Tumgik
#(I'm just including the link so that people can find the post)
u3pxx · 5 months
Text
Tumblr media
EDIT: CLOSED NOW! thank you everyone
---
will be closing on JAN 29, 9 AM PHT/JAN 28, 5 PM PST
thank you so much to those who donated! i wasn't expecting to have a considerable backlog from just the 3 days since i've posted this, that's why i mentioned before that i'll be leaving this up for a week. still, i'm afraid i'll have to cut this short since i've lots more drawings to do and i unfortunately have college to juggle at the same time.
i am extremely thankful for all the generous people who have emailed me about donating! i'll be closing this at 9 am tomorrow (my time) since, again, busy. so if you've been thinking about donating and getting a doodle from me, there's a little bit of time left!
---
hello there! i’ll be doing character doodles for donations (donations done after i post this) for gaza!
Tumblr media
what will these doodles look like?
the characters will be drawn from the shoulders up! the higher the donation, the more polish that doodle’s gonna get!
what do you need to do for a doodle?
you could either:
donate e-sims to palestine (starting from sims priced 14+ usd). the post linked includes tutorials, relevant links, and discount codes you can find in the replies. instructions can be also found on https://gazaesims.com/ (you can donate another/more sims for an extra doodle or more polish, you decide)
donate 14+ usd to care for gaza. you can donate to them via paypal over here
or donate 14+ usd to palestine children's relief fund
afterward, take a screenshot that you’ve successfully donated to any of the ones mentioned above and send the proof of donation to [email protected] as well as:
the amount you've spent/donated in usd
the name/reference pictures of the character you want me to doodle (ocs included!)
now, please note that my work is for personal use only, not for commercial use/profit/merch/ai training/nfts. you can use it on icons, headers, etc. but please credit me and do not crop/edit out my signature.
i'll end up being a lot busier in the following weeks so this will be available for a limited time, i'll announce it here once i close this. thank you so much, free palestine!
6K notes · View notes
zorciarkrildrush · 8 months
Text
Kim Kitsuragi shitpost voicelines!
Please see end of post if you want to use these!
Submitted by you, voted for by you, I'd like to present the voicelines you were just dying to hear being said by Kim - dutifully performed by the brilliant Jullian Champenois.
In 10th place,
How did we get here? We walked, believe it or not. You were not entirely lucid.
In 9th place,
I want to have fuck with you.
In 8th place, Normal people, when they go down a slide - they're fine.
Submission idea attributed to this post.
In 7th place, No, detective, I do not just want to go apeshit.
Submitted by bowyooo. In 6th place, Apartment complex? I find it quite simple.
Submitted by elelei. In 5th place, Officer, what the fuck was that?
In 4th place, Trans rights are human rights, detective. Obviously.
In 3rd place, Do I like men? Man is a hopeless creature. I don't like much of anyone. ...Oh, if you meant sexually, then, yes.
In 2nd place,
Detective, Instead of worrying about appearing 'submissive and breedable', please make sure your paperwork is submitted and readable.
Submitted by scrollingdown. And finally, in 1st place, the voice line you all wanted to hear so so badly is...
I'm da king of da highway.
Usage
You are welcome and encouraged to use these for memes, shitposts, and other foolish fan content on social media. When you do, please include credit to Jullian Champenois. You can also include a link to his website, tag him on Instagram/Twitter (@julliannailluj), or mention his Youtube channel according to the content you make. Commercial content of any kind - ads, promoted videos, etc - is explicitly forbidden by these usage terms. Anything of this sort will require specific permission by Jullian. Please don't fuck around we love him. That's it! Thank you everyone for participating, reading, and enjoying this silly little project.
7K notes · View notes
fleapit · 5 months
Text
hi. why is nobody talking about the porn ban in north carolina? the PAVE act is a bill that was passed back in september 2023 (came into law january 1st 2024) that effectively bans users from viewing websites hosting adult content without age verification. (link to the bill)
"-the act legally requires commercial ventures to verify users’ ages if a company “knowingly and intentionally publishes or distributes material harmful to minors on the internet from a website that contains a substantial portion of such material.”
In order to do so, North Carolina requires these sites to either use “a commercially available database that is regularly used by businesses or governmental entities for the purpose of age and identity verification,” or utilize “another commercially reasonable method of age and identity verification.” Companies are not allowed to hold records on any personally identifying information used to confirm users’ ages.
Additionally, North Carolina offers residents the right to a lawsuit if a site is found to record user identifying information, or if a minor’s parent or guardian finds that a website allowed their child to access a site purposefully hosting material “harmful to minors.”" obviously we don't want these websites having our IDs, but sites like e621 and pornhub just straight up aren't asking for them either- blocking their service to the state in it's entirety instead. even beyond the restriction of adult websites, obviously as the 'queerest place on the net' we can see how "material that is harmful to minors" is not just intentional vague wording, but a massive red flag. even if you dont care about the porn- which you should, this is a massive rights violation. how long until 'harmful material' is expanded to include transgender people? same-sex relationships? anything lgbtq? this is a serious fucking problem and it opens the door to hundreds of potentially worse bills that extrapolate on the same concept.
i have no idea what to do to fight it, but if someone smarter than me could add links to representatives or something, that would be awesome.
i'm also going to tag a few people to get this post out: @polyamorouspunk @safety-pin-punk @doggirlbreasts (i have no idea who else to tag, if any of you can think of someone who can help this post get out there, please tag them!)
4K notes · View notes
hellsitegenetics · 4 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
ms-demeanor · 1 year
Text
So I've been seeing some discourse around the No Fly List leak that looks a bit like "hey everybody, we can't make jokes about this, the list is racist and there are children on the list" or "if you're talking about identity categories instead of the list you're missing the point" and I think that we CAN make jokes about a trans bi lesbian catgirl owning the US government while also appreciating the gravity of the No Fly List but what I think is troubling to me is the way that these discourse posts are treating the blatant racism and inherently fascist nature of the No Fly List as news.
It is news that Maia Arson Crimew was able to download a copy of the No Fly List from an unsecured public server.
It is not news that there are 1.5 million people on that list, many of whom do not belong on it for any number of reasons, and it is not news that there are children on that list, and it is not news that the list is a tool used to deprive people of their civil liberties. That's why the list exists.
I'm aware that I'm getting older. I'm aware that there are entire adults of legal drinking age who were born after 9/11. I'm aware that it's not super common to follow up on foreign policy or national security debacles from when you were in kindergarten, but there are people who have been mad about this shit for twenty years and if you're just now hearing about how bad the list is for the first time, hell, maybe that's on us and we haven't been yelling enough (though when I'm yelling about how the TSA is security theater meant to make us accept encroachments on our rights, this is at least a part of what I'm yelling about).
The No Fly List is a list of individuals maintained by the TSA who are deemed a threat to security for some reason or another.
Tumblr media
The TSA maintains the list, though they are given information for the list from the FBI, Terrorism Screening Center, and other entities. If you'd like to click this document, you can find 250 pages of FOIA'd documents about the No Fly List pre 2006. Much of this document is members of the FBI trying to justify why they need a copy of the list and lamenting that airlines have a copy of the list and they don't. This is very funny.
