Every time I click on @changes to view the shitshow that is whatever the fuck @staff is doing to tumblr this week, I don't know what's more rage-inducing: watching this site slowly but surely become yet another carbon copy of every single other social media site in existence, or the absolute barrage of complaints from users going completely ignored/unacknowledged by @staff. Literally every "update" post is like:
Anyway why do I have a big fucking annoying "turn your computer off before 12/31/99" sticker on my dash? I can't ignore it bc it keeps fucking moving, but having to click on it to see some new fucking whimsical nonsense tumblr occasionally decides to launch instead of dealing with the porn bots just makes me even more pissed off at this hellsite than I was before.
12 notes
·
View notes
Tumblr app put the post button back in the centre of my control bar and not hovering over posts so I accidentally click on the wrong thing challenge
5 notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Background:
Hello everyone! I am thrilled to announce my updated and more user-friendly challenge. If you are unfamiliar with me or my challenge, let me introduce myself. My name is SimfinityPlays, but you may recognize me as HopesBecameOurNightmares. Recently, I have revamped my channel, Tumblr, and Challenge with a new name and appearance. This challenge is dear to my heart because I designed it for simmers like me who get easily bored. This challenge allows complete creative freedom to those who create sims for it! Please keep in mind that these rules are merely suggestions rather than strict requirements.
Creation:
I created this Let's Play when I had a lot of free time. Now, I've updated the rules for better gameplay and more activities to enjoy. You can find it
HERE
Below are the links to my YouTube channel, Tumblr, and other relevant websites:
YouTube
Tumblr
Generation One Sim Download
Gshade Preset Folder
You can find a few recommended mods linked below, in case you prefer to download them beforehand instead of during the challenge. The mods are as follows:
McCommand Center By Deaderpool (How to make your sims' teenage sim runway )
Functional Mill By Icemunmun (This mod allows you to make many ingredients while being self-sufficient in the sims Ie; no Market!!)
Basemental Drugs and Gangs (Only Gangs Require Get to Work) (Allows the criminal generation to be more realistic)
Any World Residental By Zerbu (This mod opens up Granite Falls as a living option for the hobbit generation)
Chore By Littlemssam
Delinquent Teens by Adeepindigo
Thanks Guys!
XOXO,
Simfinity <3
4K notes
·
View notes
here's a list of mozilla add-ons for all of you tumblrinas out there to have a better internet experience
also, if you like my post, please reblog it. Tumblr hates links but i had to put them so you adhd bitches actually download them <3 i know because i am also adhd bitches
BASIC STUFF:
AdGuard AdBlocker / uBlock Origin : adguard is a basic adblock and with origin you can also block any other element you want. for example i got rid of the shop menu on tumblr
Privacy Badger : this add on will block trackers. if an element contains a tracker it will give you the option to use it or not
Shinigami Eyes: this will highlight transphobic and trans friendly users and sites using different colors by using a moderated database. perfect to avoid terfs on any social media. i will explain how to use this and other add-ons on android as well under the read more cut
THINGS YOU TUMBLINAS WANT:
Xkit: the best tumblr related add on. with many customizable options, xkit not only enhances your experience from a visual standpoint, but provides some much needed accessibility tools
bonus: if you are into tf2 and wanna be a cool cat, you can also get the old version to add cool reblog icons
AO3 enhancer: some basic enhancements including reading time and the ability to block authors and tags
YOUTUBE
Return of the YouTube Dislike : pretty self explanatory
Youtube non-stop: gets rid of the annoying "Video paused. Continue watching?" popup when you have a video in the background
SponsorBlock: gives you options to skip either automatically or manually sponsors, videoclip non music sectors and discloses other type of sponsorships/paid partnerships
Enhancer for YouTube: adds some useful options such as custom play speed, let's you play videos in a window and most important of all, it allows you to make the youtube interface as ugly as your heart desires. I can't show a full image of what it looks like because i've been told its eye strainy and i want this post to be accessible but look at this <3
PocketTube: allows you to organize your subscriptions into groups
YouTube Comment Search: what it says
FINDING STUFF
WayBack Machine: you probably know about this site and definitely should get the add on. this allows you to save pages and access older versions with the click of a button. while you can search wayback using web archives, please get this one as well as it allows you to easily save pages and contribute to the archive.
