#and i am specifically not including neurodivergence in this because many of these spaces are openly welcome to neurodivergence
We need to talk about how so many queer spaces are inaccessible and even actively hostile to physically disabled people.
8K notes
·
View notes
as someone who has been scarred for life by experiences at gay bars, i need people to understand it's beyond tacky to mock people who want queer spaces beyond queer bars- it's dangerous.
let me explain. i went to 2 of my local queer bars a lot last year, as much as i was able to despite being poor. i witnessed a fist fight that was so bloody that ended up with a transmisogynistic drag queen getting hit in the head with a metal baton. the sight caused me to uncontrollably throw up in the bathroom of the club because of how gruesome it was. they had to close down the club and forard people out the back door because of how out of hand this person got- he was screaming transmisogynstic slurs and phrases at the bouncers were were transfem.
i was also sexually assaulted at these places, i was repeatedly groped by several people who i was not interacting with in the first place who found me attractive and decided physically grabbing me on numerous occasions was the way to get my attention. being femme in a queer bar is dangerous even if the people groping you are gay men.
i am also a recovering addict who dealt with alcohol issues in the past and could be considered a recovering alcoholic. i don't want to be around alcohol. i don't want to smell it. it triggers awful memories and also sometimes makes me consider getting a drink, but i can't have one, because the medications i take will cause a fatal reaction- i don't want to be tempted to drink, because it will kill me.
it's not right to mock someone or call them childish or whatever for not wanting to go to a club. whenever alcohol is involved, people's inhibitions are gone and they will do whatever. this includes fighting. i witnessed several other fights. just because it's a queer bar doesn't mean there won't be fights. and it especialyl doesn't m ean that you won't get groped or assaulted because, like i said, since alcohol is involved and it's a bar, there's a high chance this can and will happen.
queer people are not inherently safe angels to be around by virtue of being queer. there are still transphobes in queer bars. tranny chasers come to these bars. homophobic lesbians show up and lesbophobic gay men show up. drag queens and performers bring their cishet friends and family to support their shows. these are not perfect havens. they are not safe. we should not force other queers to interact with inherently dangerous spaces if these are supposed to be our safe spaces.
also these spaces are not friendly to people with disabilities; wheelchair users have nowhere to go especially when it's very crowded. other mobility aids get kicked and knocked over. neurodivergent people can get overstimulated by the deafening music very quickly. photosensitive people can have seizures due to the strobing lights. people with emetophobia like me run the risk of running into those types of triggers. people who are overstimulated by intoxicated people have no choice but to deal with it. dancing is one of the only activities to do other than drink and not many disabled (or even abled) people can dance for extended periods of time comfortably.
not to mention these spaces are not geared toward aromantic or asexual people at all, either. there is a long list of reasons why bars should not be our primary venues of interaction with one another. they serve a specific purpose- for people who want to cruise- but for the rest of us, it's really crucial that we have spaces that provide meaningful interactions with other queers on other levels of our identities.
some people just want to hang out with other queers in a quiet environment and craft, or shop, or drink coffee, or read books together, or just about any other activity on planet earth, and that's not "lame" or "cringy" or bad in any way- these are extremely normal and necessary parts of human interaction that we all require and crave and it's normal to want to do healthy, domestic things with other queers. we need this in our lives.
please take it seriously when people attempt to create queer spaces that don't involve alcohol and bars. it's necessary for our survival and well being as a community.
2K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Is there a reason you didn't include an acknowledgements section in Camp Damascus?
yes actually, as man name of chuck i have spent a lot of time FINDING MY IDENTITY through masking and unmasking. in early days there were many more layers hiding me away and it took a while for me to understand WHY. over the last ten years buckaroos have very much seen me find myself through art, accepting and talking about my sexuality, neurodivergence, and gender.
there is ALWAYS a layer to protect my privacy, and to allow myself room for POETRY. example i like to give is that if i post 'i pet a dog today' i might have actually pet a cat, but everything i say is true is some sense. in the early days that truth was stretched farther because even i did not quite understand it my dang self, and it has been my journey to strip away as much of this mask as possible (sometimes called removing my skin) and BECOME MYSELF on this timeline (which is something i have always talked about)
if you have been following chuck for the last decade you will see my older posts were much more abstract and difficult to parse, they reference themes that i have since come to terms with, and this journey to find myself is WHY i have been able to do this. some could say it was the journey of a reverse twin adapting to their new timeline, others could say it was the journey of a neurodivergent artist allowing themselves the freedom to find a healthy expression and conquer their chronic pain from constant neurotypical masking.
FOR INSTANCE this is why i am wearing buckaroo suits on tour now, an outfit that is more true to the INNER ME. i used to answer interview questions with metaphor and now i just answer, only hiding certain details when i need to. i talk less about figures in my life back in billings who were REAL IDEAS and PARTS OF MYSELF but sometimes not flesh and blood or ghostly buckaroos. this is my trot, and this is why i am so strongly against gatekeepers in the buckaroo community. i have been becoming myself long before i knew what that meant.
so when it came time for acknowledgments i realized i would have to acknowledge buckaroos who helped along the way but also ABSTRACT IDEAS who helped along the way, symbols and themes that i have since decided i wanted to leave behind. it was important to me to create a new era of my expression where those abstract layers are respected but also stripped away. i have to respect the inner truth i am trying to cultivate, for way of my mental health and also my physical health.
so i DID write out acknowledgments and sent them to my buckaroos privately, then i said please do not include this in the public book. these days i want to hide behind as few layers as possible, that is my artistic journey now. buckaroos were very respectful and supportive.
very quick before we finish, there was one other small and important reason. i am so sincere ALL the dang time it is kind of my natural state to get very emotional and thankful, that i kinda thought 'i am going to give myself space here to NOT stress out over this for once'. i am constantly thinking about acknowledging others and i LOVE this part of my trot, but doing it in a way that is so defined and specific and maybe even performative (gotta write your acknowledgments now bud. HAVE to do it) felt at odds with my inner way.
anyway thank you for this very good question what a dang treat to talk about this detail and how much it means to me to find truth in my inner trot.
903 notes
·
View notes
(**Warning: Spoilers for the OFMD 2 season finale follow. Read at your own risk.)
I've just watched the finale of season 2 of Our Flag Means Death, and it has stirred a lot of thoughts and feelings in me (as it has many of us, unquestionably). I had initially planned to include some of these thoughts in my review of GO 2 (which I still have not written), but the death of Izzy Hands (Con O'Neill) has brought back some of the feelings I had a few months ago, so I'd like to talk about the theme of ableism in GO 2 and OFMD.
Since the first season, Izzy Hands has seemingly been a polarizing figure, but there has been a clear emotional resonance on the part of fans toward him, and especially now in season 2. To have his arc and "redemption" come in such an ignominious fashion certainly feels like a slap in the face to those fans. I would characterize myself as "Izzy neutral" (that is, I did not hate him, but I didn't necessarily feel a deep connection to him, either), but what troubles me is how Izzy was ultimately treated as a disabled character.
Earlier in episode 8, the Revenge crew is jailed, and Prince Ricky pulls Izzy out of the cell to have a drink, and during this exchange Izzy says this line, which we had previously heard in one of the trailers:
It was Izzy who the writers/creative team specifically chose to have say this line, and because of that, I find it very difficult to swallow the idea that he was the one character who was later killed. That in the end, the character who speaks about belonging is the one who doesn't get to belong. As if he was there to further Ed's storyline, to be an object lesson for him, and was then disposable after that.
Further compounding the issue was the crew using Izzy's prosthetic leg as a grave marker (presumably under the assumption that he no longer needed it). But for many disabled people, prostheses and wheelchairs and other accommodations are what help us thrive in the world and are part of who we are, so to me, taking that away from him inadvertently diminished how complex and multifaceted Izzy had become as a character and seemingly reduced him to little more than a mascot.
As a person on the autism spectrum who works in the field of disability, Izzy's line about belonging resonated with me extremely deeply. For many of us who are neurodivergent or disabled, this is the stuff of our everyday lives--being told through childhood, adolescence, and even adulthood that we are nothing, and that our lives do not have value. I spent so many years searching for that sense of belonging, to know that I had a place in the world, and it was not something anyone could give to me, but something I had to fight for. To make that space, because no one else would.