Tumblr media Tumblr media
There have been issues with mis-identifications and false positives for the list for as long as the list has existed. You can click here to read through an infuriating 200 pages about a Pfizer employee who was stopped at least a dozen times at airports and who retained a law firm to hound the TSA/CBP/ICE clusterfuck of interagency buck-passing for nine months to try to get the problem resolved. One of the three documents at this link includes a complaint from the president of the Terrorist Screening Center lamenting the way that the TSA would refer obvious non-matches to be detained, including infants and the elderly.
Tumblr media
At this point, the FBI/TSA/TSC/ICE/CBP claimed list was still relatively small, in the low thousands at most.
However a 2009 cost-benefit report by the Defense Technical Information Center found that in 2004-2005 30,000 people contacted the TSA to have their names removed from the list; 30k false positives suggests a list somewhat longer than a thousand names.
As long as the No Fly List has existed, criteria for being placed on the list has been subjective and selectively enforced.
Tumblr media Tumblr media
As the Crimew leak shows, there isn't a tremendous amount of biographical data, but there are hundreds of thousands of names and it is enforced at the discretion of the TSA in each individual airport in the US, which is how you end up with duplicates and toddlers and 100-year-old men on what is functionally a filter to keep Muslim people out of the US.
The list has expanded every year that it has existed, and has been defended by republicans and democrats alike since it became one of the tools in our arsenal to fight "the war on terror"
Tumblr media
And for just about that long, people have been talking about how it is unconstitutional, denies civil liberties, and also just doesn't really work.
Tumblr media
It has never been transparent, it has always been a tool of surveillance, exclusion, and control:
Tumblr media
And people have been documenting, protesting, and suing over the islamophobic nature of the list - and the security state's weaponization of the list as a threat - for two decades at this point because in the earliest days of the No Fly List it was OPENLY ACKNOWLEDGED that it was based on racial profiling and people made (shitty, cruel) legal arguments for why it should be:
Tumblr media
THIS isn't funny. These are not the things that people are joking about when they choose to stay silly :3 in this conversation.
But these things also aren't news. Nearly everything I screencapped here was listed as a source on Wikipedia, and what wasn't was available as simple searches on Archive.Org or easily looked up on news websites.
All you have to do is just *look* at the sources on Wikipedia to see that people actually have been talking about it for quite a long time, very publicly, and that there has been a lot of public outcry about the list as it balloons and punishes innocent people with false positives:
Tumblr media Tumblr media Tumblr media Tumblr media
And when you've been looking at stories like these for twenty fucking years it feels wonderful to say "holy fucking bingle" and celebrate that for once someone did something VERY COOL in order to shine a light on this massive (and apparently underappreciated problem).
12K notes · View notes
nobrashfestivity · 5 months
Text
Everyone Hates Poetry 2024
Rules
Write a poem before Feb.5th and submit it to me with the submit feature or in an ask.
Poems should be less than 500 words
You can use your real name or your blog name but they can't be completely anonymous.
Poems will be published at 9pm on Wednesdays and then a link to each poem will be added to the bottom of this pinned post so people can read them all.
I can't stop anyone from reblogging their own poems and generally sharing art is a wonderful thing, but don't turn it into some kind of social media campaign. because people with a small number of followers would be at a disadvantage. This is supposed to be fun. Please do reblog this post and tag people if you think you know someone on tumblr that might be interested. Since the post will contain links to the submissions, your poem will not be lost in the shuffle.
If I receive less than 10 entries I'll cancel the contest and consider it a failed experiment.
Public voting will begin after the 5th.and account for 50% of the vote
A panel of judges will also vote but will not submit poems themselves, and their votes will make up the other 50% of the final tally.
.There will be small prizes for the winner and runner up.
This is my art blog and will remain so, as it always has been. I'm doing this because poets here don't get much chance to get their stuff read and I have a fair number of followers. It's just a little thing to do if you want. I'm not turning this into a poetry blog or a contest blog or anything else.
Poems don't need to be finished. Due to the one month time frame I would suspect these would be first drafts, but please write something new. I want to encourage people to do something now, however imperfect, rather than showing work that's already done.
Updates will follow. Thank you!
Rule clarifications
-Please dont send poems anonymously if at all possible. I am happy to include a name that doesn't identify your blog directly but it's impossible to refer to or contact people who submit poems anonymously. I can't have anonymous poems considered without at least a name for you and if you were to win a prize, you'd need a name and address to claim it. I don't so much care about the latter part, that's for you, this becomes very disorganized and hard to regulate with anonymous messages floating in.
-Please put the title of your poem above it. If it is below it, I have no way of distinguishing with certainty if it's a title or a last line.
One poem per person please.
if you do not wish to see the poetry contest entries just filter the tag "everyone hates poetry 2024"
Due to the very high volume of submissions I am blogging them more gradually as to give more attention to each one. The same tag, "everyone hates poetry 2024", that you can filter if you do not want to see these can be used to find the submissions. If you follow this tag you'll get them all.
Please note that I am now publishing these as asks, previously I had to retype to keep the formatting and there are simply too many entries
Submissions are now closed, I will be publishing submissions all week and then when all have been posted we will start the voting (stay tuned as to how and when)
1K notes · View notes
lethesbeastie · 19 days
Note
Hi, I saw your post about practicing drawing fat people and I was wondering if you could compile like a list of resources or references?
Tumblr media
It can be difficult to find resources for drawing the wide variety of forms fat bodies can occupy, so I've done my best to bring together some resources I've been able to prove have some degree of diversity in the references they offer!
My primary resource recommendation for drawing fat people is Morpho Anatomy For Artists: Fat And Skin Folds! It does a wonderful job breaking down where fat accumulates on the body, how it interacts with the familiar landmarks of human anatomy, and what sort of shapes it tends to form under the influence of gravity. It's a phenomenal reference and my top recommendation for anyone seeking to improve at drawing fat people!
When it comes to finding decent photo references for fat people, the pickings are frustratingly slim. Most sites that specialize in pose references either don't have fat models or have all their images behind paywalls. Of the resources I looked through, the best sources for pose references were Adorkastock and Line of Action.
@adorkastock actively seeks to provide an incredible profile of pose references with diverse body types, and as an added bonus you can access a lot of their images for free on their site/Tumblr or join their patreon for early access to images! Line of action is a site aimed towards practicing figure drawing, providing images and a timed function to challenge artists to sketch within a set time limit. I took the time to go through roughly 300+ images and was pleased to find that during my session around two-to-three out of every ten photos were fat models. The only caveats to this was the fact that most of the images were of the same individual, limiting the applications for studying the variants of fat bodies. Still, it's an amazing tool that has a free mode and allows you to filter the types of references you want based on age and level of nudity.
Beyond sites that specialize in art reference photography, there's also the ever popular Pinterest, which is the site where I typically seek references for my personal studies. Due to the nature of Pinterest's extensive collection, there's a vast variety of references for different fat body types that includes a lot more "everyday" people. The primary issue with Pinterest however is the rampant reposting and lack of proper credits for images, which can make things dicey depending on how you wish to use the references you find. For personal studies this isn't really an issue, but for any sort of professional or paid work is something to be aware of just for the sake of accountability.
* For those who are 18+, porn photography of real people also offers an incredible wealth of visual resources for fat bodies and how they interact with gravity/movement/etc. The variety of positions and angles offer many opportunities to study human anatomy, and it's a pretty well-known fact that drawing NSFW art can be an important learning experience for those struggling with drawing anatomy. In the end, it depends on your personal level of comfort with viewing/drawing explicit images, but it's not something you should completely overlook.