Web Archives: it allows you to search through multiple archives and search engines including WayBack Machine, Google, Yandex and more.
Search by Image: allows you to reverse image search using multiple search engines (in my experience yandex tends to yield the best results)
Image Search Options: similar to the last one
this next section is pretty niche but...
STEAM AND STEAM TRADING
SteamDB: adds some interesting and useful statistics
Augmented Steam: useful info specially for browsing and buying games
TF2 Trade Helper: an absolute godsend, lets you add items in bundles, keeps track of your keys and metal and your recent trades, displays links to the backpack tf page next to users profiles and more. look it tells me how much moneys i have and adds metal to trades without clicking one by one oh may god
IN CONCLUSION:
oooooh you want to change to firefox so badly, you want to delete chrome and all the chrome clones that are actually just spyware and use firefox
HOW TO USE MOZILLA ADD-ONS ON YOUR PHONE
if you already use firefox on android, you'll know there are certain add-ons compatible with the app, some of them even being made just for the mobile version such as Video Background Play FIx. while most of them are pretty useful, some more specific ones aren't available on this version of the browser, but there's a way of getting some of them to work
you need to download the firefox nightly app, which is basically the same as the regular firefox browser but with the ability of activating developer mode. you can find how to do that here.
once you've enabled it, you need to create a collection with all the add ons you want. i wouldn't recommend adding extensions if the creators haven't talked about phone compatibility, but XKit and Shinigami Eyes should work
also, don't tell the government this secret skater move, but you can try using both the regular firefox browser and nightly so you can have youtube videos in a floating box while you browse social media.
see? i can block this terf while Rick Rolling the people following this tutorial. isn't that tubular?
2K notes
·
View notes
I am putting out a warning for the blog @/blktransdyke for very likely being a scammer, and is/was the same person behind the now deactivated blog @/raisedeyebrowemojii (who is also very likely a scammer) for the following reasons:
Usage of a very common story one particular scammer constantly reuses across multiple blogs (which i've talked about here before)
Several typical scammer red flags: Their blog has only existed since April 2023, and they started asking for money immediately. The blog only posted for the month of April and then did not post for months only to come back in January 2024, and start asking for money again
Their blog is sparse of anything denoting a personality, personal interests, friendly interactions with mutuals or followers, aesthetic choices and/or blog customization, and the only thing they reblog is also mentioned in their bio, thus indicating a falsified persona for a scam blog. (Ex: they say they are a lesbian, and so have a few posts about lesbianism, and the rest of the posts are almost exclusively fundraising posts)
Inconsistent information
Suspicious behavior on twitter, which was also noted and called out on twitter
Claiming to be homeless, but apparently rejected the non-monetary aid from another user who offered to house them
Claims to be "Indigenous" but then misuses the terminology of their alleged tribe (thus likely indicating racefaking for a scam persona)
No proof of their claims
Posting the same personal information as two other suspicious accounts while call three claim to be different people (& this is connected to the raisedeyebrowemojii blog)
& you know me, I always come with screenshots and proof. Image descriptions will be available in Alt text. (& please bear with me, some screenshots lead to imgur due to tumblr limiting images to 10).
First off, the suspicious story that is often reused by one particular scammer:
There's a scammer on here that ALWAYS uses the same story of:
Claiming to be trans,
claiming to be homeless,
Says they are homeless because they were/are being kicked out by a bigoted/homophobic/transphobic parent
Shows a screenshot of a IM or text message correspondence between them, and their alleged parent, where the parent is being abusive, and the messages always very concisely, very conveniently mention what is happening
Usually says they are disabled in some way (though before they would usually claim to be autistic)
The blktransdyke blog has all five of these things.
Im putting the rest under the cut because this is gunna get long, buckle in.
