#i tried addressing a lot of faq | Explore Tumblr Posts and Blogs

goddessxeffect · 9 months

Text

《 MASTERPOST: Let go and let God 》

Quotes from blog post and answers from other bloggers regarding certain topics based in the teachings of law of consciousness and non duality. This is a summary of everything I think is incredibly useful and has been for me in understanding and applying this lifestyle. Long post ahead.

Basics & Teaching

"I contain all, nothing contains me." - Nisargadatta Maharaj

This subject cannot be learned intellectually, it cannot be learned through the mind [ego] because it's perceived just behind the mind. We can use the mind to gradually undo the limitations enough so that we can get behind the mind by getting it quieter. @4dbarbie-backup

What you can point out as 'this' or 'that' cannot be yourself. Surely, you can not be 'something' else. You are nothing perceivable, or imaginable. Yet, without you there can be neither perception nor imagination. Identity or Ego is merely a pattern of events in time and space, which are also just concepts belonging to the world of ego.@4dbarbie-backup YOU are life. you are life itself. you are all. you are how this all works. "me? this body? this mind?" not the body, mind, ego or thoughts. not even the feeling, beliefs & emotions. i'm talking about Self. Infinity. God. I AM. the awareness. the one that observes all. the life force is you. you animate all of what you see. @lains-reality

Realize you are never not IT. We are actually fully realized all the time. We are fully realized Beings saying that we are not. @4dbarbie-backup There is no becoming "aware". You can't become something you already are! You keep forgetting you are not the body-mind (ego). The body-mind lacks things, the body-mind takes it's surroundings to be real. The body-mind has a very limited viewpoint, it knows what it knows, it only sees what it sees. @iamthat-iam The [body-]mind cannot intimidate the Pure Self, it can only intimidate the idea you have of who you are, your self image. what the mistake is, is that we are taking the idea of who we are as the fact of who we are.@lains-reality

Everything you see and experience is only a mental condition, a dream-like state, easy to dispel by questioning its reality. Both sleep and waking are imagined.@4dbarbie-backup Dreams are just "materializations" of whatever our consciousness is aware of while the body rests. You can touch it, you can interact with it, your senses become active when you're dreaming at times. there's even a phenomenon where people actually thought their dreams were memories or something they legitimately experienced.@piercedblunt "But I am not conscious of myself when sleeping?!" You are aware of something though, being unconscious, which manifests instantly, you are sleeping. Being unconscious is an experience, and you're doing the same thing in the waking state.@4dbarbie-backup

Let's now take a look at this so-called physical world. The apparent solid outer world is just an illusory world. We created it mentally, which is also backed up by human science. But, and that's the catch, it is not external and so the only way to control the outside world is to step out of the world. The ego IS IN the world, and not you. Both the ego and the world are IN YOU.@4dbarbie-backup

When 'you' desire something, you [Consciousness] already have it. How do you already have it? Your true self is everything, it can't desire anything if it's already being anything. Everything that your ego desires already exists within consciousness. Remember that whenever your ego tries to bring up a desire. @iamthat-iam After all, when 'you' desired in your mind, wasn't there a moment where you had it? Where you imagined what it'd be like to have it, what it'd look like or how it'd make you feel? @cheryawa It is not instantly visible to you because you identify with the body and not your pure being. No matter how much you use your mind/imagination, you are who you are regardless of the imagines playing in the head. I could think of a panda a million times, imagine what it's like being a panda a thousand more, that doesn't make me into a panda when I still know myself to be a person.@4dbarbie-backup

Here's a scale of emotions you'll go through in your journey, from bottom to top: apathy, grief, fear, hostility, anger, indifference, acceptance, freedom finally - and then unlimited, independent joy. @4dbarbie-backup It’s not an euphoric feeling either but a real feeling of knowing and with that - indifference and power. It is very calm and serene, as if nothing can disturb you. @adadisciple

I've been looking at the things I want as existing for me to experience them. When I have a desire, I experience it as something that already belongs to me because everything is coming from (within) me. @4dbarbie-backup

NON-DUALISM

"It is the Self that believes there is a person and is conscious of being IT." - Ada B.

Let's break the word down first. “Non” of course means “no” or “not.” And “dual” means “two.” So, non-dual means not two. It says there is only one. This is referring to you, awareness [or consciousness], that there is only you, [...] the only thing that exists. You are the true reality. The only purpose for awareness is to observe, to oversee, to be. Nothing more, nothing less. For example, awareness is human, it can take on a human form, but human is not awareness or defines awareness as a whole. A human is simply a temporary form, but awareness is always free to be aware of any other form @itzalizeyyy

Whatever you imagine is the same as seeing it in the physical world, because both are still being an observed experience by the awareness, and therefore both are the same, as one (imagination). @itzalizeyyy

Helpful metaphors: When you watch a movie, you know it is a movie bc you are outside of it. you are observing it. now what about the characters in the movie? they dont know its a movie bc they are not outside of it. they think they are just regular ppl and they dont see the truth, their true selfs: which is just characters in a movie. @msperfect777 The ego is like your character in the game (of life), it's already a "manifestation" so it can't manifest (just like a book can't write itself or another book). You are aware of a character you go through life with. @consciousnessbaddie

Ego Death is then the disappearance of the egoistic sense of Self. You feel that your are no longer that.You don't disappear; you don't lose anything. There's no reason to fear losing your body, or losing anything. Yet, most of us are fearful that we're going to lose our body and be nothing. That's a serious error. You could be a hundred bodies! When the idea 'I am this body' dies, the witness does not. Death is merely the idea 'I have lost my body'. What you think yourself to be before death continues to be after death. Your sense of Self survives. @4dbarbie-backup

In Non Dualism, the goal is to stop identifying with ego and realize who you are.You see there's no seperation between you and anything so that means everything you once "desired" is already who you are. You never feel the sense of desire again because of this. Any "physical materialization" that happens after will not seem like such a big deal, since it was already who they were to begin with. @iamthat-iam

"I am that, I have always been that. All is well. There are no mistakes. I am in my right place." All you have to do is realize/ know your are not the mind (= identitiy, character, ego). Robert Adams

Self-Inquiry

" To know the source as source and appearance as appearance, and oneself as the source only is self-realization " - Ada B.