Last but not least, look at the work of artists you admire who draw fat people! While I typically recommend sticking to photo references for learning anatomy, studying artist's portrayals of fat people is also incredibly helpful for learning different tactics for simplifying and/or stylizing fat bodies to better fit ones own style. There are also plenty of artists who've crafted tutorials detailing their approach to drawing fat folks, so I highly recommend you check them out as well! I hope the resources I've linked here can help you in your studies, and feel free to drop another ask if you have any more questions! I'm planning on posting a tutorial on how I do studies for fat people soon, so that will be an additional resource for you once I've got it posted!
734 notes · View notes
schattenhonig · 1 month
Text
The A in LGBTQIA+ doesn't stand for aspec because they're not repressed!
(please read the disclaimer at the end of this post)
Ummm, excuse me? Would you mind telling me what your definition of repression is, then?
Because I feel repressed when a doctor asks me about my sex life, and if I say I have none, it gets marked down as a symptom without being asked if I suffer from it.
I feel repressed when my gyn tells me I can't get a hysterectomy yet despite losing so much blood on every period that I need to take iron supplements all the time, because I could change my mind about not wanting children (which is a whole other post, I know, but it's most likely linked to sex).
I feel repressed if I can't use dating apps or platforms because my sexuality doesn't even exist there, and the one time I tried, I got called names because I didn't want to meet for because it was clear where this date would go, despite my explicit "what I'm looking for".
I feel repressed when I think about how recently a paragraph was finally abolished in my country that considered sex a vital part of a marriage, basically entitling the spouses to having sex with their partner (both gender neutral, because entitling people to having sex with somebody else by law is wrong. It's basically a rape permission).
I feel repressed when I can't watch any film or show without it being about love and/or sex, no matter if it fits the narrative and furthers the plot.
I feel repressed when I plot my own stories and automatically put a romantic couple in there as main characters, even though I have no idea why this would be important for the plot. Not even my own stories, my own thoughts are mine.
I felt repressed when I was asked accusingly in a relationship if I wasn't missing something before I even knew asexuality as a spectrum was a thing, and having to lie about this being a side effect of my medication instead of genuinely not feeling attracted to someone in this way.
I feel repressed when I can't tell people I'm not sexually attracted to them because they will take this personally no matter how well I explain myself.
I feel repressed when everywhere I look there's advertising relying on naked skin, suggestive posing and objectification. Why are expensive cars still presented by women considered beautiful and tempting? It's not like that's necessary to convince people of spending so much money on a thing that gets you from A to B. Couches with women in smart dresses and high heels. That's not what a normal person looks like on a couch. But the worst is a truck in the town where I live: it's from a small fruit and vegetable stand, so whenever I see it, it comes from the warehouse, delivering groceries. On it is a woman clad in very little, presenting fruit. I'm sorry, but why? Does a misogynistic picture convince you of the necessity to avoid scurvy?
I feel repressed when I tell people and get the answer "you just haven't found the right person yet", because there are two possible assumptions from that point: I'm either not trying hard enough (so it's basically my own fault) or something about me is not right, appalling even (which circles back to I'm not trying hard enough or frames me as a victim of my genetics, upbringing or circumstances to be pitied).
Do not tell me how I feel. Do not try to tell me everything is fine and I shouldn't complain or ask for acknowledgement if everywhere I look, I'm reminded of how odd, how weird and how not normal I am. How much it inconveniences you to even acknowledge my existence, let alone respect any of my traits, views and choices.
And while I can only write from my own asexual point of view, I wrote this with all kinds of flavours of aspec in mind, so I'm explicitly including aromantics, aroace people and every shade of the spectrum in this. Not all my examples may apply to you, but I hope you can find something to relate to.
ETA: please feel free to add your own experiences of repression!
956 notes · View notes
5ummit · 1 year
Text
So there's this post with a troubling number of notes going around insisting that "dead dove" is not a genre, it doesn't inherently have anything to do with darkfic, and that the tag could be applied to fics that are "100% fluffy where everyone's having a good time" if they happen to contain some abnormal (though entirely non-problematic) content like an unusual kink. The claim is that "dead dove: do not eat" is simply a "courtesy tag" that means "this is a very specific niche, mind the tags." And that's just... wrong.
I wrote up a whole rebuttal to this post since I can't stand misinformation and frankly OP was being kinda rude and judgey on top of their wrongness. But right after I posted my reply, OP turned off reblogs because, and I quote, “some fuckwad added some dumb shit onto this post and it is no longer educational” (the “fuckwad” being me and the “dumb shit” being proof that they were wrong). A couple people have asked me to make a rebloggable version of my response, which I've decided to do because this isn't the first time I've heard similar claims and I want to help set the record straight. However, I'm not linking the original post on the off chance this gains traction because OP did the right thing by turning off reblogs, preventing it from circulating further, and I don't want them to get hate for being unfortunately misinformed.
For those who don't know the history, "dead dove: do not eat" was originally proposed as a catchall "hydra trash party" alternative label for any fandom to warn that the content of a fic may be considered problematic or potentially upsetting and to read the tags carefully so you know what you're getting into and won't complain later. Specifically, DD:DNE was intended to convey that the Bad Things in the fic would likely be reveled in and not explicitly condemned by the narrative, which some people tend to get up in arms about, hence the need for the extra warning in addition to the tags. Don't believe me? Here's the original proposal (note DD:DNE can be found on a handful of fics dated before 2015 but this is when it really took off and became a Thing).
There are currently around 50,000 fics tagged as "dead dove: do not eat" on AO3 and close to 50% of those also include the rape/noncon warning (which of course is not the only type of "dead dove" but is one of the most popular and most consistently tagged). The normal percentage of noncon fics in any given fandom? Around 1-3%. That's a HUGE disparity. So don't tell me that dead dove is just a general "courtesy tag" and doesn't or shouldn't have dark connotations. Even the context of the original joke on Arrested Development has a dark undertone. Micheal Bluth casually finds an animal carcass in a bag in his refrigerator with the label "do not eat", as if eating it would be any sane person's first thought. The whole situation is kinda fucked up. And this fucked up vibe very much carries over into fandom usage too, as was intended.
The claim that dead dove has nothing to do with the content's genre and could just as easily be used to describe a 100% fluffy fic in which everyone's having a good time is straight up Wrong, or at the very least, severely warping the original meaning. Also, when someone these days says that they like/dislike "dead dove" most people in fandom automatically understand what that means because of the consistency of its usage over the years and the way language evolves. Whether you like it or not, "dead dove" IS a genre now and the term does carry a specific connotation. I do agree that DD:DNE should definitely still be used in conjunction with other tags, when applicable, to be explicit about the exact type of fucked up content you may find, but to say that the term is meaningless on its own is patently false and I'm tired of people who don't know what they're talking about pushing this narrative and causing even more confusion.
You want a generic term that also means "mind the tags" and doesn't have any inherently dark connotations? Just use good ol' "what it says on the tin" instead of trying to force dead dove to be something it's not.
3K notes · View notes
ao3commentoftheday · 6 months
Note
another writer stole parts of my fic.
i found out about it by sheer coincidence, because they were asking for a feedback on their fic on the server we were both part of.
i read the fic out of curiosity and noticed paragraphs and storylines taken from my fic.
the worst part is she's a bigger writer than I am, she has big tiktok account in my ship and she publishes chapters faster than me (understandable how now as she copies parts from other people) so her work buried mine down and surpassed by all stats.