Secondly, inconsistent information, rejecting non-monetary aid, & suspicious Twitter activity (& this is also connected to the creation date of their tumblr account, which you'll see in a moment):
The blog blktransdyke uses two methods of recieving money, gofundme, which is linked on their main page and is run by someone named "Avalon Smith" (& we can assume this is the name they prefer to go by, because they have the tag "avalon speaks" on their blog), and this gofundme account says its based in York, Ontario. And the second is paypal, which uses a different name, which is "Ashton Jones" & the paypal url of "/ashtonjonesy". Below, the first screenshot on the very left, is a screenshot of the first post they made asking for money on April 14th 2023 while linking to the gofundme account, and then the second screenshot to the right is the blktransdyke's more recent donation post asking for money to be sent to the ashtonjonesy paypal account, and then here is a link to a screenshot of the gfm run by "Avalon Smith".
The consistencies are odd: and while one might think that "Ashton Jones" is an older name or a dead name, but if you search up "ashtonjonesy" in a search engine, you get two results: one leads to a post made by a now deleted twitter/X account with the url "blktransdyke" while using that same paypal (so we can assume this is the same person from twitter/X) and the second is ANOTHER twitter account, still up, that is completely different, also using the twitter url that is the same as the paypal username (/ashtonjonesy) who also claims to be homeless & kicked out by a transphobic parent, but says they have different pronouns than blktransdyke & seems to be transmasc, not a binary trans lesbian that blktransdyke claims to be. Below is screenshots of that.
But what's more troubling: the second twitter account @/ashtonjonesy on twitter/X says that they were 24 years old as of July 2021, while blktransdyke claims that they are 21 as of January 2024. So this can't be the same person using different names and twitter accounts, and yet curiously both are using the exact same story (both claim they are trans, homeless, and disabled & using a wheelchair), and both use the exact same paypals, while are apparently two completely different people. And again, we know that there is a scammer who repeatedly reuses the exact same story details across various accounts
And then, more concerning, that if you search up "blktransdyke" on twitter, while the original posts by the account are gone due to the account being deleted, you get results of various Twitter/X users retweeting the account blktransdyke's post, which was them asking for money. The bottom screenshots are related to the next point: highlighted in yellow you can see someone offering blktransdyke a place to stay, and they live in the same province, and the second screenshot, highlighted in blue you can see that on April 12th 2023, a twitter user accused them of being a scam. We can assume the blktransdyke account wasn't taken down yet that day due to this user encouraging other users to report them.
Recent tumblr creation date:
The oldest and first post made by the blog blktransdyke on tumblr was posted on April 14th, 2023. And as you can see, that was two days after the blktransdyke twitter/X account was accused of scamming. So the blktransdyke twitter account was accused of scamming, then was either deleted or self deactivated, and then the blktransdyke tumblr account showed up immediately after that while using the exact same paypal and story. Which brings us to the other half, which is
Rejecting aid
On this screenshot we can see in a retweet of what the original blktransdyke twitted/X account originally said in the post, and that on August 22nd 2022, they claimed they were still homeless, so apparently they didn't take up the person in Toronto who was literally offering them a place to stay on September 2nd, 2022 (which you can see in the screenshot above, on the second last tweet result to the right).