As I've said before, while I have watched both shows, I am far more into and emotionally connected to GO than OFMD. This leads me to GO season 2, and the parallels to this that I saw there. In GO 2, we have the character of Saraqael (Liz Carr), who is an angel that uses a wheelchair (as does the actor who plays them). It's shown in one of the episodes that Saraqael's power is to miracle wheelchair ramps everywhere they go, and in nearly all of the reviews and articles I've read about the second season, this trait is met with widespread praise.
But to me it mirrored precisely what we see in real life--that is, that the burden of accessibility is often placed on disabled people ourselves. I would have loved to have seen one of the able-bodied angels have not only the power, but the desire to create those ramps. It was disheartening to me to think that even in a seemingly ideal place like Heaven (although we know it certainly isn't), it is the disabled character who has to create a place for themselves.
The character choices around Saraqael and Izzy are something I would describe as benevolent ableism, in that while no harm was likely intended, it still reinforces long-ingrained prejudices and ideas about disability. There is so much intersectionality between queerness and disability as well, and so it is disappointing to see an opportunity to have that idea of "belonging" encompass every character only encompass certain characters instead.
I truly think this will only change if and when we have disabled people behind the camera as well as in front of it. And I hope that day comes sooner rather than later so that all of the fans who see themselves in Izzy or Saraqael are not left feeling the way they do now...
118 notes
·
View notes
Azi’s Zim is Disabled Essay
So there are a lot of different interpretations about Zim being defective that exist. There are a lot of interpretations about what it means to be defective in the first place. I would like to propose that being defective, not only relates to neurodivergence and “non-desirable” behavior (anything that goes against the Irken regime) but also certain physical disabilities, in specific chronic illnesses.
I would like to draw a line here because I firmly believe that the Irken Empire would not give a shit about limb differences. They are technologically advanced (even if their technology is mostly stolen from other species) so, to them, it would be entirely cosmetic and one could simply get cybernetics. However, a problem with the body’s systems cannot be as easily addressed. Thus, Irkens with conditions, like these would be considered defective. Due to their condition, they cannot contribute in the same way as others if they can contribute at all. They would be considered a liability. That’s right, the space fascists are probably also eugenicists (shocking no one). I mean seriously, that’s pretty easy to see. They literally genetically engineer their own people to near perfection.
The only way for a genetic issue like this to happen with the way smeets are made would be because of some kind of cloning error. Anyone reading this probably knows that a popular headcanon about Zim is that he is the product of some kind of cloning error. This is a headcanon that I agree with. So, if Zim is the product of a cloning error what saying that he doesn’t have some kind of invisible disability like a chronic illness.
Putting the lore side, when you look at the Irken Empire, as a satirical representation of America, its greed, its disregard for citizens, and its imperialism, having Zim be disabled makes thematic sense. Zim is actively disregarded by and pushed out of Irken society, many people tend to interpret this as Zim being autistic or another neurodivergent parallel, which I agree with. However, why not take this a step further, why not make a Zim physically disabled?
The closest thing within fandom spaces that I’ve seen to interpreting Zim as disabled, is making Zim autistic or deaf/hard of hearing. However, when this is written it usually has little to no bearing on the plot of whatever is being written. It is almost always a superficial detail of some kind like the occasional mention of Zim having a hard time hearing something, not understanding subtext, or wearing a hearing aid.
I don’t think this is a problem within the Invader Zim fandom; I am well aware that there is just not much fic about disabled characters in which they are actively discussed as being disabled or their disability is important to the plot in some way. I am not blaming anyone for this issue, it’s just the fact that not many people write disabled characters. I think this problem mostly comes from the fact that people are scared of messing it up. Quick message: if you think that you have a good writing idea that involves a disabled character, make sure you do your research, but fucking write it! Even if they aren’t anywhere close to implied to being disabled in canon. What is the point of fanfiction if not to give fans the space to interpret the character however they please?
Apologies for the tangent but it was important. I’m going to shift the topic a bit, onto examining a symptom of chronic illness that I see in Zim within the canon. Specifically, I think that it explains one of the main inconsistencies in Zim’s character.
Many people including myself have noticed the fact that Zim is simultaneously very smart, but also very incompetent at times. This seems to be a contradiction because someone as smart as he is shown to be, logically, shouldn’t be making some of the mistakes that he does within the canon. And I have a plausible solution to this: brain fog. Brain fog is an overarching name for a collection of symptoms that includes an inability to focus and concentrate, confusion, unusually inhibited logic skills, feeling disoriented, as well as trouble remembering and comprehending information. If Zim was intermittently experiencing these symptoms, the inconsistency of him being simultaneously a genius and on many occasions almost completely incompetent would be explained. Brain fog is a symptom of a lot of different things, personally, I interpret it as chronic pain and immunodeficiency for my Zim headcanons and my AU.
Being able to deep dive into Fem Zim’s experience with her disability as she continues her story is important to me. Describing her chronic pain is important to me. Not having a fix for her condition is important to me. Having a character that is not just disabled, but who talks about their disability, has prose dedicated to their symptoms, and has it as an important part of their character building and development is something that I do not see. Let alone anyone with a similar condition to me. Zim is that character for me, whether it’s me going into specifics about Fem Zim’s symptoms within my own AU, or me as a kid, first getting into Invader Zim, and seeing so much of myself in Zim as a character.
You can interpret Zim however you want, I’m not telling you what to do. But I would like to point out that this is an entirely underutilized interpretation that in a fandom that has existed for over 20 years know I do not know of any other genuine instance of.
My only explanation for that is that y'all are cowards. /j
28 notes
·
View notes
helloo :)
i’m new to your blog and I really like it! i saw that ur open to asks?
there’s been something on my mind recently. i appreciate any advice you have.
for some time now, there have been a lot of derogatory autism-jokes, misinformation, stereotypes circulating around my school. as part of a “c.a.s” related venture (service-as-action towards my community), I want to do something about this, as it’s really bothering me.
as to why it’s bothering me, im really affected by injustice and ignorance in the world, it’s something I find hard to let go of. and I think I might be audhd or in some way neurodivergent and I guess advocating/learning about neurodiversity has become one of my special interests.
all that aside, I’m unsure how to approach this. I feel like simply holding a “psa” that explains what autism is and de-bunks stereotypes isn’t realistically going to help change the minds of a bunch of teenagers and stop the hate. What can I actually do by myself to create change in some manner?
tysmm:) (also, if you can see my username, id appreciate it if it wasn’t shared with your audience.)
Greetings & I thank you from the bottom of my heart for your incredible ask. /g
The world needs more awareness & more non-ableist information about autism & we need to stop the hate & injustice & ignorance against us. Not all autistic people are able to raise their voices against the system because of many reasons, which is why we have to stand together as a whole - including every autistic person, taking different perspectives in (e.g. non-speaking autistics are often excluded, which is SO wrong in SO MANY ways). I could write another million words about it.
Yes, I think simply giving a lecture is not the solution to get heard & listened to. It's difficult to give a specific advice here, but if you are already part of a group that wants to change something or at least give support - that's something.
If you are autistic & safe 'to be like you are', consider the following, because that is what I do.
Unmask your traits, explore them & express them. TAKE UP SPACE. Be open with your struggles, respect your way of being & your way of experiencing the world. It's hard work, even if you are supported. //I was not supported & I was not able to disclose that I am autistic at first & I still am not able to publicly, but I still try to advocate for my needs & try to build my confidence.//
Talk about your traits. Start a blog online about it. If you can, raise awareness in some way, like I do. It can comfort others & maybe inspire (that is what I wish for with my work). If you can't do that (which is totally valid), support the people who do so, share their work. Also do tons of research, get as much knowledge as you can so you can fight stereotypes.
If you want to support us, work with us. Support us. Stop hate & bullying when you see it. Stop negative talk about autism when you hear it. Make existing ableism visible.
Also, if you want to support us & you're not autistic yourself:
Respect our need for accomodations & reasonable adjustments
Support us & RESPECT US when we are not masking, support & respect the ones who can't mask, the ones that are non-verbal, the ones with other disabilities - RESPECT THE WHOLE SPECTRUM
Support us when we can't work or be 'productive'
Listen to us & believe us when we tell about our experiences
Support us when we struggle to communicate, when we miss cues & don't assume we're rude
Do not belittle us, regardless of how high our support needs is - they can change from day to day
Do not JUDGE us for not living according to the standard allistics are used to.
Instead, try to make the world more accessible for us.