She has bigger platform then me, bigger clout. I'm not on tiktok so i can't call her out on her own platform.
And she has my fic in her bookmarks.
I don't know what to do :/ Kind of want to call her out but also i can't muster the energy to fight a battle like this.
I never really see the point of call outs, myself. The people who love that person rarely change their minds. The people who support you already support you. All that a callout post will do is cause a lot of drama that you don't want to have to deal with.
Instead, I recommending reporting her work(s) to the Policy & Abuse Committee (PAC). They can investigate and determine whether plagiarism occurred. If it did, they will ask her to edit her fic to change it. If she doesn't, they'll delete it.
(it's more complicated than that and it takes a long time, but that's the gist)
To contact PAC, go to the work that you want to report (the one that she plagiarized) and scroll down to the footer. Click on Policy Questions & Abuse reports. Explain what you think happened and include a link to the work that you think she copied. If they are multichapter works, tell them which chapter(s) were taken and give them whatever other information you can to help them find the specific parts.
If more than one of your fics was affected, you can include all of the links in the same report - no need to report each one separately. Just make sure it's clear which story belongs to her and which belongs to you.
PAC may come back to you with questions. They'll definitely reach out to this other author. They won't mention your name, and you won't hear any details about the other person until PAC can tell you what their determination is. They take confidentiality very seriously.
I will say, ideas will need to be very specific in order for that to be the determining factor for plagiarism. Most of the time, the call will be made based on the text itself an how similar it is to each other. For more information about how they determine plagiarism and copyright infringement, you can see this post from a PAC takeover I hosted in April 2022.
PAC doesn't care who has the bigger account and they don't give two shits about clout. They just determine who wrote what, when and then go from there.
731 notes · View notes
pixiel · 3 months
Text
Dashboard Unfucker Alternative
With the death of Dashboard Unfucker I wanted to share the link to my alternative (I know Tumblr hates external links so I'm making a separate post to make sure this userstyle reaches as many people as possible) The post is pinned on my Tumblr & I'll include a link in a Reblog & Replies just in case to make sure people can find this post!
Thank you dragongirlsnout for all your work on Dashboard Unfucker it was amazing working towards the same goal of fixing this website with you! The fact that this site has treated its trans users like this is absolutely horrible. I know we affectionately call this website a Hellsite, but right now, it's honestly feeling less of a joke.
I will continue to update my Old Tumblr Dashboard Userstyle for the foreseeable future and if anyone has any issues with it my Messages and Replies are always open - I try to get back to people ASAP!
Right now, my Userstyle is compatible with Dashboard Unfucker and can be used in unison to keep access to the ability to change the Width and Content positioning that Dashboard Unfucker has, as well as other features. This compatibility might not last as Dashboard Unfucker slowly fades out... Dashboard Unfucker is now sadly dead, however, I am working on a bonus Userstyle to add content positioning/width - this is now in Alpha testing!
Check the replies for the Userstyle's tumblr post link!
680 notes · View notes
phoenixyfriend · 4 months
Text
How to Call Your Reps About Gaza
I make a lot of posts telling you to call your reps! Anyway, here's the overall shape of how to argue to them.
Disclaimer: I am not in politics. I do not have experience as a staffer. I am just someone who cares a lot about where things are going, and wants to help. Also, this is specific to the US, because that's where I'm based. Hopefully, people with expertise can add more suggestions on.
Find your elected officials.
My Ko-fi: this took me two days to write up, so uh. If you've got a few dollars, send them my way so I can keep doing this sort of thing, and maybe move out of my parents' house sooner.
General tips:
Be polite, or at least civil. Do not swear or shout at whoever answers the phone. This will quite possibly get your number blocked. Fifty civil calls over the course of several months will do more than one where you shout. You can be frosty, you can say you are disappointed, you can say you find the actions of your reps to be reprehensible or morally bankrupt, sure. But keep calm and aim criticism at the rep, not the staffer.
Keep it short. The staffers who answer call centers are busy. They usually start trying to hurry me off after about two minutes. I've yet to manage a call longer than four or five minutes. Pick one or two topics for the day, and focus on those. Cycle through them every time you call. Stick to just one from day to day if it's a large, ongoing issue like Gaza.
Plan for voicemail. I get voicemail more often than not. My House rep usually has a staffer free, but the Senators are almost always voicemail. This will give you a minute and a half max. Be ready to get your point squeezed into that.
Only call your representatives. The important, powerful word here is "constituent." You will be ignored or even counted against if you are from a different district or state. The first thing you start with is your name and address. A staffer will ask for the information they need. On voicemail, leave your full name, your city and state, and zip code before you go into your message. Do not lie, either. They look these things up in the system when you call. I'm not sure how--I think maybe they have access to a database of registered voters--but every time I call, they ask for my last name and address and at some point say, 'oh, yep, I've got you right here,' which indicates a database of some sort.
Research at least a little bit about their opinions. If they already agree with you, then it's much easier to leave a quick "I support you and want you to know that" to combat anyone who's arguing from the other side. If they don't, then you're best off finding out what specific issue they have so you can know the best kind of comment to leave.
Look up specific bills or arguments. I get daily emails from GovTrack about bills that are on this week's docket or have been voted on in the past day. IDK about anyone else, but being able to say that I disagree specifically with HR 815 or something makes me feel powerful, and possibly like I will be taken more seriously. Sometimes you can start with articles like this one, which include links to specific bills on the official congress website.
Email after if you can. Reportedly less effective, and takes longer, but you are more likely to get a written (canned) response, and it reinforces whatever you called about.
Basic structure of a call, at least as I've been doing it:
"Hi, my name is ____ ____, and I am a constituent from [city, state], [zip]. I am calling to express my opinion on [topic]. I am concerned about [short argument with a clear impact on the topic]. I ask that you support [measure or fellow congress member]/vote [yay/nay on specific legislature]. Thank you for your time, and I hope you keep my opinion in mind."
For this post, the topic can be stated as the war in Gaza, military funding for Israel, or unrest in the Middle East, depending on which you think your elected official will respond to best. That said, the structure should work for whatever your call is about.
Arguments to use against your elected official... or your on-the-fence cousin:
I'll be honest, some of these are not going to do much against your representative. They know the arguments, and have been going over them with each other for months. You just need to have one locked and loaded that they consider relevant instead of a nonstarter, in order to back up your opinion as 'founded' instead of 'nonsense, can be swayed with a good marketing campaign.'
I'll include explanations if I don't think something is self-evident (or needs more evidence to tell your cousin), but in most of them I'll provide some suggested verbiage that you can tweak as needed, and for a few of them, that's really enough.
THESE ARE FOR THE TOPIC OF CONCERN, ONLY. You still need to end each one with "I ask that the [official] votes to [action]" at the end. Give them something actionable (example from Feb. 13th). My go-tos right now:
Both chambers: Reinstate funding for UNRWA
Both chambers: Place mandatory restrictions on any aid to Israel, with contractual threats to cut funding if Netanyahu and his government continue to disregard civilian life
Senate: Put support behind Bernie Sanders and his motion to restrict funding to Israel until a humanitarian review of the IDF’s actions in Gaza has been completed (S.R. 504) (Tabled by the Senate on 1/16, but it is being brought back in as conditions continue to escalate)
House: Put support behind Rep. Rashida Tlaib’s petition for the US government to recognize the IDF’s actions in Gaza as ethnic cleansing and forced displacement, and put a stop to it.
