conversation wasn't exactly easy at this pace. "Did you miss what I said earlier, huh?"
One hand moved from her waist to slip around Wonyoung's throat. She inhaled sharply, her breath catching in her throat as you squeezed. For a passing second there was no sound save for the repeated slaps of skin against skin as your hips were flush against Wonyoung's ass each time you entered her.
"I only want you," you finally gasp. "Always you."
Rather than another vulgar display to go along with your words, you merely lean over her, capturing her lips in a sideways kiss. It's messy and imperfect but it's also loving and passionate. Your tongues dance together all while your bodies remain intertwined. You can feel Wonyoung pussy quivering around your cock intensely as she moans into your mouth. When you pull back, you look at your girlfriend with a raised eyebrow.
"Did you just cum from that?" you asked.
"S-shut up," Wonyoung retorted. You noticed a bright red hue of embarrassment coloring her cheeks before she hid her face, "Don't stop until you finish inside of me,"
It was always adorable when she continued trying to be dominant after her own orgasm. However, her words had an undeniable effect on you. "If that's what the princess wants."
You returned to the task at hand, focusing your efforts solely on chasing your first release and Wonyoung's second orgasm.
"Daddy," Wonyoung mewled, finding her voice. "I want you to cum, daddy. I want you to cum deep inside my tight pussy.""
You had a sinking suspicion that her words were payback for causing her embarrassing moments earlier. Her attempt at provoking you to blow your load sooner than you had intended to.
Regardless it worked to immediate effect. Your hips jerked, slamming against hers from behind. Your sweat-drenched body pressed flush against Wonyoung, pushing her up against the high-rise window. Your cock twitched, ropes of your sticky seed shooting inside of her womb as her walls convulsed around your length.
Of course the two things that pushed her over the edge would be you saying how you loved her and her revelling the power she had to make you cum on the spot. Truly a representative of her duality.
After a moment had passed and you began to regain your bearings you pressed a kiss to Wonyoung's shoulder.
"That was incredible, Wony," you muttered.
"I know," she said, her form practically radiating. "You weren't bad either."
You let out a chuckle, placing another lazy kiss to her skin, "Maybe we should've included that in the photoshoot."
Wonyoung smiled but didn't immediately respond. After a moment of delay she turned in your arms to look at you.
"Did you mean all those things you said?" she asked.
Her wide eyes looked at you and you reached up to brush aside a strand of sweat soaked hair. There was no hesitation in your response when you answered her.
"Absolutely. And don't you think otherwise for a second."
A smile beamed across the idol's face and she leaned forward, burying her face into your neck. Your arms wrapped around her and quietly you wondered if you weren't the luckiest man in the world.
BUY ME A COFFEE - if you enjoy my stories considering buying me a coffee! always appreciated, never required.
1K notes
·
View notes
WHEN YOU KNOW, YOU KNOW — Toji Fushiguro
dad!toji x mom!reader
summary : celebrating baby megumi's first birthday as toji remembers the day he fell in love with you.
content warning: fluff, fluff, fluff! toji being a big softy for reader, megumi being a cute baby, mentions of foster care, reader knowing her worth.
word count: 2.3k
notes: I saw this video of a mom celebrating her daughter's first birthday like this and it made my heart absolutely melt. also, my obsession with toji is growing, especially soft dad toji like UGH GIVE HIM TO ME. i also think about the fact that he did change and the reason being a woman who showed what life could be like. my true roman empire fr. but to add a little more to the context of this fic, i chose the title because firstly the song, 'margaret' by lana del rey is about finding your person and the feeling of finding them. so i sggest listening to the sone while reading! anyways, enjoy!!!
It was currently 6 a.m. and both your husband and baby were fast asleep still. You on the other hand were wide awake putting together a special surprise for your baby, Megumi, who was turning one.
You felt yourself get emotional as you get flashbacks of when he was just a tiny little thing. He still is your tiny little baby but he’s growing so fast it makes you wanna cry.
As you’re tying the ballon’s up to his crib, you hear him stir in his sleep. Your heart jumps for a second but then see his little eyes flutter open. Your gaze softens even more and a smile spreads across your face, “Good morning, baby,” You coo at him sweetly, and he smiles immediately recognizing his momma. His hands reach up wanting you to hold him and of course you could not say no to him.