I hope I was able to give some input! (I definitely haven't covered all)
23 notes
·
View notes
✰ Catgender - Xenogender Bookshelf ✰
Catgender is a Xenogender that relates to cats! Its great for Alterhumans/Therians/otherkin who have a catkin and it also relates to their gender, and also great for neurodivergent people who have trouble talking about their gender! Some great neopronouns for pretty much any catgender are:
✰ Meow/meowself
✰ Purr/Purrself
✰ Paw/Pawself
✰ Feline/Felineself
✰ Whisker/Whiskerself
✰ Claw/Clawself
✰ Mew/Purr/Purrs/Mewself
✰ Nya/Nyaself
✰ Mew/Mewself
Catgender was coined in 2014, and the original flag was made by DeviantArt user PN-TME in 2019. The only source I could find on the original coiner of Catgender is this one link to a site about Catgender:
https://catgender.carrd.co
The mainstream flag that I see mostly everywhere is this flag:
Which in the carrd about cat-gender, it is said that the creator of the flag is Kai or @HUENlNGWAY on twitter. However I cannot confirm this.
There are other Catgender flags! Which were made to be more inclusive! Pawprint Design by EggHeggley;
⋅•⋅⊰∙∘☽ The Diversity with Catgender ☾∘∙⊱⋅•⋅
This is the main reason I made this post, because the fun thing with Catgender [and many other genders like it that are broad] is that there are many different versions of it, combining multiple genders together to make different ones. I find this very interesting mostly for the fact that you can start to see a trend with the broader animal-themed genders and the categories in it.
Another interesting pattern when looking at cattic/catgenders is that many people have the same catgender but with different flags!
I tried my best to put as many as I could find, I am using Pintrest, Tumblr, Tiktok and Instagram to find these flags + genders! Everyone's tags include which platform they are from!
✰If I am missing any, feel free to let me know!! ✰
Here is a list of as many of the cat-genders/Cattics I could find that may be useful to those who identify with cat gender!
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽DemicatGender☾∘∙⊱⋅•⋅
✰ A Gender who feel partially connected to cats [similar to Demiboy/demigirl except with Catgender]
✰ Flags made by snotdrip and Glitchywitch
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽TranscatGender☾∘∙⊱⋅•⋅
✰ A Gender for those who are trans but also indenitfy as catgender!
✰ Flag made by @tiredryota on pintrest
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽CozyGender☾∘∙⊱⋅•⋅
✰ "this gender is related to the feeling of a cat curled up into a ball listening to the rain fall outside as the scent of freshly brewed tea fills the room"
✰ Flag made and Coined by @basil3 on Here!
✰ Some great Neopronouns for this are Cloud/Cloudself; Soft/Softself; Tea/Teaself; Cozy/Cozyself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Suncatic/Suncatgender☾∘∙⊱⋅•⋅
✰ "a gender related to the sun, or any sun-related character and cats"
✰ Flag made and Coined by @obsessedwithicecream on pintrest
✰ Some great Neopronouns for this are sun/sunself; sunny/sunnyself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Mooncatic/Mooncatgender☾∘∙⊱⋅•⋅
✰ "a gender related to the moon, or any moon-related character and cats"
✰ Flag made and Coined by @obsessedwithicecream on pintrest
✰ Some great Neopronouns for this are moon/moonself; moony/moonyself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Starrycatic☾∘∙⊱⋅•⋅
✰ "A xenogender associated with stars, light up objects, and cats"
✰ Coined by @_kiko.chip_ on TikTok
✰ Some great Neopronouns for this are Star/Starself; Starry/Starryself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Lumicatic☾∘∙⊱⋅•⋅
✰ "A xenogender, faunagender and subset of catgender for those who have a deep connection to stars, cloudy night skies, space, celestial bodies, cats, galaxies, and the universe as a whole. For when you feel a connection to outer space and cats, or your gender can be described as a celestial cat. This gender is specifically not related to aliens"
✰ Coined by Snuggly Bun on here!
✰ Some great Neopronouns for this are Star/Starself; Starry/Starryself; Space/Spaceself; Gala/Galaxyself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Quacatic☾∘∙⊱⋅•⋅
✰ "a catgender connecting to cats, the feeling of not knowing, questioning and unsurity"
✰ Coined by @yoeakj on pintrest!
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Calicocatic☾∘∙⊱⋅•⋅
✰ "a catgender connected to calico cats"
✰ Coined by @yoeakj on pintrest!
✰ Some great Neopronouns for this are Cali/Calico/Calicoself; Spots/spotself; splotch/Splotchself; Multi/Multiself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Creadilic☾∘∙⊱⋅•⋅
✰ "a catgender that is connected to cats and bread"
✰ Coined by @yoeakj on pintrest!
✰ Some great Neopronouns for this are Bread/Breadself; Rise/Riseself; Flour/Flourself; Gluten/Glutenself; Ba/Bak/Bakeself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Gintilic☾∘∙⊱⋅•⋅
✰ "a catgender connecting to ginger tabby cats"
✰ Coined by @yoeakj on pintrest!
✰ Some great Neopronouns for this are tabby/tabbyself; orange/orangeself;
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽CatMillic☾∘∙⊱⋅•⋅
✰ "a catgender that is connected to cats and milk"
✰ Coined by @yoeakj on pintrest!
✰ Some great Neopronouns for this are Milk/Milkself; Dairy/Dairyself;
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Cinterlic☾∘∙⊱⋅•⋅
✰ "A catgender that connects to cats, harsh winters, snowflakes, frost, and snow"
✰ Coined by @yoeakj on pintrest!
✰ Some great Neopronouns for this are Winter/Winterself; Snow/Snowself; Ice/Iceself; Cold/Coldself; Frost/Frostself
✦•····················•✦•····················•✦
⋅•⋅⊰∙∘☽Cattpring☾∘∙⊱⋅•⋅
✰ "a catgender connected to cats and the feel of spring and spring flowers"
✰ Coined by @yoeakj on pintrest!
✰ Some great Neopronouns for this are Spring/Springself; Grass/Grasself; Flower/Flowerself; Pollen/Pollenself
✦•····················•✦•····················•✦
⋅•⊰∘☽More Cattics in the next part!!☾∘⊱•⋅
First ✰ Next ✰ Prev ✰ Last
12 notes
·
View notes
PDA Has No Place Within Neurodiversity
Something you’re likely to come across in online autistic self-advocacy spaces is PDA-otherwise known as pathological demand avoidance, or to some, pervasive demand for autonomy. This is not a new idea-in fact, it has been present in the field of psychology since at least the 1980s, before the neurodiversity movement began in earnest. You can see discussion of PDA in autistic spaces from the late 90s-including skepticism of the idea. It is not an official diagnosis listed in the DSM or the ICD. Some people want it to be. It is considered by some to be part of the autism diagnosis, much like PDD-NOS and Asperger’s, which used to be separate diagnoses in the DSM-IV. I’m unsure whether these advocates wish for PDA to be like that or for it to appear under autism. I think either way, it is not a good idea. There are several reasons why I am against the idea of PDA. I think the condition itself is too broad and more importantly, I am afraid of the implications behind it.
The way I see PDA described leaves open a lot of room for interpretation. This could lead to an overdiagnosis (or false diagnosis altogether), though that’s not so much of a concern of mine as it is that there are many reasons why someone may refuse demands or ignore obligations. It could be as simple as executive dysfunction-which I believe is diagnostic criteria for autism and ADHD. People describe PDA as extreme anxiety someone feels when given a task to complete. Again, there are several possible explanations for this behavior-simply chalking it up to “PDA” doesn’t really tell you much. Ok, someone tends to avoid demands-perhaps to a disabling degree-but I feel like the reason for that goes much deeper than just calling it PDA. A lot of things I do probably qualify as PDA to those who believe in it. I have a harder time than most staying on task or starting something I have to do. Also, no, framing it as a “pervasive demand for autonomy” does not change anything. If I don’t want to do something I’m asked to do, it’s definitely not because I only ever do things I want to do. It can sometimes mean that, but it still hardly qualifies as “PDA”. So this leads me to my next point, the implications of PDA.