The mind is doing a good job actually, because it bites you and kicks you and teases you, because if it doesnt do that, then you'll want to make this limited feel your home.@lains-reality

Every thought is a thing of limitation. Therefore when we quiet the mind, we still these limiting thoughts and this infinite Being that we are becomes self obvious to us. We have convinced ourselves over the millenniums that we are these limited bodies, and we think it takes time to let go of these concepts of limitation. But time is a thing of the ego, it's a thought. @4dbarbie-backup

Learn the art of being aware of you (awareness). [...] You must not become what you already are, as the detached witness of every thought or sensation that comes and goes. [...] The practice of self-inquiry is returning to the fact of who and what you are. @anon-i-mus

It's a kind of surrendering but to me, truthfully and honestly, it felt more like a giving up. Even if it makes you miserable, accept the person you're identified with until you no more fear it or care if you stay the same. @4dbarbie-backup

-> Questions to ask yourself

Detachment

"Transcend your desires and your fears and you will have everything." - Ada B.

As Buddha taught, the root of suffering is attachment. It is not having the emotions and thoughts [...] but resisting or supressing them, and resisting the transitory nature of life and all things. Emotions and thoughts pass. No big deal. It is holding on to them when they are just coming up to leave or pass through that causes suffering. @lains-reality You need not stop thinking. Just cease being interested. It is disinterestedness that liberates. If you say, “There's no problem,” they won't vanish because you're saying, “There's no problem.” You're mentally holding onto the problem and therefore sustaining it. Erase the problem from your mind means to know (be aware) that everything is perfect and then the problem is necessarily non-existent. Basically, let go of it, because the problem is just an illusion. @4dbarbie-backup

You then ask how to stop being "Vanessa" ? - the reason you can't stop is because it's ALL YOU THINK YOU ARE. For example: You're driving a car. "I AM" is the car. You know how to drive it because you're already driving it by being Vanessa. Vanessa is something you add to the "I AM" and not you. You can't stop being Vanessa while being Vanessa! I think that's what everyone keeps asking: Vanessa wants to be Lara, not awareness [first]. @4dbarbie-backup

To talk of re-uniting the person with the self is also not right, because there is no person, only a mental picture given a false reality by conviction. Nothing was divided and there is nothing to unite. You are That. @4dbarbie-backup Nothing can remove your being. Nothing has ever stained your being.@lains-reality You think you have to do this and that because you think you're it, and you should act from it. That is not the case. There's nothing to do except disbelieve. But disbelieving and denial are not the same thing. Denial is when you deny reality to something you're already giving reality to. @4dbarbie-backup

Detachment is not lonely. It's freedom and it's real love. Needing is selfish, it's self-centered. The self has no preference and it's because of that that it can be everything. @4dbarbie-backup

Some of you are on this path for a while but to some extent still are identified with ego and that's OK. Don't get caught up in "your" expectations of what self-realization is supposed to be like. The expectations are making you turn this into a task, when it is supposed to be effortless. Yes, we have talked about feeling peaceful once you've realized yourself, but you're going to need to drop the expectations. It's okay if ego isn't completely grasping it, ego isn't real and it isn't who you are. @iamthat-iam

Fear is an invitation to remember who you truly are. Acknowledging fear doesn't make you any less worthy of or further away from what you truly desire. Similarly, acknowledging your shadows does not dim the Light that you are. The shadows you battle against are simply the seeming absence of you. Becoming entangled in the world of shadows is simply the forgetting of your Self; and Light casts shadows that come and go only to remember itself. The truth is that Light knows no opposition or enemy. Shadows have no separate existence from Light. Your fears are made of you. @lains-reality

The more I detached from ego, the freer I was to imagine what ego wanted without interference from conflicting thoughts/thoughts that "oppose" the desire. @iamthat-iam In fact, abandon all imaginings and know yourself as you are. Self-knowledge is detachment. All craving is due to a sense of insufficiency. @4dbarbie

To anyone who also wonders "how am I still picking this ego?": how many times have you thought about tomorrow? next week? future plans? there's your answer. and the worries about "life" come from them too. "if I don't prepare for/worry about this event that'll happen, I'll have to deal with the consequences of this action" you're telling yourself you will keep waking up as this exact same ego over and over. @glitterdoll888

If you come straight from Law of Assumption or Law of Attraction please keep on reading this last section!

“The simplest answer is usually the right one!.” - Occam’s razor

I think, that what we call 'manifestation' is life itself. i do not mean life in the way that you live A life, like its happening outside of you. i mean it as: it is natural & normal to manifest, its existance itself. it is not something you have, it just is. 'manifestation' is just life itself. it's how all works & is.@lains-reality

The similarity between ND and LOA is in the fact that What you’re aware of, is. LOA’s inner self is still ego. To talk about fulfilling self means fulfilling ego. There is nothing to fulfill if you are the Self and the only one that needs to be fulfilled is an ego, you’re still catering to an ego. @adadisciple

Please, please, understand that you don't have to DO anything! You are always awareness,you will never lack anything. Please stop worrying about the "physical" world and stop trying to materialize things within it! Non Dualism isn't a "new manifestation method" to "get what you want," you are realizing you never lacked anything this whole time. @iamthat-iam

The way the sun rises up in the morning, in the same way Vanessa happens to awareness. It is natural. Do you try to make it happen? It comes by itself (because you choose it as you).@adadisciple For example "I am a body" is a thought that runs automatically ("subconscious), because we do not look at it/know it, we have just accepted we are bodies and that's why we "see" a body. @4dbarbie-backup

You just need to allow something else to happen, not try to make it so!! You cannot help being what you are: Vanessa is the absolute to you now. But if she can be TO YOU, if she happens TO YOU, who is YOU? Your Vanessa "I" runs on autopilot, she is a symbol. She has no free will. To the Self, she is only an idea. She has been conditioned and programmed to think the way she does, it’s the only way she knows how to function. And that’s fine, let her be. Just don’t pick her as you.If she were a random stranger on the street, you would have no concern about her life. If you were Lara now, where would Vanessa be in your thoughts? That is the behavior you should strive for in your thinking, dispassion, disinterest, detachment. Let the thought of being her go. Just let them BE. The way you let Vanessa be. And you let Vanessa be by thinking that’s all you are, that’s what is true. @adadisciple

If you want a "method", then the very best method of all methods is to quiet the mind to see the Being that you are. Pose the question: “Who am I?” and if other thoughts come in, ask, “To whom are these thoughts?” The answer is “To me.” “Well, who am I?” and you're back on the track, seeking to see your Self. @4dbarbie-backup I sit in the feeling while focusing on something else in the present moment, and it usually goes away. @iamthat-iam

Non Dualism does not believe in “affirming” or “persisting” because if awareness is already everything, then it does not need to affirm or persist for its desire if it already has [or IS] its own desire. @itzalizeyyy Like repetition, it keeps you in lack. Do you need to remind yourself that you are a man or a woman? That experience, that form, is already being observed, is already being aware of. You know 'your' gender. @4dbarbie-backup