You lift him up in your arms and hold him close to your chest. You press a kiss against his cheek, closing your eyes and swaying back and forth with him in your arms.
Toji groans as he feels himself wake up from his deep slumber. He rolls around in bed and reaches for something that isn’t there. His eyes quickly shoot open and he sees that you’re not in bed. *Did the baby start crying?* No because he would’ve heard it.
He then gets up leaving his room and making his way towards the babies room. He noticed the door is already open and when he peaks inside he sees you holding your baby swaying back and forth with him in your arms. His eyes then scan the room and notices the balloons above the crib along with the birthday decorations.
It was Megumi’s first birthday, of course. His eyes go back to you and Megumi and his heart accelerates. The sight was beautiful, he wanted to cherish it and keep it locked up in his head forever. God, you were so beautiful and you absolutely glowed with Megumi in your arms. He never knew how love could feel so amazing and how easily it stared him in the face when it came to you.
It was never easy for Toji to love especially since he’d never felt real true love for anyone. Not his mom and certainly not his dad, he was alone for as long as he could remember.
Of course he didn’t care, he could have any woman he wanted in a matter of seconds. No women could change him and he was fully convinced of that.
But boy was he wrong when he met you, everything changed. When you met you didn’t immediately flirt with him. You just saw him as a regular guy walking into your diner because that’s what he was. You treated him normally, not throwing yourself on him like other women. It was refreshing to say the least.
But he knew why, he could tell by the way you carried yourself that you knew you deserved something special. So when he first asked you out, you immediately turned him down without explanation. At first he was a bit offended but he brushed it off telling himself he liked a challenge.
He continued to ask you out after and still was met with the same answer. He did this for 4 months until he finally sat down at the diner and asked you, “Why won’t you go out with me?” You stare at him wide-eyed as you place a cup of coffee in front of him, “Well, you’ve never actually tried having a conversation with me, nor have you tried getting to know me, you like me because I’m pretty not for who I am,” She says cleaning up the area around him then leaving him there to think about what she said.
As she comes around to serve some costumer their food he stops her, “But I want to get to know you, that’s all I’ve been wanting these past couple of months,” Your face is blank, a bit irritated that he’d step in front of you like that, “Then prove it, actions speak louder than words,” You step around him continuing to do your job.
He let your words marinate for a second before he paid for his coffee and left.
It was now the end of your shift and all you wanted to do was go to bed. You sigh as you open the back door to leave, “Hey,” You jump at the sudden noise, feeling your soul leave your body. You look over at the noise, feeling a wave of relief that it wasn’t some freak, “Toji, you scared me!”
He was leaned up against the diner’s wall. He scratched the back of his neck sheepishly, “My bad,” You shake your head before taking a deep breath, “What are you doing here anyway? The diners closed,” He shrugged leaving the wall and beginning to walk over to you, “I wanted to talk,” You raise your eyebrow in confusion, “To who?”
“To you,” He has a light smile on his face which causes you to smile, “About?” He laughs as he puts his hands in the pockets on his jeans, “I want to get to know you,” You narrowed your eyes at him, “How long have you been waiting out here for me?” Your question makes him tongue tied and red with embarrassment, “I-…since I left the diner,” He mumbles, but you heard it clear.
“That was 6 hours ago…you’ve been waiting here this whole time?” He nods looking away from you, already feeling so much embarrassment, “I didn’t know when you got off, so…I waited,” You didn’t understand why but you felt your heart flutter a bit, but you quickly shook it off. He noticed you think for a bit but quickly spoke up again, “Can I walk you home?”
Your snapped out of you thought, staring up at him blankly, “Sure, why not,” you didn’t feel threatened by him at all, you felt more safe around him then anything. One thing about Toji is that the many times he’s asked you out he’s never made you uncomfortable. He’s never made weird comments about you, he was cocky when you first met him which was off putting.