There are two main concerns I have with the implications behind a PDA diagnosis or label. Not only do I think it’s not specific enough, I am worried about how people use it as an excuse for genuinely shitty behavior. While this does happen with a number of disabilities, including autism, the broadness of PDA, as I previously described, only accentuates this. I’ve already seen it happen. I’ve seen somebody accuse people for their “PDA acting up” simply for not addressing an issue to their satisfaction. That leads me to the second issue-how staff could (and likely already do) use it against people in their care. Pathologization already leads to this in institutional settings. If, hypothetically, someone with a diagnosis of PDA doesn’t stick to their behavior plan, or generally just doesn’t follow directions, the staff could just shrug it off as PDA instead of thinking more critically about the actual cause of their behavior. Alternatively, they could use that against them. This is far from an unrealistic expectation. This already happens with other disabilities. This would just make it worse. Calling it a “pervasive demand for autonomy” would yield the same result. This is also the issue with Cluster B Personality Disorders, which are actual diagnoses. The psychiatric system exists to pathologize and strip people of their self-determination. This isn’t to say the entire DSM is invalid-just that there's a severe power imbalance at play here.
There are traits that are distinctively neurodivergent. Even then, just chalking behaviors up to diagnosis is unhelpful. However, there’s enough evidence that a neurodivergent brain works differently from a neurotypical brain to justify calling it autism, ADHD, tourettes, etc. PDA is not that. It reeks of Asperger’s and PDD-NOS. I thought we were done using Asperger’s? Apparently the only reason why many people don’t like Asperger’s is simply because of Hans Asperger possibly being a nazi and not for the actual issue with it-which was the false sense of hierarchy and separatism that came with it. Supporting the use of PDA is proof of that.
21 notes
·
View notes
Masterlist of Fandom Playlists
as a neurodivergent person, i literally can’t write if the vibes of what i’m listening to isn’t on point, so i thought i’d share a few of my fandom playlists down below! some of them are specific to fics, others are certain relationships, some are purely vibes. i’ve included links to all of them, just click on the title. welcome to the chaos that is my mind
there was an idea
this one is just vibes tm. songs that i listen to when i’m picturing fights or action. i named it after the avengers because i liked the way it sounded, and i generally like the mcu’s music choices.
it's angst hours baby
these songs just put me in the mood to ruin someone's life.
ethereally eldritch
this one’s still under pretty heavy construction, but when it’s finished i want it to be a Danny Phantom inspired playlist that’s a bit spooky. i’m going for grungy, spooky, punk vibes.
i've learned to love falling
this one is a Dick Grayson character playlist. i just wanted to add some songs that remind me of him/his vibes. think abba, Britney Spears, and a little bit of punk pop.
i'm the most cutest girl in the world
a Paulina Sanchez playlist!!! i love her so much and i realized i didn't have many 'bad bitch' playlists, so it felt fitting. this is a lot of female artists, mostly pop and rap. however, i have thought about adding some 'bubblegrunge.' thoughts?
i’ve been bamboozled (into loving you)
an Anger Management (Jazz Fenton/Jason Todd) playlist <3 basically a lot of the songs that remind me of their relationship or that i think fit their vibes.
👑Space Princess💫
a Space Princess (Dani Phantom/Mar’i Grayson) playlist, because i am so soft for them. it’s a soft sapphic playlist that’s just as lovely as my favorite girls
🏹Trick Shot💘
i will admit, this one started off as Dani Phantom/Lian Harper, but at some point became more of a sapphic modern disco playlist. it still have light, fun vibes that i associate with them though.
👑 Crowns & Clowns 💗
now we’re getting into the fic specific playlists. this playlist is a BIG spoiler for my fic “The Princess and the Outlaws” so listen at your own risk. basically all the chapter titles for that fic are different Taylor Swift songs and they’re on that playlist. past those songs, we get into more vibes territory. this playlist in particular has a few different sections since it deals with the polycule Jazz Fenton/Jason Todd/Roy Harper/Koriand’r. the first section being chapter titles obviously, the next being songs about their relationship, then songs they would sing to/about their partners, then a girl power section because Kori and Jazz kick ass, and lastly non-romantic songs that give off their group vibes.
Blush Bobbin
this playlist is specifically for my fic "hitting pitch black streets with pink clad heart beats." it's mostly Panic at the Disco, Fall Out Boy, and Matt Maeson right now, but i want to add some more to it eventually. fun fact, i named the playlist that because a group of robins can be called a Blush or a Bobbin, among other things.
Bellflower Manor
this playlist goes along with a fic i'm cowriting called "Brides, Birds, and Batshit Family Matters." if you know, you know.
forgotten kids
this is a grungier Dani/Lian playlist for a fic i'm planning "Urban Legends are Warnings from the Dead." it's meant to be a bit spooky, a bit grungy, a bit hopeful---because what is Gotham if not full of hope?
Gotham Academy
this playlist is also specific to my fic “Wisteria” which is a dp/dc dark academia au. it’s a mixture between dark academia, dark forest, investigation, spooky, magical, grungy, gay vibes. it’s doing a lot right now, and i might go back and edit it sometime some.
❤️🔥let me show you power💋♟
this. playlist. okay, so it’s specific to the dp/dc leverage au i’m working on but bare with me. it’s punk, punk pop, angry feminine, anti-hero vibes. it’s about manipulation and being alluring, and falling in love somewhere along the way. i rather like this one as you can tell lol.
alt universe
so, this playlist was actually made for a fic i started a long time ago “See the Light.” i’m not currently working on it, but i really like the concept so i’ll probably revisit it one day. it’s alternative, dark vibes, very much so focusing on the dark parts of the fic. it’s probably one of my favorite playlists i’ve every made, the songs just hit in or out of context.
🕊prettybird🌷
this playlist was made specifically for my very indulgent Batfam/Charmed (1998) au. it’s based on the main pairing of the fic, Dick Grayson/Melinda Halliwell. it’s a lot of love songs, pinning and accidently falling in love vibes, as well as a generous amount of ABBA.
47 notes
·
View notes
what are the physics behind samatfoe's magic system
hell yeah...
Thank you for asking! A warning that I am a physics major, and I know a lot of physics, but I am also neurodivergent, my specific flavor of which assumes that everyone knows everything I know. I've tried my best to not let this leak into samatfoe itself, but since this is a specific discussion of the physics of samatfoe, I might not be able to adequately explain everything. If you are confused, just know that is another opportunity for me to explain my special interest.
I also allude to this but don't explicitly say a lot of it in samatfoe, because it's really dense and nerdy. You have been warned.
So. Magic, in itself, is energy, specifically moldable low-entropy energy, flowing from a place where there is infinite energy to samatfoe's multiverse. So, what does that mean? Well, we're going to have to define energy.
Uh.
Dictionary.com defines energy as "the capacity or power to do work" which is absolutely worthless to people who don't know what physics-flavored work is. Which is just about everyone, including a lot of people who have a passing familiarity with physics. And physicists ourselves have a really difficult time explaining energy to laymen. Energy is... the ability to move things, to change things, to make things happen. Now, it is not weird luminescent semi-matter like a lot of sci-fi likes to claim, but matter itself is really, really condensed energy, so remember that, 'cause it'll be important later.
As for having low entropy, that's also hard to explain. Entropy is also a common buzzword in sci-fi, usually in a villainous way because, well, if anything's gonna murder the universe, it's gonna be entropy. But what entropy really is is probability. Every bit of energy in the universe has a probability to be somewhere, but it's far more likely to be in a disordered state than an ordered state, simply because there are so many more disordered states. Like, say we have four dots, moving quickly around a box. It's far more likely for the dots to be in a lose, patternless form akin to this:
than it is for them to be squished together in a perfect square:
But since the perfect square seems more orderly to us, the system is said to be low entropy.
Add in countless little dots and continually increase the size of the box, and we get an increasingly disordered system. Add in fun quantum effects, fundamental forces, and other physics, and you've got the universe! But the thing about entropy is that low entropy isn't necessarily a "better" universe – all the interesting things, like life, happen in the gradient as energy transitions from low to high entropy. So magic starts out with low entropy, and then transitions to high entropy when it's used by people to cast spells.
So we've discussed "energy" and "low-entropy," what is "moldable?" Well, that is a fantasy term I invented. It means the energy that is magic can be manipulated by creatures that have it. And how much they can manipulate is determined by how much energy is in a metaphorical and completely fictional storage space within their souls, and how connected they are to the ultimate magical energy storage space, the Realm of Magic.
The energy in the Realm of Magic is stored as the most energy dense thing in the universe: mass. Mass is derived from energy by the most famous equation in physics: E=mc^2, where E is energy, m is mass, and c is the speed of light, squared. (But notice that this equation solves for energy, not mass. If we rearrange to see how much mass we get from an amount of energy, it's m=E/(c^2)). The speed of light is 299,792,458 m/s, or, more simply, 3*10^8 m/s. That's a big number! And imagine it squared! In order to get just 1 kilogram of matter, we need 9*10^16 Joules of energy, or, in the scientific term, a whole heck of a lot of energy. This is why Toffee can't create mass very well: they do not have 10^16 Joules of energy lying around, much less 9 of those. Star, however, can create storms of miniature narwhals, tiaras, and warnicorns, even without the wand (which supplies magic for an entire dimension). All of those are well over a kilogram. Star is really, really magically powerful.