House: Put support behind H.R. 786, introduced by Rep. Cori Bush, calling for an immediate deescalation and cease-fire in Israel and occupied Palestine.
What Not to Say
"There is no threat to Israel." I've talked about this elsewhere, but the short version is that this will be basically laughed out as you not knowing what you're talking about.
Anything generically antisemitic. (I mean, it might work on some of the white supremacists, but do you really want to encourage that thinking? No, so don't do it.)
Facts that you "heard somewhere" but cannot find a reliable source for. If it's being reported by the New York Times, NPR, or the BBC, it's probably trustworthy by government standards. If it's not a super common statistic, cite the journal you got it from by name. Remember, you aren't arguing to tumblr mutuals. You are arguing to your elected official or your 'I don't really pay attention' cousin. When it comes to this, big name news sources are better.
Unrealistic demands for complete isolationism, permanently abandoning Israel to its own devices, supporting Hamas, etc. Again, you will not be taken seriously. Pick an argument they might actually listen to, and use it to press them towards a possible solution. You want them to believe that if they adjust their position, they will be doing the will of most of their constituents, and thus more likely to get reelected.
The Ethics Argument
Third-party reporting has stated that that nearly 29,000 Gazans are dead since Oct. 7th, as of 2/18/24. The vast majority of those are civilians, and over half are children. Palestinians in Gaza are facing an acute hunger crisis threatening to become a full-blown famine.
The International Court of Justice has found that there is credible reason to believe that the state of Israel is committing a genocide against the Palestinians of Gaza.
This does not mean that every single Israeli is complicit. It does mean that the government, particularly Netanyahu and his associates, has been reprimanded by a large, diverse coalition of countries, and has consistently refused to listen to that court since.
This argument will possibly work on your cousin. Less likely to work on your elected official. They already know the numbers. I just wanted to get it out of the way first.
The Re-Election Argument: Michigan vs New York
Meanwhile, this is possibly the most effective. Again, this is not an argument of ethics. This is an argument of "how can I make my elected official do what I want." We do not use only the purest moral argument. We use what works.
What to say to your elected official: Michigan, as a swing state, was won by democrats on the power of the Arab-American vote in the 2020 election. We (either party) are at risk of losing Michigan due to the current Congressional approach to the Gaza conflict, as that demographic is now polling as likely to abstain from voting entirely. The risk of losing several congressional districts due to the Jewish vote is a real one, but the risk of losing the the executive branch is greater, especially after what we saw with Suozzi. Supporting Palestine might lose us parts of New York, but supporting Israel will lose us Michigan.
Explanation: Something that has been taking up a lot of time and space in the election coverage is the situation in Michigan, and more recently, there has been attention paid to the special election of New York's third district, AKA the "who gets to replace disgraced George Santos" competition.
Michigan is traditionally a swing state. While 2.1% doesn't sound like a lot, that is some 211k-278k people (depending on your source), and while not all of them can vote... Michigan was won by about 154k. Arab-Americans are not the only relevant demographic, but they sure are an important one, and they are vocally opposed to the situation. Approval has dropped from 59% to 17%. From that same article:
As Axios notes, Biden won Michigan in 2020 by 154,000 votes, but there are at least 278,000 Arab Americans in Michigan. Biden took Arizona, a state with an Arab American population of 60,000, by only 10,500 votes. In Georgia, Biden prevailed with a margin of 11,800 voters, in a state that has an Arab American population of 57,000.
Democrats cannot afford to lose these states. Pressure your congresspeople about that, especially if you live in one of those states. I assume most Arab-Americans in said states are already calling every day; the rest of you can join in.
Meanwhile, most Jews (considered the most pro-Israel demographic by strategists) in America are concentrated in a very small number of electoral districts. Of the twenty most-Jewish, ten are in New York, which is why I put it up in the section header.
One of those districts was won by a Republican in 2022: George Santos, New York's third congressional district. Following his scandals and ousting, the seat was up for a special election, and the two candidates were Tom Suozzi, a democrat who held the seat previously (he decided to run for governor, and lost), and Mazi Pilip, a Nassau county legislator who was of Ethiopian Jewish background and had been in the IDF. She ran on a campaign that leaned strongly pro-Israel and anti-immigration, and when Suozzi won, she interrupted his victory speech to accuse him of supporting a genocide against Israel due to his rather centrist, rather milquetoast stance on the conflict during his election campaign.
Now, Suozzi's win probably had more to do with Pilip being anti-choice than her pro-Israel arguments, but he still won.
Democrats can better risk possibly losing a few seats in NY than definitely losing three swing states.
"But I don't want Dems to win their districts after what they've been--" Nope. Listen to me. Surveys indicate that Republicans are on average more pro-Israel, because Trump and Netanyahu are buddy-buddy, and we do not have a viable third option.
Also, again, this is about convincing Dems to be better. "If you do not vote to put restrictions on funding to Israel, I will not vote for you in November" is a lot more powerful than "I will not vote for you either way, because of what you've been doing, but you should do what I say anyway."
The Re-Election Argument: Risk of Escalation
So, that thing I said about Trump and Netanyahu?
Yeah, so, while Biden is giving Israel military aid while cautioning them to slow down and be careful, Trump is... complicated, but suffice to say he's much closer to Netanyahu on a personal level than Biden is. Biden's relation with Netanyahu is reportedly pretty frosty, while Trump's is based on relations through the Kushners.
Just from wikipedia:
Netanyahu made his closeness to Donald Trump, a personal friend since the 1980s, central to his political appeal in Israel from 2016.[21] During Trump's presidency, the United States recognized Jerusalem as the capital of Israel, recognized Israeli sovereignty over the Golan Heights, and brokered the Abraham Accords, a series of normalization agreements between Israel and various Arab states.
Trump's been more all-over-the-place recently, badmouthing Netanyahu for being what Trump perceives as a loser, which complicates understanding what his approach is. It's kind of incoherent right now.
Given Trump's general history of being pro-Israel, though, and the attempts by House Republicans to push through a bill of unconditional funding for Israel. It failed, but notable is that the more recent bill passed in part because it was paired with aid for Ukraine and Taiwan (something Dems are much more invested in having happen).
What to say to your elected official: If Trump is reelected due to his current appearance of being more critical of Netanyahu, there is evidence from his presidency to indicate that he will support Israel much less critically if elected. While he claims to want to settle the Middle East, it seems incredibly likely that he will worsen the situation for Palestinians, and ramp up retaliatory strikes to groups like the Houthis in a manner that will impact non-military parties, igniting tensions that are already tenuous.
The Disrespect/Wild Card Argument
This particular argument is best used against the Very Patriotic Politicians who are more concerned with the US's image and Being The Alpha Nation than with other things. Basically, this might work on Republicans.
This isn't really something I believe in, as a matter of foreign policy, buuuut it might work on your rep, so. Consider it!