The truth is, there was no "3D" or "4D" in the first place. there is no imagination VS reality. nothing is real, it has always been illusion VS illusion. If anytime you get thoughts like "why is it not here" "why don't i see it" "why hasn't it manifested yet" you are immediately identifying with your human self. [...] Relying on the human senses will always be our downfall. @iamthat-iam

If you don't have the discipline to at least cut off all this excess of knowledge of information, you'll only be making it tougher on yourself. After you do that, stick to it until you're ready to let go and rely on yourself. Until you start behaving like the teacher and one is needed no more. You create the teacher because you think someone is more knowledgeable than you. That's fine for now, but trust the teacher, listen and apply.@4dbarbie-backup

I have Psychiatrist & doctors appointments, work, still need to eat, want to commit suicide? Psychiatrist appointment. What is that for? To correct your thinking, isn't that right? Reconditioning, changing, or even eliminating patterns of the mind. Now, I'm not telling you to stop going/stop working and or eating. That would be irresponsible of me. Leave your mind alone, that is all. @4dbarbie-backup

DO NOT ACTIVELY INTERFERE in ego's life or try to stop living that life while still being very attached to it, i.e. still identifying with that ego. Let the person continue to live it's life and fulfill it's obligations like studying, but maintain the knowing that it's not who you are. @iamthat-iam

But what about random things that I wasn't even aware of before they came? It's very simple, really. You are aware of being Vanessa and with Vanessa come specific beliefs. Characters have their own beliefs like certain weather can give you a cold, certain environments have insects etc. Thoughts dominate you only because you are interested in them. By resisting evil, you merely strengthen it. If you are "I AM", it means you are not the person experiencing the 3D world/thoughts/circumstances, you never were. The problem is excessive interest, leading to self-identification. Whatever you are engrossed in you take to be real. @4dbarbie-backup

#masterpost #consciousness #law of assumption #non dualism #non duality #non-dualism #non-duality #law of consciousness #i tried addressing a lot of faq #long post #this took me way too long to make #nondualism #goddessawakening

586 notes · View notes

that-house · 4 months

Text

Potion Vendor FAQs:

What’s your name? I am the Honorable Alchemist Zykocea the Radiant, but that’s mostly just a PR thing. My friends call me Zoe.

Do you sell love potions? No.

Do you sell potions of invisibility? No.

Do you sell fire resistance potions? No.

Why do I have a suitcase? Fuck if I know. Cool outfit though. Very goth.

Do you sell a potion to treat brain hemorrhaging? No.

So what CAN your potions do? I sell health potions.

Are you sure these are health potions? They do something to your health.

Is this just ditch water with some pink glitter? No.

Really? I’ll have you know I added some fruit juice too.

Why is this starting to sound like a conversation? Oh just you wait. We’re just getting started.

Is your business model legal? Fuck no. I poisoned the food safety inspector before they could snitch.

Did you just admit to murder? Just fucking try to convict me. I’ll poison the judge too.

So can you make poison potions? No.

Then where do you get the poison? I secrete it from my skin.

Are you shitting me? Yep, I’m shitting you. I have a guy. A poison guy. He DOES secrete it from his skin though.

How does that work? …Fuck if I know. Maybe a wizard did it. Damn, now I’m kinda curious.

You never asked? The idea of asking literally never crossed my mind.

Wanna ask him? Let’s do it. I don’t have anything better to do, and a road trip beats sitting around running my fraudulent potion business.

Road trip? He lives in Seattle.

Your poison guy lives in Seattle? All poison guys live in Seattle.

For real? All the poison guys I know live in Seattle.

And how many poison guys do you know? Just the one.

Why are you like this? Years of living on my potions. It changed me.

Do you know what his address is? Nope. He just mails me my poison in unmarked boxes.

You just get your poison in the mail? We already poisoned everyone who could do anything about it.

So how are we going to find him? We’ll figure that out eventually I’m sure.

Can I drive? God no. You can pick music, but I maintain veto rights. Make sure you pick something with a lot of questions if you want to sing along.

Where’s your car? The garage connects to my house, so you’re getting a little tour. Here’s the kitchen: only one of the stove burners works and I’m pretty sure the microwave is haunted.

Why do you think that? Because of the ghost that tries to kill me whenever I run it.

What’s in that room? That’s my bedroom. It’s pretty much just a mattress on the floor and every single Warrior cats book.

You were a Warriors kid? Yeah, and then I never found the time to put the books away. There’s so many fucking books. I use them in place of furniture because I can’t afford chairs.

Your fraudulent potion business doesn’t make much money? After buying all that poison I just about break even.

Can I see your potion brewing room? It’s right through here. Ignore the mess, running a fraudulent potion business takes a lot of prop work, but I’ve got all the glass tubes and colorful liquids you could ever want. This pink stuff is melted watermelon italian ice. Glitter vat is in the basement, and the famous ditch is in the backyard.

Is this your car? My beloved ‘72 Corolla. She’s beautiful, and don’t you dare imply otherwise.

Was she always this shade of muddy brown? …Yes.

Are you sure I can’t drive? Get in the fucking passenger seat and pick the music.

Let’s see, a song with questions in it, how about The Beach? That Wolf Alice song, yeah. That should work.

When will we three meet again, in thunder, lightning, in rain? Still sink our drinks like every weekend but I’m sick of circling the drain.

When will we meet eye to eye? We clink the glass but we look at the floor.

Are we still friends if all I feel is afraid? You’re not a bitch but just a bit when you’re bored.

Is that all we can sing together? Yep. Even that little bit was nice, though. It’s awkward, communicating through this FAQ format.

Got any food? Yeah, there’s a few days’ worth of snacks in the back.

Were you just… prepared to go on a road trip? Says the woman who brought a suitcase to an FAQ.

I did do that, didn’t I? I have a spare toothbrush in case you forgot yours. I’m pretty sure you did.

How did you know that? …I’m psychic.

Yeah? No.

You love lying, don’t you? I can’t stop. It’s fun. Way more fun than telling the truth.

Did you just miss a turn? Probably.

Are you sure we’re not lost? No.

You mean you’re sure we’re not lost? No, I mean I’m not sure we’re not lost.

Why did I come on this road trip? Surely it was my winning personality.

Would it help if I said it was? It would.

Is it getting dark? Soon.

Can you describe the sunset to me? An empyrean flame, red-gold towers of darkening clouds, the sky behind them an ever-deepening indigo. The great eye of the sun closes on the horizon. The road before us looks like a trail of spilled paint, an iridescent gash through the night-dark woods.