But Toffee is strategic. They don't create mass, they create light. What is light? Well, it's electromagnetic radiation. What's that? Basically just energy, a wavelike, particle-like oscillation of the electromagnetic field. What's the electromagnetic field? Not important, let's move on. Because light is energy, we can quantify how much energy is required to create it. The energy in a photon is E=hf, where E is energy again, f is the frequency of the light, which is the amount of times it oscillates per second, and h is the Planck's constant. The thing about the frequency of light is that it's usually a large number, visible light is 4*-8*10^14 Hz (1/s). But the thing about Planck's constant is that it is an absolutely minuscule size, at 6.626*10^(-34) Joules/second. Teeny-weeny. So that balances out to 2.65*10^(-19)-5.3*10^(-19) Joules, for a single photon, or unit, of light.
Of course a single photon isn't going to do much, but "only" about 10^14 per second are needed to completely account for the vision of one person. So, about 5.3*10^(-5) Joules per second. Much more sustainable than 10^16 Joules per narwhal (if the narwhals are only 1 kilogram, which is generous!).
But that's not the only thing Toffee can do. They don't create matter, but they can mold it into different shapes. This is basically applying force to objects to move them. For basic things like amplifying the force of a hit, you just increase the kinetic energy, which, given that magic is energy, is easy. 200 Joules of energy applied to a human body by blunt force anywhere is more than enough to kill a human and break your fist, and Toffee probably knows enough biology to be able to reduce that number significantly (and enough Septarian healing to heal their fist quickly). So, again less magically costly.
Septarian healing is a different beast. Sílthéy only has around 10^20 Joules of magic (might change that later, but so far this is what I'm going with!), enough for 10,000 1-kg narwhals over 1,000 years, so she doesn't have nearly enough to ensure septarians can heal themselves, even with the near-100% mass recycling they have going on (the matter from any part of them lost, including blood, is reduced to ashes and everything except the ashes is used to heal them. Very accomplished septarians like Toffee leave only a smudge of ashes behind). So instead she used her magic to set up a link between Septarians and the realm of magic that they could use to heal themselves. This "cheat code" is used often by both Glossaryck and Sílthéy, most notably with the wand, which is the hydrogen bomb to the septarian's coughing baby regeneration. (Yes, if the Butterflys were intelligent, they could make themselves heal as fast as the septarians. Thankfully for the monsters, the queens often forget how unfairly powerful they are, and Glossaryck lets them, because the more the queens feel like they're the underdogs somehow, the less likely they are to realize how unfair the system is.) However, even this setup is magically taxing, because you have to maintain it. It's part of why Glossaryck doesn't have as much magic as Sílthéy, even though they both are incredibly irresponsible with it, he is constantly having to expend literal energy keeping Earth's magic well tied to the wand. So, let this be a lesson to you all: it's incredibly taxing to give your side infinite magic. Don't do it!
(well, it isn't actually infinite magic. that would require an infinite universe, which is not the case. Even if Star and Marcie's dimensions were infinite, which I'm not sure they are, they'd repeat themselves eventually. in the place called The Infinite, however, you can keep going for infinity and never find a perfect repetition of a universe!)
(that being said, The Infinite is not the end. At the end of the Infinite, an understandably difficult place to get to, there is 0/0, which is completely undefined and where the concept of numbers break down. this is where Sílthéy is from)
As for the last thing Toffee is known for, reshaping their weapon, that cost is harder to estimate. The way humans shape rocks is either by hitting them with something and breaking them, or melting them down and trying (and most often failing) to shape the lava. But hypothetically one could move the molecules into a new shape if you had perfect control and knowledge of the structure of the rock, since some rocks are just aggregates jammed together by cementing materials. But this is the limit of how wishy-washy I allow magic to be. It's weird that I have a solid understanding of concepts such as making matter out of thin air and healing instantly from any injury, but I'm like "eh, it's *probably* a thing that works" with a concept as simple as shaping stone. I guess I'm just not a geologist. I should ask my friend about that.
But the last point I'd like to talk about is, of course, how is magic purely based in physics when you've explicitly said that magic is also the emotion and complexity in life ("La Campagne") and that it creates intelligences? Well, discerning reader, this is because magic is not only used by flesh-based monsters and humans, but also by spirits. ("Spirits" being the intermediate stage between a mortal, such as a monster, and a Dragon, such as Sílthéy. Spirits are Dragons in training. Glossaryck is a spirit who is willing to do anything to become a Dragon.) And the most prominent spirit to magic is the Realm of Magic, which obviously has a lot of say in what effect magical energy has on the world. They have a very complex mind that can influence a lot of the world around them. And they are such a sap. They're lonely, so they make more spirits. They're fascinated by complexity, so they make things complex – and interesting. They have a substantial positive effect, which makes their absence in s5 a very bad thing. Both intelligence and emotion are, on some level, based in energy, because energy is everything.
But yeah! Please let me know if there's something I glossed over or that you'd want more info on or that you don't understand at all because I gave a terrible explanation! See you soon for s5!
3 notes
·
View notes
I think it's really important to know that the length of someone's list of diagnoses is generally based on that person consciously deciding how to present it. Like for me I can generally "summarize" with 2-5 labels. I almost never need to list a huge number because not every symptom set is relevant in every situation! It varies greatly based on:
The context of the conversation (I'm going to give a somewhat different list when discussing mental health and neurodivergence than I would talking about chronic illness and healthcare experiences)
Other people's probable knowledge (when talking to other people with Tourette's, I might specify diagnosis change between chronic motor tic disorder and Tourette's syndrome because it has some meaning, but with laypeople I generally just say I have Tourette's; conversely, someone who doesn't have autism might need to have alexithymia specifically explained, while a fellow autistic person may not)
Depth of conversation (if we're getting into specifics I'll likely list specific diagnoses and issues or may briefly mention symptom sets as they become relevant, but if the topic is only brought up in passing I'll use broad terms)
How comfortable I am with the person (I'll sometimes avoid details, specific diagnoses or symptom sets, or listing "too many" things if I don't know the person well or I'm not comfortable giving out that much information)
How well the person already knows me (I might tell a classmate that my neuro issues are acting up, but be more specific with friends about sensory processing, dissociation, thought stopping, etc. because they already know the broader issues they're part of; conversely, I might tell a person I don't know well that I'm having sensory processing issues, but tell friends just that "it's an ADHD/autism day" because they'll know the greater list of what I'm describing)
Those people with huge lists of things are consciously choosing to list that many, and it's usually because it's relevant to the communication
Putting a "little things included" list in their bio to meet people who are similar to them
Talking about comorbidities
Specific disorders or quantity/type of issues is relevant to their life or healthcare experiences
Making a point that this space is going to focus on their disability experiences
Heading off "so what exactly is wrong?" questions or trying to avoid later accusations of suddenly lying because something wasn't disclosed
Weeding out people who will be unpleasant to be around, judgemental about health issues, or just "won't get it"
The difference between "long list of problems" and "short list of problems" is less about how many problems they have and more about how specific they're choosing to be
8 notes
·
View notes
Moon Knight Primer Part Nine
Moon Knight (2016) #1
Prologue, Part I, Part II, Part III, Part IV, Part V, Part VI, Part VII, Part VIII
Ok, so yeah, I am going to divide the issues of Lemire’s run one by one, two by two at the most, at least for the first 10 issues because on one hand, the art, done mostly by Greg Smallwood, is so gorgeous you guys deserve to see as many pages as I can cram here without, you know, posting the whole issue.
On the other… it is so deep, so full of symbolism and different little things that reference the past runs, but twisting them in a way that now, canonically, they have a completely different meaning. So yeah, we’re going to go there.
Now… unfortunately, there’s a little bit of a spoiler I have to give right away or this is going to be as incomprehensible as the comics were for the month to month readers at the time. See, Lemire did a lot of what we saw in the series, specifically in episodes 4 and 5, where at times we couldn’t tell what was real or not. Every time we thought we were back in the real world? Lemire pulled the rug from under the Moon System and our feet!