But after you shot him down the way you did he wasn’t so cocky after, “Would you like me to carry your bag?” He asks, noticing how tired you look, wanting to lift a weight of your shoulder, literally, “Oh, sure,” You handed him your bag then stretched your arms over your head and yawned, “I’m tired,” You say as you begin to walk, Toji hums before he asks, “How long have you been working there?”
“Mmm since I graduated high school,” Toji’s eyes widen a bit, you’d been working there for years and he’d never seen you, “Seriously? How come I only met you 4 months ago?” Toji had been going to that diner for a while now, ever since he graduated high school, “Well I recently graduated university, like 6 months ago but it’s been hard to look for a job so I asked to start working full time.”
Toji did take you for an educated woman, as whenever you were disrespected at the diner you never took it, always standing up for yourself, “Wow, what did you study in university?”
“Social work, I want to be a social worker for foster kids,” Toji felt his heart jump out of his chest, Toji was a foster kid. After he’d left the Zenin clan, he got into trouble shop lifting which let him to get put into the system. Which he was salty and angry about at first, it was as if he was just going back to where he was in the first place.
But to his surprise he was assigned a nice family and a great social worker who looked out for him, “Really? You know I was a foster kid,” his words make your ears quirk up turning your head towards him, “seriously? Was the system good to you?” The hope in your eyes is telling, he could see that you wanted to change things that went on it the system that were awful, “Fortunately yes, it was,” I smile spread across your face that made him melt instantly, “That’s great, I’m glad.”
The rest of the walk he learned more things about you, your favorite things, what you enjoyed doing on your free time, everything he could. You were right, getting to know somebody is so much more important than whatever they’d look like. Of course you were beautiful, no doubt about it but it was just a bonus to the beautiful personality you carried within you.
You soon arrived to your apartment complex. Toji scanned the area, it wasn’t the safest part of town but he knew it was affordable, so he couldn’t judge. “So, where do you see yourself in the future? You said you’re 22 right?” You nod as you both stop in front of the complex and sit on a nearby bench, “Well, I’ve always wanted a family, small or big. An amazing husband with a baby in a small house in the suburbs or by the beach, just living happily and peacefully.”
He noticed the way your eyes sparkled when you spoke. When you continued to describe what you wanted he couldn’t help but picture it. You, him, and a baby. His heart pounded in his chest at the image, when you stopped talking you looked into his eyes as he did you. That’s when he knew, he wanted to be everything you needed. He wanted to be the man for you.
So watching the sight of you and Megumi swaying back and forth, happily as ever is a sight for sore eyes. He felt emotional, never thinking he’d get to this point in life, this happy. Even though he was partially raised well he still had his flaws but you saw those flaws and mere things willing to stay and work on them with him.
You were his angel, his peace, and his everything. He finally decided to fully enter the room, placing a hand on the small of your back making you jump slightly, “Oh my gosh, Toji! You scared me!” He lightly chuckled before placing a kiss on your lips, “You weren’t in bed so I came up to see what was up,” You hum rubbing circles on Megumi’s back.
“I was going to wake you but you seemed exhausted last night,” He looks at Megumi, placing a hand on his head and giving him a kiss on his forehead, “Thank you, honey but I’m okay. Besides, it’s our little guys birthday, I could never miss that,” boy did this man have you wrapped around his finger, you fell in love with him over and over again every single day.
“Well since you’re here, can you grab the cake and candles that are in the kitchen so we can sing him happy birthday,” He nods giving you another kiss, “Anything for you,” You giggle as you watch him walk out of the room, you look at Megumi staring up at you, “happy birthday, my sweet boy,” you bring him up pressing your cheek against his.
Toji comes back with a cake and a single candle in his hand. Little Megumi coos at his dad causing Toji to laugh, “patience little guy,” he sits down placing the cake down as well, you follow first placing Megumi down then sitting yourself next to Toji.
Toji places the candle on the cake then lights it. Little Megumi’s eyes widen as he sees the small flame but then giggles and claps. You lay your head on Toji’s shoulder watching the sight that made your heart melt.
You began to sing happy birthday to him and he’d never smiled more, swaying back and forth to the sound of his parents voice. Megumi’s was only one but he felt the love that radiated off of his parents and how much they loved him, “Happy birthday to you, okay baby, now blow out your candles.”