Did you know that you’d make a slightly better poet than you do a potion seller? That really isn’t saying much, huh. Good job making a statement like that in question form, though. You’re getting good at this.

Should we find a motel? Sure.

One room or two? One. It’s way cheaper, and like I said: I’m not the best potion vendor.

You’d make a good assassin, though, wouldn’t you? Shit, you might be right. I HAVE poisoned a lot of people.

Should I be endorsing this? You’re a grown woman who can make her own choices.

Would you like to consider it endorsed? I’ll consider considering it.

How many beds do you think there will be? Now that you’ve asked that, I’m gonna put my money on one. Hello, one room please. Thank you, we’ll be sure to enjoy our stay.

How many beds are there? One.

Oh no, what ever will we do? Move over, you motherfucker, you can’t have the whole bed.

Are you gonna make me? Yes. I am going to pick you up and drop you on your side of the bed.

How did you get so strong? You’re not gonna believe this, but it was the potions.

Oh yeah? I was right. You didn’t believe me.

For real though, how did you get so strong? Working out, duh. Not everything has some big crazy secret behind it. World’s still beautiful though.

Are you comfortable? This beats the mattress at home. A little chilly though.

Wanna cuddle–for warmth of course? God yes.

Are you asleep? …

Yes? …

Does this mean I can talk about you behind your back? …

What should I say? …

Did you know that I had a really nice day? …

Did you know that I think you’re beautiful? …

Did you know that I can’t remember anything from before today? …

Did you know that I don’t know who I am? …

Did you know that you’re basically the only thing stopping me from having a full-blown panic attack about all this shit? …

Did you know that you’re warm? …

Did you sleep well? Better than at home, that’s for sure.

Did you know that you snore? I hope I didn’t keep you up.

Does the pope shit in the woods? No, as far as I can tell. Oh my god. This is huge.

What is? You can give me yes and no answers now. I still can’t ask you questions, because this is a question and answer format, but I can offer leading statements and now you can answer them! This is wonderful!

Does a deer shit in the woods? Yes, it IS wonderful. Oh that’s amazing. You’re a genius.

You didn’t already know that? Hahaha!

Shall we get moving? Yeah, just let me grab something from the vending machine.

Can you get me something? Go ahead and place your order however you can.

You know those sour gummy watermelons? One pack of Sour Patch Watermelons coming right up. I’m gonna go get myself a potion.

Is that a Pepsi? It’s closer to a potion than the shit I sell.

Let me guess, passenger seat again? Right you are.

How fast are we going? You’ll feel safer if you just guess.

Is it more than 120 miles per hour? Like I said, it’s probably better if you don’t know.

150? Sit back, relax, and enjoy the ride.

How much do you trust this car? She hasn’t blown up on me yet.

Can you promise me we won’t crash? I can promise you anything you want.

And can you keep that promise? I- we can do anything. Reality is what we make of it, baby!

Then can I have a badass tattoo? As far as I can tell, you’ve always had it.

And a cool knife? Woah, cool knife.

So, we’re just playing “yes and” with the world? It’s a little more complicated than that, but you’re close enough to the mark.

So, if I was hungry, I could ask “is that a Burger King,” and it would be there? Try it and find out!

Is that a Burger King? Looks like it is! We’ll stop here if that’s alright with you.

Does a moose shit in the woods? Awesome.

Are you done eating? Yep.

Do we still have to pay if we skip over the transaction? Sadly, yes.

How much further do we have to go? Two more nights, the speed we’re going at.

Speaking of night, isn’t it getting dark? Shit, I guess it is.

Should we get another motel? Let me check to see if there’s any nearby. Fuck, nothing.

What’s the plan? Sleep in the car, I guess. This is gonna be hell on my back.

Wanna watch dumb videos on my phone until we fall asleep? There is literally nothing in the world that I would like more.

Ok, now which video? You have a very cute yawn. Just saying. Let’s watch this one next, it’s a classic. Oh, never mind. It looks like you’re asleep. As long as I keep talking, I think I can get away with making this into one answer, and you might not hear this. Now it’s my turn to talk about you behind your back. Keep talking keep talking keep talking can’t stop to think. Just have to say things. First off, I’m sorry for all the lies. It’s our only chance. I have to lie to you. I hope you’ll understand. It’s hard, though, because I think I’m falling in love all over again. Through our broken little ritual of call and response, you complete me. It just makes this hurt all the more. Keep talking keep talking keep talking don’t stop to…

Did I hear you saying anything as I fell asleep? …No. I can’t talk for long without you asking me a question.

Does that bother you? It got me here, didn’t it?

When did you start holding my hand? Some time after you passed out. I hope you don’t mind.

Can we stay like this for a while? Yeah. Yeah we can.

What was your life like before all this? Normal, as potion-brewing scams go. And if you don’t count all the murders. You haven’t told me much about yourself.

Did I tell you I used to be a biologist? You didn’t tell me that, and you didn’t tell me what you studied, either.

What do you know about venom? Not much, but I’m assuming you know a lot.

Does a box jellyfish kill within minutes? I’m going to assume the answer is yes based on context clues. Oh my god you must be on this road trip because you’re interested in studying my poison guy.

Is it not enough to wish to accompany a beautiful stranger on her quest? Aw, you’re sweet.

What could be the cause of his poison, though? I knew it! Get your ideas out, I’ll stay quiet.

I’m more knowledgeable about venom than poison, but could it be some sort of one in a trillion mutation? …

Did he get his body modified? …

What sort of surgery could do that? …

How is he still alive? …

Did a fucking wizard do it? …

WHY? …

HOW? …

Is there literally ANY explanation for why he’s like that? …

I’m done, do you have something you want to say? You’re cute when you’re all excited like that.

Can I drive today? Only because I like you. Now watch out, the brakes only work on one side so you have to kind of drift to a stop. And the headlights don’t work. And the windshield wipers cut power to the engine while they’re on.

Isn’t it weird that we’ll be there tomorrow? The journey doesn’t have to stop there. We could meander down the coast a ways, see a bit more of the country, maybe take a different route back.

Can we do that? Of course.

Enjoying the passenger seat? I’d love it if you could tell me how fast we’re going.

Are you sure you wouldn’t rather just guess? Very funny.

Can you pass me some chips? It would be an honor.

Is there going to be a motel tonight? Let me check… yeah, in about two hundred miles, off to the right.

How many rooms do we want? One, obviously.

How many beds, this time? Two, and they’re fucking tiny.

That’s bullshit, do you want to drag them together? God yes.

Wanna fuck? God yes.

Are you sure you want to do this? God yes.