What to say to your elected official: With Israel's recent actions in ignoring Biden, blocking US-sent aid like those flour trucks that got stopped at the Rafah border because they'd be distributed by UNWA, and generally Disrespecting The USA and Being Unpredictable is not only making the US look bad for being unable to wrangle a smaller country, but also making it so we are less able to wrangle other countries in the future, because Israel cannot be predicted and might set someone off.
The Europe and Reputation Argument
What to say to your elected official: The United States is losing credibility as a world power known for its military and ability to manage international disputes on behalf of the UN, because it is seemingly unable to influence Israel, and losing credibility as an upstanding moral state that is not doing foreign coups and banana republics anymore, as it appears to be tacitly supporting Israel's ICJ-labelled genocide, which is a really bad look with the other Western Powers.
I'm not entirely sure who this might work on, but there's gotta be at least a few politicians who are really concerned about America's image, more than about actually doing the right thing. Figure out if your politician is one of them.
If necessary, you can bring up how Trump is threatening to pull US support for NATO if Russia attacks someone.
The Middle East Stability Argument: Iran-backed Militias
What to say to your elected official: I'm concerned that the continued support of Israel, and thus the funding of their actions in Gaza, will increase the instability of Iran-backed militias, as we have already seen with the Houthis and Hezbollah. Entire Muslim-majority nations are showing increased displeasure not only with Israel, but with the US by extension. We cannot afford another war in the Middle East when we haven't yet pulled all our troops from the last one, not with the recent and recurring economic recessions. Any situation would also very likely be complicated or inflamed by the growing tensions among Eritrea, Djibouti, and Ethiopia regarding Red Sea access as well.
Use this on the ones that claim to be pro-military or pro-veteran. See what they said about HR 815 before the foreign military funding amendment was added.
The Middle East Stability Argument: Egypt
What to say to your elected official: Egypt's government has been unstable since the Arab Spring, and even now the military government is incredibly unpopular. With that existing instability, the addition of economic strain from the reduced usage of the Suez canal, the international disputes occurring because they're the main throughway for aid into Gaza, and the threat of a sudden influx of nearly one and a half million Palestinian refugees should Israel continue to push south... Egypt is looking at a possible near-collapse as we've seen in nearby nations suffering similar instabilities.
Explanation: It took several years for Egypt to really start recovering from the revolts in 2013, and it has applied for four IMF loans in recent years. The current government is unpopular to such a degree that they are looking to build an entire new capital from scratch in the middle of the desert so that they're less open to the risk of civilian uprisings; one of the primary causes for civilian dissatisfaction is economic issues.
Due to Houthi attacks at the Bab al-Mandab Strait, traffic through the Suez canal is down massively, and since the canal "represents almost 5% of the GNP and 10% of GDP and is one of Egypt’s most important sources of hard currency." (src) Various sources are reporting that trade through the canal is down 40-50%, which is putting more strain on the already unstable economic and political situation.
Finally, Egypt's population is about 110 million, but the governorate that shares a border with Israel and Gaza, North Sinai, has a population of barely 500,000. A push of one and a half million starving, injured people will, very suddenly, nearly quadruple the population of the governorate, and require extreme aid response from Egypt's government to keep alive and prevent a larger crisis in North Sinai and neighboring governorates.
The Middle East Stability Argument: Normalized Relations
What to say to your elected official: I am concerned that Israel's continued attack on Gaza is jeopardizing any chance of normalized relations with the Arab states in the future. American has put a lot of work into trying to get these various countries to normalize with Israel, and our funding of the current attacks on Gaza are sabotaging all that effort.
This one can be combined with the Iran-Backed Militias argument: Israel, in pursuit of revenge against Hamas, is setting itself up to be in more danger long-term, rather than less.
The International Trade Argument
What to say to your elected official: I am concerned about how the war in Gaza is impacting international trade and shipping costs. With the Suez Canal down to half its usual capacity and the Panama Canal raising costs and dropping capacity in response to the water restrictions, along with rising fuel costs in Europe and Asia, global trade is incredibly strained. We are being relegated to the Cape of Good Hope, Cape Horn, and the Malacca strait for much of intercontinental trade, and the macroeconomic projections are looking very bad for America.
The Domestic Economics Argument
What to say to your elected official: Many of the plans for Israeli military funding cause damage to other parts of the budget. For instance, a recent plan put forward by the Republicans of the House suggested IRS cuts in order to move that money, a plan which would impact the US budget negatively in the long term; we need those 14 billion being spent domestically, not supporting an overreaction/possible genocide in Gaza.
Explanation: In general, pick something receiving budget cuts that your congressperson will care about. I care about IRS funding, and saw it mentioned as a target in an article, so that's what I've got in my suggested verbiage up there.
The fewer people that are working for the IRS, the more they focus on auditing poor people (simple, easy taxes) and the less they can effectively audit rich people (complicated, time-consuming taxes), which means rich people are more likely to get away with evading millions or even billions in taxation. So yeah, you want more funding in the IRS if you are poor. They are already auditing you. You want them to audit the big guys.
The Russia and China Argument
What to say to your elected official: I am worried that the current focus on funding Israel without restriction is causing us to lose sight of the international threat posed by Russia and China. Russia is actively invading Ukraine, which continues to put massive strain on the European economy with regards to oil prices, especially with the Suez situation, and China has been testing missiles near Taiwan, and thus testing US responsiveness to those threats, for months now. We cannot afford to support an internationally unpopular war if we want to remain ready for Russia and China.
This is less likely to work on Republicans, since Trump is friendly with Russia, but hey, give it a shot if they're one of the ones who aren't fully in his camp.
EDIT 2/22/24: I'm a bit unsure of this tactic, but I'm putting it out there with hopes that someone with more political experience can offer feedback:
"Congress, and the US government in general, has promised to sanction Russia for the alleged assassination of one man within a week of the suspicious death, after five months of refusing to enact even slight consequences on Israel for the deaths of nearly thirty thousand, half of which are children. This is ethically questionable at best, but for the interests of elected officials, it is a very bad look. The mismatch shows a massive bias by the American government in regards to Israel's ongoing mass murder, with over two million facing famine as a result of Israel's aid blocking, and America's reputation on the world stage, as well as individual politicians' reputations domestically with constituents, is plummeting."
-------------------------------------
Finally, my ko-fi again. I spent a long time on this and I'd like to move out of my parents' house sooner rather than later. If you appreciate my time and effort, please feel free to donate a couple bucks.
562 notes · View notes
unseelie-grimalkin · 1 year
Text
I'm going for gold, lads, lasses, and other gendered classes!
Do you like visual novels? Do you like stories about the fey? Do you like your entertainment as EDUTAINMENT?
IF SO, BOY HOWDY DO I HAVE A VISUAL NOVEL PROJECT FOR YOU.
youtube
The Good People (Na Daoine Maithe) is a lore-rich and choice-driven romantic visual novel inspired by Irish mythology. Play as an Irish tenant farmer from the mid-19th century, whose path becomes inexplicably entwined with fairy affairs after getting robbed by the roadside and lured into the mythic and war-torn world of Tír na nÓg: A once unified land, now divided into the Seelie and Unseelie Courts. Will you escape with your stolen belongings? Or does fate have something else in mind?
OKAY, BUT WHAT DOES THIS MEAN FOR YOU, SEEKER OF SEROTONIN?