Megumi’s face tilted in confusion, causing you and Toji to chuckle, “Like this,” you said as you blew softly, he copied your movement but no air came out of his lips. Toji laughed, “Okay try again,” he whispered but instead this time Toji blew slightly causing the candle to go out, little Megumi clapped thinking he had done it. You smiled at your happy baby, then at your husband, you lifted your head off of his shoulder giving him a kiss.
“Thank you,” You whispered lovingly, “For what?” He asked confused, “For this, for it all, for giving me the life I’d always dreamed of,” His heart swells at your words causing him to shake his head, “No, thank you, you accepted me knowing I had so many flaws…and you changed me…you’re the reason I am this way. You are my reason, Y/n.”
You look over at Megumi for a second, who moved himself to crawl, “Oh Toji,” You coo, cupping his face and giving him a passionate kiss, “I love you, I love you so much,” He whispered wrapping his arms around your waist and bringing you closer, “I love you, Toji,” You nuzzle your face into his chest holding him close, but in the corner of your eye you see something.
“Toji, look,” you tap his chest and point over to Megumi, who stood up. He always did that but what you didn’t expect was for him to take a couple steps forward. You both gasped, quickly sitting up as you watch your baby make his way to you. You feel your eyes well up with tears and you begin to clap excitedly, “he’s walking!” you cheer excitedly. Little Megumi makes it all the way to his parents. Toji is quickly to scoop him up and kiss him excitedly.
You both celebrate your babies big step in growing up. Which makes you so proud but so emotional, Toji is quick to wipe your tears. He kisses you once more and smiles, down at you then at his son, “My blessings,” He whispers.
h1ghoffu - i do not allow my work to be reposted. please do not plagiarize my work or theme. reblogging and comments are welcome! much love! thank you for reading!
1K notes
·
View notes
truth or dare... don't lie
pairing: xavier thorpe x fem!reader
summary: during a game of truth or dare, a secret about reader is revealed that xavier offers to help her out with.
warnings: SMUT LMAO, unprotected PIV, fingering, oral (F receiving), virgin!reader, kinda soft sex tbh, reader loses her v-card bc i'm projecting, kent, bianca, and yoko are kinda mean in this i'm not gonna lie, theres a bit of angst at first but then it gets really smutty and comforting
a/n: THIS IS NOT EDITED! i AM working on a part two to my series, but i have finals this week and can't focus enough to develop the plot how i planned so you're getting this instead to tide you over... wooo! enjoy horn-dogs :)
"it's your turn, y/n!" bianca started giggling as she took another sip of whatever alcoholic mixture she decided to deliver this time.
somehow you, enid, wednesday, ajax, xavier, bianca, kent, and yoko were playing a skewed version of truth or dare in xaviers single room. basically, it was the same premise of you choose a truth or a dare, but if you didn't complete the task or answer the truth then you had to strip. so... strip truth or dare.
it's not like anyone really cared, it was a week before winter break, and everyone had already finished their exams for the semester. luckily you were even able to have thing sneak into the teachers' lounge and bag some extra goodies, which was mostly only alcohol and little debbie snacks.
"what'll it be, y/l/n?" bianca continued to ask you. "truth or dare... or strip?"
you see, there was one MORE issue at hand...
you were down to your dress.
having already taken off your jacket, socks, and even your necklace, you were desperate to remain in the game with your integrity intact, although you were sure most of them wouldn't remember a thing because they had drank so much. except for wednesday, something about making sure enid got back to the dorm safely... blah blah blah.
well, and xavier, but you weren't sure why he wasn't drinking much on his end. maybe he was simply uncomfortable with it, or wanted to be the designated walk-er, helping everyone to their respective dorms. that's part of why you like him so much. he's so sweet and thoughtful, even when people choose to inebriate themselves beyond belief with alcohol. it wouldn't happen, and you know that. but a little schoolgirl crush never hurt anyone, right?
regardless, you needed something easy, so you remained covered and not embarrassed, "truth."
"boring!" enid rang out, hands cupping around her mouth to symbolize a megaphone.