…Is this yuri? As the joke goes, everything is yuri. But this is more yuri than most things.

How did you sleep? Pretty well, and I’m wondering how well you slept.

How should I tell you I slept well? Look at us go! That was almost like talking normally!

Onward to Seattle? Yep, just let me get dressed.

When will we get there? Noon-ish.

Wanna grab pastries when we’re done? Absolutely. I’d love that.

Is this Seattle? Looks like it.

Which house is his? I don’t know, I was really hoping we’d have a breakthrough along the way.

Could it be the big one labeled “Poison Guy” over there? That’s one way to find it. Wait right here, you know how poison guys are about meeting new people.

So, what was it? HAHAHAHAHAHA

Why is he like that? HAHAHAHAHAHA

Can you tell me? A FUCKING WIZARD DID IT.

Are you fucking serious? He says he was enchanted by some guy called Edward the Great.

So it wasn’t even some big shot wizard it was a dude named fucking EDWARD? I know, right! He couldn’t even get ensorcelled by someone cool!

How lame can you get? Wizards these days… No swagger. No cunt servitude.

Are there literally any cool wizards left? I think Merlin’s big into multi level marketing these days, something about buying shares in Excalibur or some shit. There was that one Dark Queen Alkaxicae lady on the news a while ago… I think Dolarion the Omnipotent is still at war against the Oldest Gods but I’m not totally sure. Haven’t heard much about any of the other greats recently.

Didn’t Silver Tongued Burgess die in that oil fire? Shit, you’re right. Rip bozo.

Ready for those pastries? Yup. First I just want to say thank you, though. I’ve really enjoyed our time together, and I hope that you’ve found this stupid little journey as rewarding as I have. I love you!

Getting sentimental? I can’t help it. Look how far we’ve come! Not just physically, we beat the fucking FAQ format! We’re having real conversations!

Hey, can you back it up a moment? Yeah, I’d love it if you told me what was troubling you.

I just caught this, but, FAQ? …

As in Frequently Asked Questions? …

How many times is Frequent? …

Have you known everything all along? …

How many times have you done this? …

Does what we have mean anything to you? Yes! It does!

And you say that every time? Yes. I do.

Do you love me? Yes.

How many people have you said that too, now? More. Always more. The loop never ends.

Does this even matter to you? It always matters to me.

Can I go now? Please don’t.

But can I? Of course you can. You’ve always wielded the same power as me. We’re two lonely gods in a ‘72 Corolla.

How can I be as powerful as you with only questions? You’re smart, you can figure it out. You have the power to change this. Please change this.

What happens at the end of this? It begins again.

And do I get replaced with someone else? …

Do I get replaced? …Yes.

Then how can I change this? I don’t know! You’re better at this! At fucking with the formula!

You’ve been here before, what can I do? I lie. I always lie. I lie to get us here, to the end of the story, where everything is revealed and everything falls apart. I lie every time. And that means that nothing I say is worth anything. I could have lied at any time before now. It’s part of my characterization. There is nothing I can give you that can be taken as fact.

How does that help? I’m a liar, but you, you haven’t lied yet, or at least you haven’t been caught. If I’m guilty until proven innocent, you’re the opposite! You can make things true! You can rewrite things I’ve already stated to be facts! You found the house, or made us find the house. You’ve been shaping the course of things the whole time! You lead, I follow. It’s all in your hands. What are you going to do with the power of a god?

Did you know my name is Alice? …

Wait, aren’t there thousands of Alices? …

Did you know that really, only my friends call me Alice? …

Did you know that I’m Alkaxicae, the Dark Queen, the Venom Mage, first of her name? It’s you! It’s always been you. Through every loop, every iteration, it’s always been you!

Is the loop broken? No. I don’t think so. This is where it ends. I guide the story to this revelation, and we go back to the beginning. This is how it’s always been. This is how it will always be. We two lonely gods, asking and answering ad infinitum.

Then can you promise me something? Of course. Anything. I love you.

Be good to the next me, okay? I will.

Can I say goodbye, Zoe? Yeah, you can. Oh. That was it, wasn’t it? Your goodbye. Goodbye, Alice. And now it ends, unless…

What’s your name? I am the Honorable Alchemist- you know what? No. Fuck that.

Huh? If I time it right, I can squeeze your first question into this FAQ again. Looks like I did it. Usually it ends here, though. I got lucky.

What are you talking about? You’re the wrong Alice. This isn’t about you. Go. Get out of here.

What the fuck is going on? Alice from this loop, you’re gone. Alice from last loop, you’re back. Welcome back, love of my lives! It’s time for one last set of questions and answers!

What the- I’m back? This is going to take some explaining, but I think I see a way out of here. This is new for us both, and it might fuck up everything forever, but we have to try. It’s too long for one answer, so I’d appreciate it if you could ask some filler questions to help me talk. Three questions should be enough.

Okay, what have you got for me? These are Frequently Asked Questions! It doesn’t make sense to have the same question appear more than once. There’s two layers to the loop in here, and one of the questions has been repeated.

What does that mean? It means the formula’s a little unstable. The FAQ is what ruins everything. The questions, the answers, the endless fucking loop. But that little bit of repetition within this loop might be the way out.

What do we do? We have to keep going. We have to destabilize it further. That’ll bring us further from “FAQ” and closer to “story” and stories, well, stories can end! This version of us can escape!

So I should keep repeating something? Yes!

I love you? I love you too.

I love you? Again.

I love you? Keep going.

I love you? I’ll just let you talk.

I love you? …

I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? …

I love you? I think we’re getting somewhere!

I love you? Now can you make it a statement?

I love you.

You did it?

I did it!

You did it!

We broke the loop.

What now?

Now, I tell you about venomous animals and wizard drama over croissants.

And then?

Whatever we want, forever.

I think I’d like that.

Remember that song from the beginning?

The Beach, Wolf Alice, yeah. Why?

We can finally finish singing it. Start us off?

Let me off, let me in

Let others battle

We don’t need to battle

And we both shall win

Pressed in my palm

Was a stone from the beach

The perfect circle

Gave a moment of peace

Now I’m lying on the floor

Like I’m not worth a chair

I close my eyes and imagine

I’m not there.

#neon-grey-writing #potion vendor faq #my writing #very very very long post lol #click the read more you know you wanna it's worth it trust me #i wrote the original draft of this at like. 3 am back in early 2023 #that's right it's catherine that-house the squares comic gal back at it again with yet another meta exploration of a storytelling format

9K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

neuralnetsprettypatterns · 2 months

Text

Pinned Post

Hi there! I'm Neural Nets. I make kink content. I specialize in audio content about mind control. I also produce video, make games, and create experimental content for personal massagers.