6 wonderful romantic/PLATONIC options (each love interest can be pursued entirely platonically)
a visual novel whose philosophy is less on anxiety-inducing, arbitrary choices to get a good or bad ending, but instead focuses on if you, the player, are interacting with a character in a healthy or unhealthy manner, leading to player freedom and choice
intelligent and reflective writing that is reflected within character moments and dialogue
and MORE! (so much more!)
WHERE CAN I FIND MORE OUT ABOUT THIS GAME?
Here is the bio link, which has links for the indie developers' social media accounts (Tumblr, Twitter, Discord Server) along with the link to their official website, which has a deep dive into every main NPC and the philosophy of the game. The demo is out now and free on both Steam and Itch.io
(As an official statement: I am in no way employed or affiliated with Moirai Myths and I was not approached in any way to make this post. This is me being a feral fan on main, blazing this post)
EDIT:
HELLO EVERYONE! DID YALL KNOW THE KICKSTARTER FOR THIS GAME JUST LAUNCHED TODAY? NOW YOU DO! MORE DETAILS AND MORE FUN TO BE HAD!
They’re doing voice acting reveals this month, along with an early bird special to see blushing/flirty emotes!
EDIT THE SECOND:
WE HAVE REACHED FULL FUNDING WITH THE GAME! Which is excellent, because it means that my little hyperfixation is gonna be made!
However!
It would be very nice if we could reach some of the stretch goals (which go into depth here: x). Not only are they fun (MC customization, a switch port, expanded voice-over work, more sprites, mini-games, side stories), but I think they'd spark a lot of serotonin for folks playing (myself included).
If this post has interested you at all, please, please, please check out the Kickstarter above! Thank you!
EDIT THE THIRD
Since this is still getting notes beyond my wildest dreams:
Hello! It's been a while! The Kickstarter ended a bit ago (I did not update this post when it did end, due to being ecstatic to how much the project managed to get: 130% funding!), but development is ongoing and strong! The first two routes are in development right now. Please keep tuned at @moiraimyths for official development updates!
4K notes · View notes
goodluckclove · 2 months
Text
You Don't Need an Agent! Publishers That Accept Unsolicited Submissions
I see a few people sayin that you definitely need an agent to get published traditionally. Guess what? That's not remotely true. While an agent can be a very useful tool in finding and negotiating with publishers, going without is not as large of a hurdle as people might make it out to be!
Below is a list of some of the traditional publishers that offer reading periods for agent-less manuscripts. There might be more! Try looking for yourself - I promise it's not that scary!
Albert Whitman & Company: for picture books, middle-grade, and young adult fiction
Hydra (Part of Random House): for mainly LitRPG
Kensington Publishing: for a range of fiction and nonfiction
NCM Publishing: for all genres of fiction (YA included) and nonfiction
Pants of Fire Press: for middle-grade, YA, and adult fiction
Tin House Books: very limited submission period, but a good avenue for fiction, literary fiction, and poetry written by underrepresented communities
Quirk Fiction: offers odd-genre rep for represented and unagented authors. Unsolicited submissions inbox is closed at the moment but this is the page that'll update when it's open, and they produced some pretty big books so I'd keep an eye on this
Persea Books: for lit fiction, creative nonfiction, YA novels, and books focusing on contemporary issues
Baen: considered one of the best known publishers of sci-fi and fantasy. They don't need a history of publication.
Chicago Review Press: only accepting nonfiction at the moment, but maybe someone here writes nonfiction
Acre: for poetry, fiction and nonfiction. Special interest in underrepresented authors. Submission period just passed but for next year!
Coffeehouse Press: for lit fiction, nonfiction, poetry and translation. Reading period closed at time of posting, but keep an eye out
Ig: for queries on literary fiction and political/cultural nonfiction
Schaffner Press: for lit fiction, historical/crime fiction, or short fiction collections (cool)
Feminist Press: for international lit, hybrid memoirs, sci-fi and fantasy fiction especially from BIPOC, queer and trans voices
Evernight Publishing: for erotica. Royalties seem good and their response time is solid
Felony & Mayhem: for literary mystery fiction. Not currently looking for new work, but check back later
This is all what I could find in an hour. And it's not even everything, because I sifted out the expired links, the repeat genres (there are a lot of options for YA and children's authors), and I didn't even include a majority of smaller indie pubs where you can really do that weird shit.
A lot of them want you to query, but that's easy stuff once you figure it out. Lots of guides, and some even say how they want you to do it for them.
Not submitting to a Big 5 Trad Pub House does not make you any less of a writer. If you choose to work with any publishing house it can take a fair bit of weight off your shoulders in terms of design and distribution. You don't have to do it - I'm not - but if that's the way you want to go it's very, very, very possible.
Have a weirder manuscript that you don't think fits? Here's a list of 50 Indie Publishers looking for more experimental works to showcase and sell!
If Random House won't take your work - guess what? Maybe you're too cool for Random House.
331 notes · View notes
uncivilliberties · 7 days
Note
>unfairly banned
>checks internet archive of her blog
>99% of the posts are completely unlabeled pornographic text and fantasies, not even a tag
>checks tumblr guidelines:
"Nudity and other kinds of adult material are generally welcome. We’re not here to judge your art, we just ask that you add a Community Label to your mature content so that people can choose to filter it out of their Dashboard if they prefer. You have the option to add a community label when making a new post, reblogging a post, or editing an existing post. Depending on your content, you can label it as generally mature or choose a specific category such as “Sexual Themes” if your post contains sexually suggestive subject matter."
if you actually give a shit about transfems who are getting harassed left and right then stop martyring people who are getting banned for not labeling NSFW content they post.
and god before anyone tries to have a fit and accuse me of some bullshit, i do not have anything against NSFW, i'm not a puritan asshole, what i DO have an issue with is people posting sexual content without any content labels (yet alone tags) meaning people who don't want to see that content can end up getting exposed to it anyway, even if they've taken the time to filter tags.
What are you fucking talking about? 99%? She posted about music and chatted with friends and made shitposts. It would take an extremely bad faith reading of her blog to find out uniquely objectionable UNLESS you were already inclined to find trans women's existence inherently sexual.
In your reply to this post you accuse her of constantly posting about her kinks and fetishes, helpfully including a link to the Internet archive. Let's take a look, hmmm? Wow, that's a lot of posts about music. In the limited snapshot available at that link I see one (1) masturbation joke that wouldn't even be a blip on the radar if this were anyone else's blog, a goofy ask about breasts that she answered in kind, and a couple of references to being a deergirl. Oh, I see what you mean. The crazy thing about this is that it took one single word to turn it horny. She could have said deer and not deergirl. You absolute dipshit.
"I'm not a puritan asshole, I just wear puritan asshole pants and a big puritan asshole hat and shout puritan asshole bullshit." Even if there was NSFW material somewhere in her history it would still be the thinnest possible excuse for banning her. It would still be blatant selective application of the terms of service weaponized against trans existence. Do we really need a community label on every single dick joke on this site to keep the children safe from harm? Cis people get to make dick jokes with impunity!
"People who don't want to see that content can end up getting exposed to it anyway" This is not the foundation for any sort of moral imperative! This cannot serve as the basis for any sort of course of action! The idea that we need to tag and police and bubble wrap any potentially objectionable thing online is exactly the excuse they are using for KOSA. It's no kink at Pride discourse. It's this post about Pete Buttigieg.
Straight people don't get policed like this. Cis people don't get held to these standards. Are you Staff in a wig and fake nose pretending to be a user supporting their rationale?