So yeah, everything that we’re going to see now, and up until I say otherwise? Is happening in the Moon System’s headspace, so we’re going to get to know them pretty well. This means that a lot of the secondary characters who do reappear, such as Jean Paul (Frenchie), Gena, Crawley, and yes, Marlene, can sometimes act very out of character but that is because we’re not seeing the real people, we’re seeing the way in which the System sees them (Which also explains why some of them disappear when a specific Alter is fronting. If that Alter has no real relationship to the person, the person is not part of their private part of the mind space)
This includes the enemies, by the way. The only real characters we will see for a long time are the Moon System. Everyone else? A creation of the Moon System’s mind in order to heal and work towards a better co-consciousness.
Because yes, one of the beauties of the Lemire’s run is that it points out that the reason why the Moon System is seen as ill? Is not because they are a System. It’s because they are working against each other, and not communicating. This is the FIRST run to say “No, No guys. You are NOT Broken. Yes, you’re neurodivergent, but that doesn’t make you ill or wrong. It just makes you “you””. And while at some point it uses some incorrect language to depict this? It doesn’t take away from the main message that people who are not neurotypical are not broken, nor they need to be fixed. (We may need treatment, but that’s not different from, say, wearing glasses)
Anyway, enough introduction. No more gilding the lily, let’s get into the Moon System head with issue 1 of the Lemire Run. Welcome to New Egypt, part 1
And we open with a very sketchy looking page. An unreal page, if you will, as the Moon, Khonshu, calls Marc to an ancient looking temple. Marc says he’s not sure if he IS Marc, and Khonshu replies that, if he comes in, he will see his true face.
And here I give an annoying pause to explain something about comic narrative.
See, panels are very important in comics. The bigger, longer they are, the longer the moment they are supposed to represent is. The shorter they are, the faster the action happens. And of course, when they have no borders, the action is spilling out from one moment to the next, in a way that they blend together.
This page and the two that follow? Have borders, but they are sketched in, unsure and confused… but are THERE. However, once we get to the last room of the temple? The panel borders disappear.
Yes, we can see the panels separation, thanks to the white gutters. But there’s no real border to them, and they change shape easily. And THAT is our narrative clue that what we see? Is not real. The REAL part was the beginning, Marc talking to the moon, entering the temple, and LEAVING reality. We actually see him put his hand to the panel and LEAVE the boundaries of the comic book reality into his meeting with Khonshu.
Yes, Marc is face to face with Khonshu. Once he leaves the temple, the panel borders disappear completely (And, since unlike the Asylum, here they are in a completely white void? There’s NO reality to get our bearings. And thus, we have two possible readings: either this is Khonshu, the real Khonshu in the void between reality and the Moon System’s mind space, giving Marc a choice to die or be remade again… or it is the System’s mind way of re-framing their first meeting with the god: You are dying, if you want to live, if you want to be more, then put this mask on and become MORE.
And, as he remembers everything (and, very importantly, we see in his head Moon Knight, Mr. Knight, Steven AND Jake… but not a specific MARC memory) he wakes up… and the inking and color become SHARP.
Again, no panel borders, so we, the readers, know that this is still not real. But everything is sharper, more solid than in the moon and Khonshu scenes, so we know that for Marc? THIS is reality.
At first, the Asylum seems normal. Abusive as hell, since the two orderlies we meet Bobby and Billy, seem to delight on punching and doing electroshock therapy to Marc. Importantly, Booby is a big black man, like Bushman, while Billy looks a bit like Det. Flint when drawn by Smallwood. This is NOT to say they’re them, of course, but it is interesting that the two men who are tasked with keeping Marc in the Asylum part of his mind? Look like the two figures of authority he mostly had connections with as Marc and as Moon Knight.
But after the second shock session, we get to see the full asylum and we immediately know that something is not right, and not just because we still have no panel borders but because the architecture of the Asylum looks wrong. Parts of it are perfectly fine, white and tiled, but then the walls become ruined, full of cracks. And every window is boarded up with a lattice pattern. And of course, then there is the very first patient Marc hears speak:
Gena, getting herself psyched up to start her day at the Diner.
And her voice brings Marc a sketchy, confusing memory from Jake.
On TV, he sees a news segment about Moon Knight fighting with Stained Glass Scarlet. Interesting here because the news call her “his nemesis” but anyone who has read Moon Knight know that she was more like a strange ally. So once again, we realize that there’s something OFF even if we hadn’t been tipped off by the panels. But before Marc can get his bearings, he gets interrupted by Crawley.
And here we have an interesting thing.
See, in the past? Marc and Crawley barely interacted. Crawley was Jake’s friend, first and foremost, and later would go to the Grant mansion, where Marc never fronted. By the time Marc got to be fronting for most of the time, we were deep in the dark-grim-gritty era, and there Crawley became Marc’s rock and pain killer dealer. The one who tried to keep Marc in contact with his friends and later, helped Jake disappear.
So for Jake, Crawley was a friend, and a trusted source of information. But for Marc? Crawley was a rock, a mentor, and the one he could trust to get him out of any mess he got himself in.
Which is why THIS Crawley in Marc’s mind? Not only knows precisely what is going on, but also seems to know that this is not their first rodeo there as he introduces himself and tells Marc he knows he doesn’t remember him, then tries to make Marc realize exactly where they are.
So this Mind-Crawley is a wise mentor, a patient one which is the exact opposite to Khonshu. In fact, where Real-Crawley was on the fence about the whole Khonshu thing, just as everyone in the System’s lives? THIS Crawley calls Marc the Fist of Khonshu and reminds him of his promise to protect and free the travelers of the night. His role will expand much more later, but it’s again an interesting way to introduce this “out of character” thing the other people in Marc’s mind have.
Because right after Crawley, we get to see Marlene. But remember how Marlene was Steven’s girlfriend and refused to have anything to do with Marc? Well, the Marlene in Marc’s mind is completely catatonic, drugged into unconsciousness, just staring at nothing. Because for Marc? Marlene is a non-entity. He remembers her from Steven and Jake’s experiences, and he loves her because the System loves her… but he doesn’t have anything to give her a personality, so he… doesn’t. She becomes the uber-damsel in distress, that needs to be saved because she can’t save herself… but because she doesn’t speak? She can’t break Marc’s heart by reminding him that she doesn’t want him, she only wants the Millionaire.
From there we move to the office of Dr. Emmet who is the first 100% original character we meet in Marc’s mind. She is his psychiatrist, and claims to be very worried because now Marc claims not to remember how he got there, but he remembers bits and pieces of Moon Knight, Jake and Steven, that he’s sure are real.
But again, we the readers know something is wrong because the Dr. Office looks like a desk and a fireplace in the middle of a tomb chamber. No decorations at all, no windows, nothing to make it look like an actual place where a real person works. And if we had ANY doubt? The words of Dr. Emmet seal it because apparently? There IS a Moon Knight, but it’s not Marc since Marc has been entrusted to the care of the hospital since he was twelve. He is an orphan, and he has never stepped outside. She even has his notes on his fantasy of Moon Knight, a fantasy that the child that Marc was created to make his life a bit better.
And yes, she’s cruel, she’s direct, she doesn’t coddle Marc -in fact, Series’s fans will see that she acts much like Dr. Harrow did in episode 4 and 5- because, once again, that’s how Marc sees ALL psychiatrists. Because let’s be honest, in all his different series? He hasn’t seen one worth their Doctorate’s weight in rice.
Oh, and thankfully, we’re back to the DiD diagnostic, none of the “brain damage caused by an extra dimensional entity” nonsense.
Not that Marc believes her. He is ready to escape, and in a very interesting twist, he steals a pen from the doctor in order to, that night, use it to create a makeshift mask and cape from his bed-sheets and fight his way out of the hospital. Because with the mask on? When he IS Moon Knight? He can see the true faces of his captors, who are Egyptian Jackals.
Following Khonshu’s voice, Marc runs to the roof of the hospital, where he sees a changed New York skyline as the buildings are half buried in sand and there’s a giant pyramid in the horizon. Khonshu tells him that all this is a full blown invasion by Seth, and that his enemy must be stopped, but unfortunately Marc is caught by the Jackal-orderlies who tear off his makeshift mask and thus, take away the ability Marc has to see what’s going on.
And now New York is normal again, and Marc tries to contain his tears as he is unsure of what is going on in his own mind. (Not that he realizes yet that he is on his own mind. He truly believes this is the outside world)
And so we end the issue, without having one single moment outside the System’s head, and, in fact, no scenes outside MARC’s corner of the mindscape.