"she is down to just her dress and whatever is underneath," wednesday pointed out with a nod. you turned to see xavier simply looking down at his phone, more than uninterested in the game.
"fine," you sighed. "i choose dare," you said smugly, noticing xaviers eyebrows raise as he made eye contact with you before you abruptly looked the other direction.
"there we go!" bianca clapped as the others cheered with her. "that's what i'm talking about y/n," she put her finger to her chin as if she were in deep thought with a quiet 'hmmm,' "i dare you to sit in xavier's lap for the rest of the game!"
"really?" your surprise was practically impossible to hide. "i don't think he'd be very comfortable with that, b."
"i'm cool with it if you are, y/n/n," he gave you a smile, one that you didn't recognize. it wasn't his 'i'm proud of you smile' or his 'you fucked up again' smile, no. this was a new one. this one seemed darker. mysterious. enticing.
you liked it.
"i-i'm cool with it," and with that, you got up and walked in his direction.
he had been sitting at his desk the whole time, in his comfy little chair. he pat his lap three times before you rolled your eyes at him and sat down on his lap, facing the same way as him. you tried not to put much weight on him, so you opted to sit on the very edge of his knees and let your tiptoes hold most of your weight.
"okay that can't be comfortable," xavier pointed out. "here," he carefully lifted you just enough to maneuver you over his lap, now sideways with your back against one armrest and your feet dangling over the other. "better?"
"mhmm, thanks," you smiled as you clasped your hands in your lap, one of xavier's arms still wrapped around your waist comfortably. it felt nice, like it belonged there.
from there on the game got a bit more... risqué. now there were kisses dared on cheeks, first time stories being drawn out, and so much more.
"xavier," ajax pointed at him, slurring his words with a big grin decorating his face. "truth or dare!"
"hmm..." he acted deep in thought. "dare."
"i dare you..." he clearly hadn't thought that far in advance, which is when enid leaned over and whispered something you couldn't make out to him. "oh that's good!," ajax whisper yelled, not being able to properly sense his own volume. "i dare you, xavier, to kiss y/n on the neck until your next turn!"
you turned to face him, your lips pressed into a thin line, praying that he couldn't see the rosy red blush that was surely adorning your cheeks by now.
"are you okay with that?" he asked, whispering in your ear so the others couldn't hear. once he got your quiet, but detectable 'mhmm,' he accepted the dare. "alright," with that, he got to work.
he pressed a feather-light kiss to your neck at first, and you thought you would be fine if this is what he would be doing the entire time. that was, until he began to press slightly open-mouthed kisses to your neck, occasionally gently nipping the area before soothing over it with his tongue.
there was no doubt in your mind that he could tell your heartbeat was racing. between feeling his hair brushing on the sensitive skin, and his tongue soothing his love-bites, you were about to explode. your hips were practically moving on their own at this point, trying to get whatever friction you could.
"hey," you felt xavier's hands grab your hips firmly. "if you don't stop moving your hips like that there's gonna be a mess between us that i really don't wanna clean up."
"what do you-" he shifted your hips up a bit more, hitting something a bit harder than his thighs were. "oh-is-is that...?"
"yea," he got closer to your ear, beginning to suck on the lobe and continuing his ministrations.
"in the school bathroom!" bianca rang out, laughing at whatever story kent was telling this time.
"i think it's y/n's turn again," kent diverted everyone's attention to you, so you tried to ignore xavier sucking on your neck like a leech, albeit a really hot one, to get through this.
"oh, and it's my turn," yoko cheered. "truth or dare, y/n?"
you really didn't think you'd be able to survive whatever dare they would throw your way, not in the slightest, which is why you chose: "truth."
"alright," yoko looked towards bianca and kent before asking, "what was your first time like?"
ajax might as well have ripped his beenie off then and there because you froze. you hadn't done it. you haven't gotten past giving a guy a handjob, let alone sex.
you didn't know how long you were quiet for, but you did notice when xavier stopped his kissing. you could practically feel his stare right on your face. you wanted it to go away. you wanted to disappear. it was humiliating, really. at least you thought it was until...
"you haven't, have you?" kent chuckled as bianca stifled a laugh.