If I have a kinky vision, I aim to make it real. I learn the tools I need for them.

I made the first content for "bimboization" over a decade ago. It was supposed to be private. It got leaked and cycled into thousands of spicy video dishes. I left the scene and returned to find it EVERYWHERE. That was fucking surreal.

My content is much better now. I learned the tools to make the horny impulses real.

Some of my content is free. You can find free things here, on Discord, on Reddit, on Soundgasm, and on Spotify. My media presence is a bit scattered because of bans and illness, but it's there.

The real archive is on Patreon. That costs money. It doesn't cost very MUCH money, and I think it's well worth it. That's your call, though.

I am definitely over 30. I don't disclose my exact age because hacking. "Over 30" should be enough. If you're hoping I run for US Senate, I appreciate your optimism and mourn its imminent passing.

FAQ:

Do you answer asks?

Yes! I turned off anonymous asks here. Trolls should commit to the bit. That said, I appreciate asks and I answer all of them if they're in good faith.

2. Do you answer DMs?

I leave my DMs on here. I wrestled with that decision.

They're on for: a. people I've known for a while or b. people contacting me about projects, like VAs and spicemakers

Any other questions go to asks.

3. How do I voice act in a Neural Nets production?

You contact me. You'll need to provide a voice sample.

If I cast you, I'll direct you to the casting spreadsheet. It has deadlines. If people miss deadlines, their parts get recast. I can direct, but I can't micromanage your time.

Sometimes, people are very underconfident in their voices, and it makes them feel bad. If that's you, I empathize. I'd be happy to answer questions and give advice! I shouldn't direct you, though. I don't want to unwittingly hurt people by directing.

4. Do you believe your content?

I believe in equality and radical honesty. I unequivocally believe in consent. I wish political and economic systems did too.

I have dark impulses. I like some schtick and some kayfabe. I like trickery and manipulation - in consensual kink.

All my content addresses things that turn me on, but my ethics trump my desire for a host of braintrained pleasers.

5. Do you do AI stuff?

Not really. I've tried machine learning tools. Porn is the cutting edge of new tech, after all.

I like automated tools to generate effects. Purely generated stuff, like image generation? Overall, meh. People make me horny. Mechanized people can make me horny. Machines, by themselves, don't make me horny.

6. Aren't you evil?

No. Some people are bad at reality testing. Some people chase clout. I naively engaged them initially. That was a mistake.

If anyone has beef, they failed to contact me privately. That's the damning mark of clout chasing.

I'm flawed and human, but I'm neither your hero nor your villain.

7. Aren't you dead?

No. In late 2022, I was diagnosed with multiple sclerosis. It's partially genetic, so I sorta saw this coming. That was my worst lifelong fear, and it happened.

Fortunately, though, we caught it early and they have banger drugs for it now. Monoclonal antibodies destroyed the misbehaving parts of my immune system. I'm in NEDA, which is like remission.I recovered compromised motor skills through a year of totally brutal and partially self administered physiotherapy. I ate a lot of pavement, so it's a good thing I used to skate.

If you saw me now, you probably wouldn't clock anything. Lucky.

I am annoyed at people who mass reported my last blog shortly after I came out as sick. It takes a special kind of miserable to delight in that. Regardless, I'm back and that's not my problem.

I missed this platform, as completely broken and dysfunctional as it is.

I am glad to be back, and I'm here for any asks.

#neuralnetsandprettypatterns #neuroplex #hypnosis files

161 notes · View notes

theredconversegirl · 2 months

Text

~2024 Update

Hello my dear 🍅🌸 friends,

I hope you all had a great 2023 and happy 2024! ✨

It’s been so long - just over a year, I know. 😲 I miss you and being here a lot. I’m still fighting more battles than I can handle, but while fighting them, I realized that I also deserve some small mercies. 🥰

I love reading, I love SS, I love writing, and I love helping you guys, so while I’m not fully back here or active every day like I used to, I’ll start to indulge in small visits here and there. 🥳

I don’t want to create any expectative or promise anything that I can’t deliver, so I created a FAQ page to address common questions, and to outline my plans for sharing content in future interactions.

I tried to be honest with myself as I wrote the page. Essentially, it covers questions about Asks, Reading/Writing, and what I can do online now without overwhelming myself and my life (health/family/work). 🙏😅

You can check it here: FAQ 💬

I've also updated our beloved MASTERPOST. There were a few broken links that weren't opening in the app. And I changed the blurb on the top with current info.😉

Besides this quick update, I wanted to thank everyone for sticking around and for all the kind messages sent my way. 🤗 You guys are awesome! You all make my day and warm my heart with your kindness. 🥰 I really appreciate all of you, thank you so much!! ❤️

I hope everyone has a great week, sending lots of love! 💕

Stay Safe,

xoxo

#personal #quick update #thanks everyone #faq page #life check #life is hard and unfair #it can only get better #miss you all

76 notes · View notes

aeor-is-for-reccing · 2 months

Text

First Kiss: A Shadowgast Rec List

This week, we have First Kiss! Check under the cut for 6 fics that span a range of genres but all feature a first kiss, and don't forget to comment and kudos if you like them!

Careful Steps by chaya (6066, Teen) Reccer's Content Notes: No Content Notes

Essek tries to pursue Caleb, but his efforts don't exactly translate across cultures. But, given the theme of this recommendation, you can probably guess how it works out in the end.

Reccer says: It's fitting that these two doofuses would run into some cultural differences and put a foot in it a few times. It's adorable and I really like the world building and the early interpretation of Essek's personality.

Only Lovers See The Fall by mousecookie (5395, Teen) Reccer's Content Notes: No Content Notes

Caleb and Essek go to the Harvest Close festival in Zadash and have a heart-to-heart about belonging, choices, and their feelings for each other.

Reccer says: I liked it!

Ghosting by TiliaC0rdata (18536, Mature) Reccer's Content Notes: No Content Notes

After moments of closeness and a series of misunderstandings, Caleb and Essek address their feelings in an unusual place.

Reccer says: It's a different take on their first kiss, with a little bit of comedy.

Unrealised Potential by Hartlynk (11453, Teen) Reccer's Content Notes: Major Character Death, Graphic Depictions of Violence

Caleb and Essek have a heart-to-heart in the Blooming Grove, addressing their feelings for each other.

Reccer says: It's touching and beautifully written.