And because we’ve gone long enough, I’ll have to pause here. But we’ll be back with the next issue soon, I promise.
Part Ten
40 notes
·
View notes
As a queer querying author, I’ve come across many agents who are only open to BIPOC creators, and I have to admit that I find this frustrating. Like it makes me feel *not marginalized enough* or something? Which is not a great feeling. I get that agents can do whatever the F they want , and my opinion really doesn’t matter, but I wish more agents would be open to “marginalized creators” rather than “BIPOC creators” which would allow
neurodivergent, LGBTQ+, and others the opportunity to feel heard—and fine if agents pick and choose which diverse stories they want after that point. Am I off base here? What are your thoughts?
I can't see what you are looking at, so while I don't NOT BELIEVE you or anything, I also am not able to know if there is greater context.
Like, are they literally saying they ONLY accept BIPOC creators, or that they encourage BIPOC creators to submit? When you say "many" what do you mean? Like "a handful"? or dozens? (You don't need to answer these questions, by the way, I'm just posing them so that you can know what I'm thinking as I answer this!)
I think MOST agents want all kinds of diversity in their query inbox. So sometimes an agent might just assume that people realize that and not mention it (but that doesn't mean they aren't open to it!).
For example, several of the agents at my agency DO explicitly mention on the website or on their MSWL page that they are open to LGBTQIA+ creators, but also all of us rep LGBTQIA+ creators and any of us would be happy to consider, whether or not we explicitly SAY that we are seeking that rep, provided that the story itself is within our general guidelines.
So why do sometimes agents mention it and sometimes they don't? Well, they might feel like they have to say something specifically so that people KNOW, like "I'm open to marginalized creators!" -- but then we get a lot of questions like "what does marginalized mean?" "I don't know if I'm marginalized" "I'm a woman, so I am marginalized" "I have red hair so I'm a minority" (I know that sounds like I am making up stories, but I promise it is true, ppl are wild) --
So maybe we'll be more specific, like, OK, I mean XYZ -- but invariably leave some group out, NOT because we don't want to see work from them, but just because we CAN'T mention every single point of marginalization that might exist, and then sometimes people think that if they AREN'T XYZ we won't consider them -- so . . . yeah.
(Honestly, I think that we will probably get complaints or questions regardless of what we put in our wishlists or how we phrase it, there's no way to please everyone and hopefully agents are being inclusive, etc.)
So with all that said - if an agent doesn't say "marginalized creators encouraged to submit!" or "BIPOC creators encouraged to submit" or some such, that doesn't mean they aren't open to those stories/createors. And if they DO say something like that, that doesn't mean they are ONLY open to those stories/creators.
BUT if they truly do say "I will ONLY consider work from BIPOC creators" -- it probably means they have a mission in mind and are committed to only repping People of Color (including BIPOC people with other marginalizations, ie, Trans POC, disabled POC, etc) -- in which case, OK, that's a space that isn't for you, and that's fine.
Just like not all gay bars are super welcoming to random groups of straight people. (Some are! But not all. And that's OK, it should be a safe space for their patrons and they can have boundaries.)
Just like when I was in college, I, a white person, did not feel like I needed to be let into a Black sorority -- even if the sorority looked super cool and they had awesome shirts and great parties. If a member invited me to one of their parties, GREAT, I'd be excited to attend and I'd bring my dancing shoes! But I'm not going think that entitles me to JOIN the sorority, or try to finagle a way to do so -- membership is not FOR me, and that's OK.
Just like non-Latine people should not complain that they aren't eligible for the Pura Belpré award - that's just not who that award is for.
There are lots of other bars, and lots of other clubs, and lots of other award opportunities, and lots of other agents, that ARE totally open to you - so focus on those ones. :-)
**
(ETA: This is not meant to come across as a scolding for OP, at all! Just a general PSA!)
4 notes
·
View notes
RDNA 60th Anniversary; Beltane 2023
I came to druidry at a difficult time in my life. I felt the need for ritual amid all the personal turmoil, even if there wasn't much spiritual involvement to it as an atheist. Having not found much attachment to other practices (largely because of my atheistic leanings), I was surprised to find druidry still very much alive in my online searches, and it just so happened that there was a nearby active grove!
I actually intended to start attending their rituals last year around Beltane, but as a known insomniac, I slept right through both their Beltane and Midsummer rituals. Meanwhile, though, I began my own practice. According to the journal/grimoire I keep, I dedicated myself and my altar space to this path on May 1st of last year. I composed my own liturgy and everything, and I've continued to do so since then.
For a year, I've debated officially associating with the RDNA. I've shied away from other spiritual practices for many, many reasons, one of them being that I am cautious of any doctrine that imposes practices or beliefs of any kind. Reading @minnesotadruids's posts over a couple months was helpful in that regard, however. If nothing else, the RDNA seems to encourage wariness, making fun of its history and practices, and creating a path for oneself. Druidry, to them, is all-inclusive of spiritualities, and one can be a druid, no matter what one believes, including atheism or agnosticism. In some ways, this was an intellectual challenge for me, but a good one, and one I sorely needed in my lifelong, never-ending pursuits at personal growth. Ultimately, this way of thinking about things and practicing in the world is what I needed. It allows me to focus more on meeting people, creating community, listening to others, and acts of service than on practicing in any one specific or particular way. And at the end of the day, or when I go home from a ritual, I can still do things and practice in my own ways, without the permission or oversights of any singular authority. I'm also lucky that my local grove is mostly LGBTQ+ and vehemently proclaims their inclusivity and anti-racism.
I first started attending and getting to know my local grove at their Lughnasadh ritual last year. I've hardly missed an event since, aside from one or two casual hangouts. I've also done my best to continue my explorations of other practices, but continue to find the most joy with Oakdale Grove. I even began having dreams about joining the RDNA or about people I'd met in the grove--all of them happy, with an emphasis on community and creating a path for myself.
But I've still been anxious or cautious about officially declaring my attachment to the tradition of Reformed Druidry. Because of some undiagnosed neurodivergence, I've always taken up and then tossed aside rather quickly my various hobbies. I'm afraid druidry would be like that for me. I'm also afraid of not being "worthy" in my spiritual pursuits. I've never had any particularly strong spiritual experiences. But this past year has shown me that I'm not only capable of finding joy enough in something for it to keep my attention, but also that the experiences I do have are actually deeply spiritual. I've had a deep love for and connection with nature since my childhood, and studying druidry has only strengthened that and driven my curiosity.
So, I decided I would take a chance by joining the First Order during the 60th anniversary of the RDNA, just 45 minutes south or so from the Twin Cities. It's yet another strange bit of syncronicity in my life that I should find my job and move to the state where Reformed Druidry began, and especially as an act of protest, depending on how you look at it.
It was really a very nice time, between Saturday and Sunday, though both days have blended in my memory and I am struggling to separate them. Saturday was a little calmer, with fewer in attendance, but a lovely bonfire surrounded by people from my local grove and those who'd come from across the US to attend. Stacey Jo, who would be ordained into the Orders of Belenos, Sirona, and Ogmios Saturday night, presided as Arch Druid and showed us how she led rituals. During the ritual, one joined the First Order who would be ordained into the Second Order Saturday night, and then the Third Sunday morning, if he made it through his ordeal. In his own words, he said he'd been waiting 20 years for this moment, and I experienced both a mix of relief and imposter syndrome. Each member's story for their path is unique, but I'm continually in doubt if my path is the "right" one--something I'd like to write on more in the future.
Saturday was much longer and busier, and something like 22 druids showed up. Mike Sharding and another Carleton Alum, whose name escapes me, took us on a (semi-)brief tour of the Upper Arboretum to a few of the "holy sites" where Reformed Druidism started, including Monument Hill, the Druid's Den, and the Hill of Three Oaks. I was a little awestruck that so much natural beauty was preserved there and how much work was done to try to keep it that way or improve it.
Finally, though, it was time for the official Anniversary ritual, during which it began to storm. The rites and ordinations seemed punctuated by claps of thunder, which brought some attendees hesitation, but which I personally took as a good sign as a lover of rain and storms who regularly tries to go out and just stand in the rain and splash barefoot in puddles. Besides, the second tenet of Reformed Druidism is thus:
And great is the importance, which is of a spiritual importance, of Nature, which is the Earth-Mother, for it is one of the objects of creation, and with it we do live, even as we struggle through life do we come face-to-face with it.