"are you serious?" yoko asked incredulously. "well, i guess it makes sense to me," she shrugged as you tore yourself off of xavier's body, having to pry his hand away from your waist.
"hey," he held onto your hand softly and looked at you with what you thought to be puppy-dog eyes, you didn't have the best view due to the tears blocking your eyes.
"just..." you sighed as you took your hand out of his and ran out of his room, dorm, and the building as a whole. you just wanted to walk around, feel comfortable. then it hit you that there was always one place where you felt comfortable.
after around 15 minutes of walking around to clear your head, you got to xavier's paint shed. you had gone there nearly every time you needed help with homework, needed some advice, or if you simply missed him. it's amazing that even though he wasn't there, you could still smell his presence, the mahogany and woods scent that felt like home to you now.
you had made several forts in the place before, having secret sleepovers with each other countless times just because you wanted to. so, you brought out the mattress that was set up against the wall, put the fitted sheet on it and set up the bed as usual before plopping down on it.
you didn't even want to cry anymore. you just wanted to disappear. you felt like such a loser. i mean, why is that such a big deal anyway? it's just sex. but then again, if it's 'just sex' then why haven't you just done it?
"y/n/n?" xaviers voice called out as he knocked on the door of the shed. "look, i know you're in there. just wanted you to know that i kicked everyone out, okay?" you stayed quiet. "y/n," he sighed. "you know that just because you haven't... yknow, doesn't mean anything right? what yoko was saying... she doesn't make sense. because anyone would be so lucky to have you. you're unbelievably kind, and generous, witty, hilarious... and beautiful. you're beautiful, y/n. please just let me in? i wanna talk to your face, not some door."
you sniffled with a laugh, "it's been unlocked the whole time, idiot."
"hey, now," he called as he walked through the door, ducking down a little as to not hit his head on the low hanging fixtures. "why'd you run like that?" he as beside you on the bed, placing your long-forgotten items of clothing on one of the tables.
"why wouldn't i?" you turned the question on him. "i was humiliated," you began to pick at your nails. "i mean, you saw what happened. i was already flustered because you were kissing my neck and then i felt your boner because i couldn't just sit fucking still, which was embarrassing enough, but then the guy i like finds out i'm a virgin too! it was just too much. and then they were laughing at me and.... yea," you took a deep breath once you were done rambling.
"the guy you like?"
"you can't tell me you still don't know," you rolled your eyes once more before xavier grabbed onto your hands to stop you from picking at them like he normally does. "you. you know. it's you."
he didn't even say anything. it wasn't until you mustered up the courage to look at him that you saw a smile gracing his face.
"then you should know why ajax and enid dared me to do that to you in the first place," xavier scooted closer to you on the bed. placing one of his hands on your thigh. "i told them a couple weeks ago that i was starting to really, really like you-as more than friends. they went crazy, telling me you felt the same and everything, but i couldn't believe it. i mean, you're just... you're everything, y'know?
"i meant everything i said when i was outside. you're so sweet, and smart, and god, it takes everything in me not to kiss you when you look at me. because when you look at me, you really see me," xavier finished.
"kiss me," you told him in a soft tone.
"what?" his brows furrowed before you, with a shocking wave of confidence, swung one leg over his lap, now facing him and straddling his lap. his hands went to your waist
"i said kiss me," you leaned in closer to him. "please."
it didn't take anything else for him to bring one hand up to cup your face before finally connecting your lips. it wasn't like fireworks went off, or cannons bursted. it was more like a sense of belonging, welcomeness, and home. your lips had been craving him for so long, it was a sweet, cold treat in the summer as your tongues began to glide with one another.
once again, your hips couldn't contain themselves as they began to rock back and forth on his lap, this time successfully getting the desired friction exactly where you wanted it. you sighed into his mouth, your hands dragging through his hair as he began to nurse the same neck he was kissing nearly 45 minutes ago.
"i thought that would be the only time i'd have you to myself," xavier droned on. "i might've gone a bit overboard..." he laughed as he traced circles on your neck.
"what...?" you backed away from him before he picked up his phone, showing you with the selfie side of the camera how he had littered your neck with deep hickeys. "xavier!" you playfully shoved his shoulder.