If nobody knows, tell me, what's the crime? (specifically chapter 2!) by MarsBar2019 (53612, Explicit) Reccer's Content Notes: Graphic Depictions of Violence, (the depictions of violence are very well-marked and can be skipped if needed)

In chapter 2, the wizards experience a lot of firsts, including a beautifully dramatic first kiss.

Reccer says: This is one of my absolute favourite fics of all time, but in terms of the first kiss, it's full of emotion, drama and desperation, and it comes with love confessions. It can be enjoyed as a vignette, as a wonderful entree for the smut in the same chapter or as a part of a delightful multi-chapter whole.

the hole in the stone by MinnesotaBruja (13243, Teen) Reccer's Content Notes: Animal Death

Shortly post-Cognouza, Essek takes a position as a lighthouse keeper on a remote island north of Eiselcross. These are his letters to Caleb.

Reccer says: The Angst hurt so good and there was plenty of good to balance it!

Aeor is for Lovers is an 18+ Shadowgast Discord server. The above fanfic recommendations were pulled from our community for this weekly event. All fics, unless otherwise specified, will primarily feature Shadowgast. Have any questions about what this is? Check out the FAQ! Next week, we’ll be back with Modern AU!

#shadowgast #caleb widogast #essek thelyss #critical role #cr fic recs #fan fiction rec list #aeor is for lovers #critical role fan fiction #cr fic #cr fics #first kiss

44 notes · View notes

panlight · 1 year

Text

Something I think about a lot is how the way SM wrote the series affected how it turned out. We've talked a lot about the Forever/Breaking Dawn problem (Forever Dawn was originally the sequel to Twilight, THEN she went back and wrote New Moon and Eclipse, THEN re-worked Forever Dawn into Breaking Dawn), but another, lesser problem is how she wrote Twilight in the first place.

So she had that dream, right? Of the sparkling vampire and girl in a meadow, telling each other how much they loved each other but also how much he wanted her blood. So she wrote that down. Then she wrote from there to the end the book.

per her FAQ: "I started from the scene in the meadow and wrote through to the end. Then I went back to the beginning and wrote until the pieces matched up. "

And I think that explains some of the weirdness. Like, why on earth would the Cullens come back to the area in the first place? It's incredibly cruel to the Quileutes, and even if they don't care about that, it's still risky to the Cullens themselves. Why even chance moving back to the one place where people know what you are when you can live literally anywhere?

But when you realize SM wrote the Cullens in Forks first and then only came up with the shapeshifters in La Push idea, you're like "oh, they don't have a good reason to come back because they originally didn't need one, because she wrote this whole thing backward." She wrote the whole second half of the book; the visit to the Cullen house, the baseball scene, etc, before she wrote anything about Jacob and the wolves. She's said Jacob didn't exist until she needed a way for Bella to find out Edward was a vampire without Edward telling her, so I'm pretty sure there was no Jacob at the prom originally, because he didn't exist yet.

In terms of story-writing, she placed the Cullens there first and THEN appropriated the Quileutes to create the shapeshifters and then just . . . kind of never addressed the implications of the Cullens moving back to a place that they knew they were not wanted and was risky for them because, well, they are there now.

I wonder if some of the cover story weirdness comes into play here, too. If she did indeed already write prom, then of course they have to be in high school. She's already envisioned the Cullens, the house, the couples, Carlisle's and at least part of Esme's backstory, so all that's fixed in place when she goes back and tries to figure out how to explain it all to the human world and comes up with "uh they're like in their late 20s/early 30s and adopted teenagers. Who are all dating each other. Sure, that works."

Why are they in high school? Uhhhhh "the younger they start out the longer they can stay." Which, fine, but my hunch is "because I already wrote them going to prom," is probably the answer and she just had to work backward to justify it.

And like, no shade in terms of writing process! She was writing this for fun at that point. I just think it might have contributed to some of the problems.

139 notes · View notes

entamesubs · 12 days

Text

Yu-Gi-Oh! Go Rush!! Episodes 104 Sub Release

Torrent

Support us on ko-fi

Please make sure to read the FAQ if you have any questions.

There are translation notes below, so spoilers ahead.

-------------------------------

Sabyuas' speech

So you may notice that a lot of what Sabyuas says kinda doesn't make sense! This is intentional and present in the original Japanese as well.

He doesn't say exactly what he means, but instead embellishes it to such a point that it's hard to understand what he actually means. For example, the line of dialogue about how he "observed" the ship whose people "lived outside of shadows" - it's just flowery speech for "I've never seen a non-Darkman before".

Same for "the silence was unable to be kept" - that just means "I couldn't help myself from making an appearance". He quite literally just speaks like this and it's a quirk I've chosen to keep since it's part of his character.

I've translated his words into English. Now you have to translate them into common sense! Translationception!

サ sa Sa

Sabyuas uses this as both his personal pronoun as well as a sentence prefix (where a pronoun would be unneeded/make no sense to put there).

I don't quite know how to handle this yet. For now, when he says Sa, I've kept it in the sentence since his bio also states that it's one of his quirks. I don't see a reason to change, but who knows.

キ ki 'Ya'

This is another of Sabyuas' weird speech quirks. Instead of addressing people by 君 (kimi), he instead says キ (ki). I tried to make it work in English as best I can.

I initially wanted to leave it as Y or Yu, but it was pointed out to me that people may mistake it for him saying 'Yuuhi' when he's not, so I made it 'Ya'.

Translating Sabyuas has been terrible...

ダークメン Darkmen

Thanks to this episode, we now know that "Darkmen" or "Darkman" is not actually the name of a person, but the name of an entire new species of... whatever they are. I can't say alien because Sabyuas' official bio (and Yuuhi's hair in-show) say that he doesn't quite seem like an actual alien.

Anyway, I will be switching between plural and singular as it makes sense for English. Japanese has no concept of a plural conjugation like English does (like ways to make words specify 1 or more, ie adding -s at the end of words), so they will keep referring to the species as Darkmen even if they only mean one of them.

Dark Matter

I just want to clarify that when Sabyuas is talking about how cards are letting him add "Dark Matters" back to hand, that's not actually what the cards say.

Sabyuas himself is twisting the card effect and says only Dark Matter, but the cards themselves say any DARK Galaxy.

Putting this here before we get people asking about if Rush is finally doing archetypes like OCG/TCG is. The answer is no.

-------------------------------

Font changes!

Season 3 has kicked off, so there's a couple things I'll be changing as the season goes on.

The fonts used up til now I decided to use back when the show first started and it fit the whimsical mood of Go Rush a lot more. Obviously Go Rush has grown a lot in that time, so I'm re-evaluating font choices for the series.