I feel that, among many other interpretations, one of them is that nature itself is something through which we struggle, and we are beholden to it. Even for all the offerings and aeromancy that a druid might perform, nature will do as it wills, and we must accept that, especially as part of our spiritual involvement with it. There was definitely much bemoaning of soaked clothes and ritual garb, but I took great joy that my ordination into the First Order was full of laughter and mirth while John the Verbose raised his face and arms to the sky in reciting the second tenet for another initiate and I to affirm.
And so I "officially" became a Reformed Druid. We spent the afternoon drying off, before feasting at a place called "Tanzenwald" (Dancing Forest, in German), retiring to the student union for a break, and eventually reconvening at the Council Ring for the evening festivities and start to the vigils. At one point, while waiting on everyone to arrive, the bonfire re-lit itself, as if signaling to the druids, and had to be quelled by Edward, with dry wood being in short supply.
A handful of Carleton students showed up for their own initiations, Stacey took part in her ordinations, vigils commenced, and the druids dispersed into solitude and meditations throughout the arboretum. I stayed at the Council Ring for quite a while after with Adam, Edward, and John, just enjoying the night. I don't get to spend much time outside at night as a teacher often stuck at home grading and course planning. One of the things I really enjoyed about the weekend is that I didn't feel obligated to speak to anyone or impose myself on conversations. I often just sat on my own, listening to others converse and enjoying being outside. Adam, Edward, and John, though, were all kind and asked questions of me (as many did over the weekend), and as a perpetually socially awkward individual and historic social reject, it was nice to feel included and like I was part of a community. It was something I've sorely needed in recent years.
At one point late into the night, John and I traveled across the man-made lake to the walkable labyrinth they have built into one of the islands. I haven't walked a labyrinth since I was 8 or 9 years old and lived in Arkansas, but I've read plenty about them in my studies and even watched/listened to Sting's (the musician) Songs from the Labyrinth / The Journey and the Labyrinth.
John gave me the lantern and let me go first. I wish I could walk labyrinths more often. It took a minute to get into the rhythm of it, but in just letting my mind wander as I watched my footing, I could begin to feel what labyrinth walking might offer someone. At first, the sharp twists seemed to reflect my inner anxiety, like some strange metaphor for the racing and looping thoughts. But soon enough, the back-and-forth turns opened up into more languishing, longer paths along the outside of the labyrinth, and I felt calmer. That made going back into the tighter turns much easier. I was even surprised when I came upon the center, not sure what to do there. I think my mind expected to find an exit directly out again after making a clock-wide loop around the center, but one is forced to retrace their steps instead. And this, too, was easier and calming. Given more time, I would have walked the labyrinth several more times, but it was getting late and I had two cats at home to feed. After a little more time at the fire with Adam and John, I headed out.
I'm really glad I went. I don't know what the future holds for me within (or without) the RDNA, but I'm eager to see. I don't know yet if I'll join the Second Order and prepare for the priesthood. I've had dreams about it, and my dreams are strangely prophetic at times, but what does/will the call of service sound like for me? I am trying to have patience... and to keep up my studies over the next year. I worry about being over-eager. I need to get better at meditation, and I'd like to finish making one of my staves so I can take up Bodfish's "Salutations of the Day" on a regular basis. I would not say the last year has been smooth for me; I sometimes neglect to perform the rituals I prepare at home and for which I compose my own liturgy. But I will say the past year has brought me more calm and joy than I've had in a long time, especially coming out of several years of chaos and tragedy, both personally and globally. Here's to the safe travel of all the druids who came and to another year of my studies.
1 note
·
View note
ST LOUIS BLUES: THE MUSICAL
Welp I'm probably going to regret this sooner or later but I might as well make this blog so that my hockey talk doesn't entirely get blended with my LGBTQ+ talk so uh...
Hello! I'm Shadow. I'm a 17 year old queer kid who just wants to hang out with other hockey fans. I primarily root for the Washington Capitals and the St Louis Blues.
Anyways let's just get the important stuff overwith 😅
Starting off with the most important disclaimer, I do want to emphasize that some players I talk about and post about do include the most controversial ones (ex. Patrick Kane, Alex Ovechkin).
I want to make it clear that while I support some players *on* the ice, that doesn't mean I support them *off* the ice and vise versa. Still, if seeing *any* of those players makes you uncomfortable whatsoever, it might be in your best interests to tag specific players or to just not follow at all.
I also talk about the Chicago Blackhawks, a LOT, regardless of if it's me hating on them or specific players, me glorifying specific players, or just straight up mentions. I will also talk a lot about their rival and my main team, the St Louis Blues. Again, if that's not your thing you might want to filter the "chicago blackhawks" tag. This is a heads up for both Hawks fans and detractors.
Secondly, who can interact?
Well, since it's a hockey blog, I allow hockey fans of any team, any kind to interact! Casual, diehard, hell even bandwagons are welcome!
I'm also an artist, and I really wanna get to know most other hockey artists, so if you're a hockey fan and an artist feel free to interact! (Note: the account must be mostly SFW).
I am VERY MUCH open to seeing other Blues and Caps fans, especially considering there's not many on hockeyblr and I will admit I get pretty lonely hehe.
That said, I also wanna meet rivals of said teams, especially Hawks fans, Pens fans, Flyers fans and Avs fans.
As for who can't interact..
I will block freely overall, but in particular fuck off if you're bigoted (racist, sexist, queerphobic- including terfs and exclusionists- ableist, islamphobic, antisemetic, etc) anti-vaxx, anti-abortion, supports/involved in crypto/NFTs or if you're active in anti-recovery spaces (such as pro-ed spaces). Though knowing hockeyblr, this hopefully won't be an issue, but I'm putting it out there just in case.
Additionally, don't interact at all if you gatekeep fans of any kind (The only fans we gatekeep are bigots and creeps folks!), wish injury or even *death* on any players, are a gossip blog or confession blog, harass any fan of any team or you genuinely believe someone is a shitty person over the team they root for (Ex. believing every bruins fan is racist, believing every hawks fan is a rape apologist, etc). Hating a hockey team isn't a bad thing but harassing a fan *over* said hockey team is *always* bad no matter how you look at it. ...though this probably won't matter because odds are I have you blocked already lol.
RPF blogs and fanfiction blogs can interact. However, this blog is not an RPF or fanfiction blog. Please don't tag my posts as "hockey fic" or "ship".
Incest shippers and pedophilia shippers on the other hand... please stay away from me.
I'm a minor, 17 years old to be exact, and because of this I would prefer if NSFW accounts didn't interact. And if you don't want minors interacting with you overall, you might wanna block me as well for both our sakes. Remember, DNIs go both ways!
This account is a safe space for POC, Queer folks, women, disabled folks, neurodivergent folks and other minorities. If you can't handle that, get lost.
Lastly, blogs with no posts combined with no avatar or banner, or blogs that have nothing but a stock image/stolen photo of a white woman as a profile picture combined with a name and nothing else will be blocked on sight, as chances are you're a bot. No exceptions. Blogs tagged as "Mature" may also be blocked, as half the time I'll think you're NSFW.
Again, I block freely, and I will block folks even if they aren't on my DNI. If you're blocked, don't take it personally.
TAGGING SYSTEM:
+Stick to the Status Quo+ - Player hate. Will be tagged as +Stick to the Status Quo: [player name] Hate+
+Let's go tear up someone's lawn+ - Team hate. Will be tagged as +Let's go tear up someone's lawn: [team name] Hate+.
+Champions one and all+ - Player ramblings/praise. Will be tagged as +Champions one and all: [player name]+
+Welcome to my Candy Store+ - Asks.
+Getcha Head in the Game+ - General Hockey Rambling.
+And there's your final bell+ - Rant/vent, or otherwise serious posts.
+We're gonna rock the house+ - Reblog.
+Shut up Heather!+ - Not hockey related.
+I hope you enjoy the show+ - Anything related to the St Louis Blues or the Washington Capitals and their players (including current or former).
+But I don't own a motorbike+ - Art, page decor, userboxes, you get it.
Shit you should probably look at (no pressure):
Umich Rumors (TW: Abuse mentions)
Why censoring the names of players is a bad idea.
The Sexualization of Hockey Players. (TW: Sexual harassment).
In case you're curious on where I stand on Patrick Kane, read these (Archived versions. Heads up the images in the second link are broken for some reason).
Main blog and the account I follow/like from: @shadowstarlightwitch
Disability and more: @thecringepunkarchives
General fandom, fanfiction and art blog: @thatonedemonnamedlucifer (16+ only)
1 note
·
View note