Claims of Indigeneity & inaccurate terminology:
This one is more minor compared to the other evidence listed here, but in blktransdyke's bio, they claim to be "Inuit" & "Afro-Indigenous": the problem here is that "Inuit" is the plural form, its uncommon that Inuit refer to themselves as this in the singular pronoun because it is grammatically incorrect and an actual Inuk would know that, and instead will use "Inuk" to refer to themselves, but blktransdyke says they are "Inuit". So this terminology is inaccurate coming from a person claiming to be "Indigenous". & just in case they change it, here is a screenshot if their current profile description. Moving on,
Posting the same information as another blog
This is where things get more wild. I have reason to believe that the now deleted blog @/raisedeyebrowemojii ("Jay") is and was a scammer who befriended multiple people to gain trust, and that blktransdyke is the same person as them due to the information that both blogs posted. A couple things to note here is that 1. Raisedeyebrowemojii claimed that they were suffering due to a terminal kidney disease, 2. ALSO stated that she was escaping an abusive situation, was a lesbian, was homeless, and was victimized by a homophobic/transphobic parent, and 3. Had not posted anything since June 2023, before eventually being deactivated. Some of the users "Jay" befriended worried that she may have died due to this apparent kidney disease (which you can find in the tumblr search if you look up that tumblr username). Now, I can't find any paypal that "Jay" posted, but they DID post several other links allegedly that were being used for their donation posts
In this post, graciously saved on webarchive for your viewing pleasure, on May 16th 2023, @/raisedeyebrowemojii claimed that they needed a mattress, and also linked a patreon for allegedly their "best friends'" and "caregiver's" cat, named Trouble 📌. Put a pin in that, we'll come back to it. Below is a screenshot of that post where they linked the patreon. Notice that it's a brown, striped tabby cat. And here is the patreon link (which is still up) that the @/raisedeyebrowemojii blog linked for their "best friend's cat" that was apparently meant to be used to fundraise for their day to day life bills. It doesn't have a lot of patrons or followers. Below is a screenshot of the link I gave for webarchive talking about fundraising for the mattress, and the cat patreon.
Also note, that neither this post by raisedeyebrowemojii nor in the patreon does it link to any other site for content on "Trouble the cat". It vaguely mentions a private Facebook page, but doesn't give any links.
And the blog @/blktransdyke posted this video as well as THIS video, and in both videos, they claim that this brown, striped, tabby cat is their "best friend's cat" 📌. Below are screenshots showing its the same cat, including the same black and yellow blanket.
So both the blogs @/raisedeyebrowemojii AND @/blktransdyke posted a cat that looks very similar: it's brown, a tabby, and striped, and both said that this cat was their "best friend's", and raisedeyebrowemojii said that this cat's name was "Trouble" & referred to them as "Trouble the Cat" in the linked Patreon allegedly belonging to their "best friend". Except here's the bigger problem.
Trouble the Cat is already an existing open, publicly available facebook page with 27K likes and 42K+ followers, and it has its own YouTube page, tiktok account, and Instagram. And if you look at the far top right video on the second screenshot showing the youtube channel, it's the exact same video that appears on the blktransdyke tumblr page. It's the exact same brown, striped tabby cat, in the exact same grooming position, on the same black and yellow blanket, with the same thumbnail, and the exact same caption.
So both Raisedeyebrowemojii AND blktransdyke posted the exact same cat that allegedly belongs to their "best friend", and both of them claim to be homeless, trans, disabled, and being kicked out by a transphobic parent.
& if you go to the links, the official trouble the cat's first instagram post was made on December 23rd 2022, its oldest youtube video was posted on December 23rd 2022, and the facebook says it was made on March 30th, 2021, HOWEVER, the account says they've been active since 2008, but made a post on November 15th, 2023 that said they'd been hacked and made a NEW account, and furthermore, on November 7th 2023, they ALSO made a post saying that multiple other accounts were trying to impersonate them. So, side note, this account could have been hacked by the scammer.
The raisedeyebrowemojii linked that cat patreon on May 17th, 2023, and the oldest video that the blktransdyke posts of that cat is on January 6th, 2024. Both therefore, could have plausibly and likely did, steal these cat videos because all accounts of the troublethecat social media accounts existed BEFORE either raisedeyebrowemoji OR blktransdyke posted them. I find it highly unlikely that both of these blogs had the exact same "best friend".
And if this was true and that this really WAS raisedeyebrowemojii's "best friend" and their cat, then why didn't raisedeyebrowemojii blog link to the other official troublethecat social media accounts, especially since they were so popular, and they claimed they were using this patreon for fundraising for bills? And why didn't the official social media accounts ever say anything about raisedeyebrowemojii's patreon if they were "best friends" trying to fundraise? Surely, an account with 42K followers would have more than a few willing patrons that could have helped their alleged situation.