246 notes · View notes
tellnotalespod · 9 days
Text
List: Queer creatives to spend your money on instead half-arsed pride merch from Target 🏳️‍🌈🏳️‍⚧️
We're all aware by now that when you buy pride merch from one of Those Companies, your money is just going to a CEO who half-heartedly told someone to slap a rainbow on it and call it a day. So why not use that money to support an actual queer person who’s working hard to make art?
I've collected a(n incomplete) list of queer creatives who would benefit from your support this Pride Month - this is fairly limited in scope, as it only includes creators who responded to my call for links (or whose links were sent by friends & fans). It is also, for that reason, fairly audio-drama-heavy, but not exclusively so! It includes sections for crowdfunds, online stores, ttrpgs, and ko-fis and patreons for creators of a variety of different art forms.
The list is long, but worth a look through. Have a browse, see if anything appeals, and if you'd like to add any links, please do! Share the list around, shout out your friends and peers, boost your favourite artist, and vitally, self-promo is strongly encouraged!
Crowdfund campaigns:
Starting off strong with Forged Bonds @forgedbondspod — A queer, myth-bending audio drama retelling of Aphrodite and Hephaestus's love story.
This one takes pride of place as the inspiration for this post. Pine is working SO hard to make sure their cast gets paid regardless of crowdfunding outcomes, even if that means paying out-of-pocket. Help them avoid having to do that by supporting a truly kind and wonderful creator. (Crowdfund ends in a little over two weeks!)
We've also got a tight time-sensitive crowdfund for Waiting For October @monkeymanproductions — an upcoming queer supernatural audio drama series from the creators of Moonbase Theta, Out.
At the time of posting, they only have 13 hours left on their crowdfund, but they're 93% there! Help them cross the threshold and tell what I'm sure will be another gorgeous and wild story.
And for the horror lovers, a new crowdfund from The Morbid Forest — a deep dive into all things grusesome!
They are hoping to fund their fifth season, and it's looking to be their biggest yet. A lot of what they're asking for will be used to pay guest authors they're bringing in for the new season, allowing platforms for up-and-coming writers. Help them make this a reality!
All three of these creators also have Patreons you can subscribe to instead of (or in addition to!) their crowdfund: Pine Tree Pods, Monkeyman Productions, Morbid Forest
Buy yourself a little treat:
Saph the Something creates ethically handmade clothes made with vintage materials by a non-binary queer individual, with an emphasis on non-default clothes for non-default people.
You can find Saph's physical goods on xaer ko-fi (including a GORGEOUS loose-knit subtle trans flag tee)! Or support xem on Patreon for early access to content, behind-the-scenes updates, and more
For prints and pins of some truly stunning art, visit Survival of the Artist's ko-fi!
If you love gorgeous, unsettling underwater horror, you're going to absolutely love these prints
Eeler's Choice @eelerschoice is offering their season 1 soundtrack on Bandcamp!
Eeler’s Choice is a maritime horror fantasy podcast that serves as a reminder that the ocean never gives back what it takes unchanged. The music is GORGEOUS and if you love sea shanties, folk music, and eerie ambient instrumentals, you'll love this album.
They also have merch on sale, the logo sweatshirt is one of the best things I own
Pyon is an afro-latino freelance artist, writer, designer, and indie game developer
He is currently working on a visual novel magical girl project, @magicalwarriordiamondheart and you can buy prints, plushies, apparrel, charms and more from their store (or support him on Ko-fi!)
Xan Larson is an Illustrator, Comic Artist and Content Creator with a specialty and marked enthusiasm for mythological creatures of all kinds and all cultures.
She offers a huge range of treats on her website, including art prints (& original paintings), resin art, and books
Dylan Birtolo is a writer, a gamer, and a professional sword-swinger
Dylan has a huge number of books on offer, primarily fantasy, including anthologies, novellas, and novels.
TTRPGs galore:
(these also fall under the little treat category, but there were so many that I felt they needed their own section)
Sunken Rust are a game company run by married couple Dave Eisinger and Jazz Eisinger, and they offer a range of absolutely delightful TTRPGs, ranging from a wholesome GBBO-inspired micro RPG, to a solo journaling game about exploring an abandoned mansion.
Tea Witch Games is run by Anna Landin, a queer Swedish illustrator, comic artist and game designer. She offers games that run the gamut from sweet and cozy to weird, sad and spooky.
K. Petker offers games from wonderfully unique perspecitves including heroines of the princess council, children facing the apocalypse, and cats protecting their humans from the supernatural.
Christine Prevas is a writer, designer, PhD student & erstwhile librarian offering TTRPGs that range from two-player steamy horror to theatrical tragedy, and more.
Unseeliejess is a game designer and social worker, and my personal favourites from her offerings include Oops! All Draculas! and multiple sapphic-focused TTRPGs
Thoughty is run by Beau Jágr Sheldon, including innovative TTRPGs in a range of formats, as well as some games that break away from the table entirely.
Riverhouse Games includes a ton of fun concepts, including a micro-game about cleaning your kitchen and a game about telling your hot gay (dragon) boyfriend you love him. They also offer a guide to writing your own RPG!
E. Chris Garrison is the proprietor of Chris's Compendium of Free RPGs, one of the oldest game repositories on the web. They are also the designer of Saving People / Hunting Things, a TTRPG inspired by monster-of-the-week style television shows such as Buffy the Vampire Slayer, Angel, and Supernatural. They also have a ton of fantasy, supernatural, and sci-fi books on offer
Handsofblue offers a campy horror game about awful people and a serial killer, and a solo knitting game
Drazillion is an award-winning narrative designer, writer, and artist, offering a huge portfolio of games with a strong focus on queer narratives and themes. You can also support her on Patreon
Patreons & Ko-Fis:
Finally we have some ways to directly support the creators you love or their ongoing projects!
Soul Operator @souloperatorpod is a multi-genre fiction podcast, created to highlight solo ttrpgs.
If you haven't listened yet, you absolutely should - this show will rip out your heart and you'll be grateful for it. Support them for behind-the-scenes content, exclusive short stories, and more
Divine Rodentia Studios @divinerodentiastudios is releasing a new fiction anthology audio drama, Sixth Door to the Left
This is some truly intriguing and wonderful storytelling, and you can support them through the development of their upcoming project, The Loser's Game.
YamiKakyuu @yamikakyuu is a writer, photographer, amateur digital artist, and horror podcast enthusiast.
Supporting them will help an up-and-coming voice actor invest in decent equipment (a huge barrier to so many incredibly talented VAs breaking into the industry!)
Daisy McNamara is an *incredibly prolific* podcaster, the co-creator of Eeler's Choice and Waterlogged, and has contributed his talents to so many more
Daisy has made such a huge contribution to the audio drama world, so if you've listened to any podcasts to speak of, you've probably enjoyed some of her work. Your support can help him make ends meet and continue creating!
And finally (because I fave a few pals who'd kill me dead if I didn't do a bit of self-promo), I'm Leanne Egan, the creator of Tell No Tales, an audio drama about ghosts and the people who refuse to hunt them. While there is currently no way to support the show financially, my debut novel, Lover Birds, releases soon!
As a bonus, if you're in the UK, you can pre-order it from a North-West-based queer indie bookshop too!
Tumblr media
192 notes · View notes