"you better get used to it," he shrugged with a sly grin. "i can be territorial at times."
"god, as if you couldn't get any hotter," you began to peel off your dress, reaching for the hem before xavier swatted your hands away.
"let me," he ordered, you listened immediately, retracting your hands and placing them on his shoulders as he helped you rid yourself of your dress. "i don't even understand why you wore this since it's freezing outside."
"hmm," you mockingly acted like you were thinking. "well, when the guy i like is going to be in a place with booze, there might be certain possibilities and i wanted to look nice."
"you look better than nice," he pressed your lips together once more. "i was hard long before you even sat on my lap, y/n/n."
"please fuck me?" your voice was soft and whiny. "please? i want you, i just need you to-to y'know... please, xay?"
"you sound so pretty when you beg for me," he let his hand trace your neck before he buried his hand in your hair, gently tugging it back before admiring you in your nearly naked state.
"xay, please?" you were holding onto the hem of his t-shirt, nearly stretching it out with your begging.
"okay, love," he chuckled before swiftly tossing his shirt over his head, letting it land somewhere he wasn't concerned with. "now we're a bit more even, yea?"
"i just... i need you..." you were a squirming mess in his lap, to think an hour and a half ago you were pleading with yourself to keep your dignity and now you were begging for xavier...
"what do you need from me?" he teased, letting one of his hands trail down your front, hovering over your center. "i need to hear you say it for me. tell me."
"i need you," you sighed as you buried your head in his neck. "i need you to make me... make me cum?"
he chuckled maniacally, "is that a question? i thought i told you to tell me what you want?"
"please just make me cum xavier!" your frustration showed as you began to lazily press kisses to his neck. "please?"
he swiftly turned over so you were laying on the pillow at the top of the bed, him hovering over you with his hair falling to your face. he began pressing kisses down your body, gently squeezing your breasts and sucking on your nipples. eventually, after a few minutes of teasing, he reached your center. he moved your panties down your legs and began pressing kisses to your thighs, alternating between each one.
"has anyone ever done this for you before?" you shook your head 'no.' "is it alright if i do?"
"anything, xay, anything, please," you nodded as your hands tangled into his hair.
he pressed gentle kisses around your clit before licking one line through your slit, lapping up your juices like a man starved. you heard him moan into your pussy, the vibrations shooting through your core shocking you more than you thought possible. you reactively tugged on his hair, tossing your head back as he continued, now sucking gently, very softly, on your clit.
"oh my fuck," you breathed out, looking down at xavier to find his eyes fixated on you and your reaction. "god, you look so pretty, xay."
you felt him smile against your pussy, not letting himself get distracted by little compliments that he was sure melted his heart completely. one of his hands was gripping your thigh so hard you were sure there would be marks the next morning, the other hand was placed on your lower stomach, pressing down just slightly. he used the hand that was rasping your thigh and gently pushed a single finger in.
your mouth formed in an 'o' shape at the intrusion. his fingers were much longer than your own, and when he curled it inside of you, you swore you could see stars in his eyes as he continued to suck and kiss your clit. he gently thrusted his finger in and out a few times before adding a second finger.
"please don't stop," you were gripping his hair so tight you were surprised it hadn't ripped out. "'m so close, xay."
he stopped sucking your clit momentarily to say: "be sure to look at me when you cum."
you nodded dumbly as he got back to work, and it wasn't long until you were at that edge that no other man has ever been successful in bringing you to. at first you threw your head back before you remembered what you had promised him. with a few more thrusts of his fingers, you saw the look of pride on his face when he felt you squeezing his fingers in a vice grip, your mouth dropped open completely as pornographic moans left your mouth.
"fuck, yes, xavier!" you ground against his mouth as he worked you down from your high. "holy shit," your chest was heaving as he kissed his way back up your body.
he hovered over you as he sucked on the same two fingers that were just inside you, groaning, "did i tell you how amazing you taste?"
"will you fuck me now?" you reached down between the two of you to palm him through his sweatpants. "i really, really want you."