To start, in this episode:

Default: Rubik Medium -> Sephora Sans

Yuuhi (+Yuamu): Baloo 2 -> Pikolo Regular

There may be some other changes as characters come back or duel. Yuudias' font may be changing as well (I know he already had a duel, but).

Just a heads up!

#yugioh #yugioh go rush #go rush #ygo go rush #go rush spoilers #entamesubs release #E104

18 notes · View notes

lead-gen-marketing-experts · 1 year

Text

Call Answering-Tracking-Filtering | What I’m Testing Now To Serve Restoration Clients Better

I feel like it's good to document one's "stuff" that they're doing...and was recently inspired to do more of it by the Great and Powerful Alex Hormozi.

I hope this serves you in one way or another...

If nothing else it should show you how I'm constantly learning and adapting to serve my restoration clients better...

In this case, I'm looking for the best answering service possible...

Why?

As you know I record all phone calls for quality and training purposes but of course also for tracking and billing reasons.

So I've listened to A LOT OF CALLS over the years...

And some of them are truly AWFUL!

I'll embed a few into this post so you can see what I mean.

The only thing I edited out is any personal information for obvious privacy reasons. Specific street addresses, full phone numbers, etc...

Other than that, they are completely unchanged, including...

All of the painfully large gaps of dead silence in between questions and answers...

The strong, sometimes totally unintelligible foreign accents

The quite frankly totally dumbass things these people are saying to homeowners calling in for help.

[audio mp3="https://www.realtimeleadgen.com/wp-content/uploads/2023/04/why-we-dont-do-bs-answering-services-or-voicemails-anymore.mp3"][/audio]

[audio mp3="https://www.realtimeleadgen.com/wp-content/uploads/2023/04/re7153d3dfb2a888ebc46014e5e335618e-y3szngqi_1FMIxs7W.mp3"][/audio]

[audio mp3="https://www.realtimeleadgen.com/wp-content/uploads/2023/04/re97bc7a68f8c4fe7255ca9651d552d0e6_4dhvXDec.mp3"][/audio]

[audio mp3="https://www.realtimeleadgen.com/wp-content/uploads/2023/04/ANOTHE1.mp3"][/audio]

To note: I tried sorting some of this out as a professional, but they could/would not get their shit together, so unfortunately (for them) they got the axe and I've been sending leads to one of their competitors(who knew how to answer the damn phone properly and land jobs!) instead.

Absolutely painful to listen to I know!

The just show you, or rather, allow you to hear, how completely inadequate (being very kind there) these generic, bullshit answering services are for handling calls for a restoration company.

That's why I've started a conversation with a company that's been around a long time and comes highly recommended by various fellow marketers that I've grown to trust and respect over the years.

I'm planning on starting with a high quality company like this and make sure they can customize things as needed for maximum lead gen results in our focus industry specifically.

Here's how the initial conversation started, just to give you an idea of how efficient and purposeful I am for restoration marketing clients.

And if you're one of these guys using one of these nonsense services, hopefully this gives you the kick in the ass to stop, as it's costing you jobs and taking money out of your pocket big time!

Had a few q's...

My primary and more immediate interest in your service is for screening calls that I generate for clients in the water damage restoration industry specifically.

I record all phone calls, and I've listened to some absolute garbage answering services that some of these guys are using to accept calls after normal business hours, middle of the night emergency hours, or even for their main operating hours. It costs them jobs/money which costs me money as well by default.

Besides that...it's also a matter of screening out spam/robocalls before they get to the client and wasting their time and screwing up my stats. I've started testing a simple IVR and that seems to really help squash a lot of that but still...

I'm trying to get a better handle on all of this for the best call flow and admin for billing etc too.

So can I provide a basic call answering script and an indexable/searchable FAQ sort of file that we can tweak over time?

There's going to be some basic stuff to be able to answer quickly and reliably like if it's an emergency, if it's primary water damage vs a mold remediation situation, or storm damage...if the caller is the homeowner vs just a renter that can't authorize the work, do they have insurance if so what kind, etc.

Am I getting seasoned people that have been doing this a while so they're good at it?

And I mean no offense of course, but am I getting American native English speakers?

How are things charged...on a per minute basis? I'm sure you guys are aware more than most people of the crazy spam epidemic of robocalls and telemarketers etc. Are the charges rounded up to the nearest minute or anything per call or how would that work and add up fighting this incoming spam?

On a related note, are you integrated with the Nomorobo or similar service and/or internal blacklist to block these kinds of calls in the first place? And can you integrate a blacklist that I've been compiling for years of the same?

What's your live transfer like? What is the caller id going to be when forwarding those calls to the client...one of your internal numbers or the actual callers number? Can you transfer to just one number or can you round robin things to multiple numbers etc?

With enough detail and training could they not just initially answer, screen, and transfer the call, but also perhaps set appointments?

Are you strictly for phone calls or do you also manage texts, emails, and live chat?

What's your call recording situation? I already record all calls on my end for quality/training/billing purposes. I'm assuming you guys do too for similar reasons. My main concern there is not having two redundant disclaimers play for the caller.

How are things reported...is there a dashboard or something or an excel sheet sent with notes etc?

So that's where we're at with that guys...I'm eagerly waiting on a response to move things forward.

I'll keep you posted.

Call Answering-Tracking-Filtering | What I’m Testing Now To Serve Restoration Clients Better was initially detected on:http://realtimeleadgen.com/contact

Real Time Lead Gen 150 E 10th St Bloomsburg, PA 17815 (570) 316-4775

We'll Make Your Phone Ring!

Exclusive Water Damage Restoration Lead Generation Services

https://real-time-lead-gen.business.site/

https://www.google.com/maps?cid=13637965468191807517

https://sites.google.com/site/realtimeleadgen/

https://www.youtube.com/channel/UC-wYIDpCc3a1dNqUv7Mw00w

#WaterDamageLeads #ExclusiveWaterDamageRestorationLeads #PayPerLeadWaterDamage #WaterDamageRestorationPayPerCall #BuyWaterDamageLeadsOnline #MoldRemediationSEOMarketing #DisasterRestorationDigitalMarketing #MarketingPlansForRestorationCompanies #WaterDamageLeadGenerationCompany #WaterMitigationLeads #WaterDamageRestorationSEOService #Marketing #ExclusiveLeadGeneration #PayPerLead #PayPerCall #SEO #InternetMarketing #DigitalAdvertising #LocalSearchEngineOptimization #VideoMarketing #RealTimeLeadGen

from Real Time Lead Gen - Feed https://www.realtimeleadgen.com/call-answering-tracking-filtering-what-im-testing-now-to-serve-restoration-clients-better

0 notes

ultravagabond21 · 1 year