"i don't want you to just want to do this because you want to get it over with," you could sense the sincerity in his tone. "i want this to be more than just a hookup."
"it's not, xavier," you cupped his face with one hand. "i assure you, it's not," you smiled as he pressed your foreheads together. "you mean so much more to me than just one amazing night, xay."
"are you sure you want to do this?"
"yes."
"wait, i don't have anything..." xavier hinted with a worried look on his face.
"well, i'm obviously clean, and i've been on the pill since the eighth grade," you shrugged. "if you want..."
"really?" his eyes widened at the thought, you nodded. "i've never... shit. this'll be a new experience for the both of us."
after a bit of shuffling, xavier lined himself up at your entrance, looking at you one more time for confirmation. as he entered you, it was like the wind was knocked out of you. your arms wrapped around his neck as he continued to push himself into you. at a certain point, you thought it was never-ending.
"god, you're so tight," he breathed into your neck, pressing a kiss to one of your hickeys as he continued.
your head was thrown back as he finally bottomed out in you, one of your arms wrapped around his waist while the other was around his neck with your hand buried in his hair.
"so deep," you closed your eyes at the sensation. "'s like you're in my stomach, holy fuck."
he pressed down on that same spot he had earlier, very gentle, but you felt it so, so much. "is that where?" you nodded fervently.
"please move, xay, please," your hand was practically clawing at his back.
"i'm gonna go slow, okay?" you nodded at his words. "if you change your mind about anything at all, say the word and i'll stop, alright?"
"okay," you agreed with a smile as he slowly pulled back out before reentering at the exact same pace.
with each thrust, his pace increased. your moans' volume increased too. it was as if each whimper, moan, and plea was simply egging him on and bringing him to the end of that wonderful precipice of pleasure.
"you look fucking perfect," his own groans and huffs of pleasure rang out. "such pretty tits," he messily grabbed one of them. when he brought his hand down to play with your clit, you knew you weren't going to last much longer. "and such a pretty pussy for me. all mine, y/n/n. all mine."
"god, it's-i'm..." you were cut off by a guttural moan. "i need to cum. i'm gonna cum! xavier, please don't stop! please!"
"where do you want it?"
"inside, please!" you huffed out, clawing at his back as you whimpered in his ear. "need it so bad."
"say you're mine," he ordered. you could feel his dick pulsing inside of you.
"i'm-oh god," you cried out once more, tears forming at your lash line. "i'm yours! i've always been yours, xay, please! fuck!" for the second time, xavier was able to bring you off that cliff, this time he followed suit.
"so fucking pretty when you cum," xavier added before with a few more thrusts, his thick cum coated your walls. "oh fuck."
"oh my god," you sighed out as xavier slumped against your body, laying completely on top of you.
"you got that right," you could feel his smile against your shoulder before he began to press kisses against your warm skin. "here," he reluctantly got up from his position after carefully pulling out of you, tucking himself back into his sweats, and reached for one of his recently cleaned towels (he had a rotation for them, alright?). he began to wipe up your thighs, being very gentle at your center.
"xavier?" you called before he laid back down.
"yea?" he looked at your worriedly before you smiled, simply asking: "can i wear your shirt to sleep?"
a bright smile made its way to his face, "of course, yea," he helped you poke your arms and head through the shirt before he stepped back, admiring you in it. "i almost like this on you more than nothing on you. almost."
"xavier!" you called before shoving him to the side. "you perv."
"you like this 'perv,' as you call it," he rolled his eyes as he began to cuddle with you on the mattress.
"i wanna lay on you," you tried to get onto your knees to maneuver your way on top before he had to catch your arm.
"let me help you a bit," he tried to hide his smug smile while he rolled the two of you over.
"i'm never gonna live this down," you shook your head as he raked his fingers through your hair.
"nope," you laid in the most comfortable silence for a few minutes before he spoke again: "y/n?"
"mhmm?"
"i might've lied earlier when i said that i told ajax and enid that i liked you," you could sense a bit of restriction in his tone.
"what do you mean?" you held your breath.
"i told them the truth," he pressed a kiss to your forehead, getting your attention so you were looking in his eyes. "that i'm in love with you."
9K notes
·
View notes