Therefore, neither raisedeyebrowemojii OR blktransdyke are actually affiliated with this highly popular social media account of "Trouble the Cat" and BOTH of them stole from this account to scam, and both accounts wrre/are run by the same person.
735 notes
·
View notes
There's a lot of reasonably frustrated but ultimately misdirected psa-style posting about how viewers NEED to start reblogging things rather than just liking them because that is the primary mode of post circulation on this site. The modern manifestation of this sentiment seems to miss the fact that, if you've been here for ~15 years, were here prior to, during, and after the exodus to the bird app, you already know that likes have always been more common than reblogs, that many people simply don't want to put your art on their blog, and that guilting end-users into using a microblogging site A Specific Way absolutely does not work. If it did, the trend would have shifted a decade ago. Because this conversation really is that old. Regardless, the modern discourse of how difficult it is to be Seen specifically on Tumblr isn't productive because I think it ultimately misses the reason being an artist online feels so Bad, now.
The social media era has funneled Looking At Stuff on the Internet into an economy of engagement that encourages end-users to treat everything we/they see as quick, cheap, and disposable. This is just another fun and flirty way that capitalism devalues art. It's nothing new. Trying to force masses of users to behave in a way that is healthier for the circulation of art isn't going to do anything to solve the discontent we all feel when we hurl something into the void and it is ultimately ignored. I swear up and down: A higher notes number won't feel better, either. Popularity is just as demoralizing as radio silence, but it manifests differently. Instead of 4 likes and maybe 1 reblog from Old Faithful Mutual, you get a horde of people who treat you like a content machine. You keep hoping for an impossibly Bigger Number. The notifs on the first Big Number Post haven't even settled, and people are already asking when the follow-up is coming. You get anons, but most of them are trying to passively convince you to give them More Content.
It's really, really hard to make people care about art. If there was a silver bullet for making the average person appreciate the enormity of human effort behind every beautiful thing they encounter, we would have found it centuries ago.
The best thing creatives can do for their lives online is to be friendly, or at least kind, with other creators. "Big" artists don't form in-groups because they're snobs. They find each other because they casually showed each other support, and their mutual appreciation for that Thing that wound them up in the same tag becomes a foundation for connection, and in many cases, the ever-illusive Bigger Audience as they introduce themselves to each others' circles. We get more eyes on our work by building community with each other.
Where does that leave people who are just here to look at things, not post them? I think the answer is almost identical: COMMENT!! Please, comment! The first step to engaging with art on a more meaningful level is to point out something you particularly enjoy about a given work. It can go in the replies, it can go in the tags, doesn't matter!! If you notice some symbolism or make some connection, there is all likelihood that OP put it there because they desperately wanted somebody to notice it. Let them know why you like it!
Reaching for the nebulous, impossible goal of better post circulation isn't going to make being a creator online in 2023 suck less. Meaningfully connecting with each other can, will, and does. You can make someone's day just by passingly letting them know that their effort is worth more than a number.
957 notes
·
View notes
If I were to give any advice to a former twitter user (aka new tumblr user) it’d be:
Stay anonymous. Use a nickname or something ESPECIALLY if you’re a youngin’
Turn off public likes/following in settings.
Say nice things in the tags when u reblog art/writing/edits/gifs/etc. because every op (original poster) reads those and it makes their day
Block any corporate account you come across (this excludes small business, please support them if you like their work!)
Also block celebrities! You wanna follow what they’re doing? Go to their Instagram. This platform is one of the last places where we can be ourselves and not monetize our interests. We like it that way.
You can organize your blog! Use [#tags like this,] without the brackets to keep track of aesthetics you like or funny posts! It’s also nice if you wanna have a well kept blog for people to enjoy and look through your organized blog.
There are tumblr holidays and you’ll learn to love them <3 they’re silly and tbh it’s this community made culture that really makes this place special
There are a lot of millennials on here that are so sweet and amazing and they post about their interests and skills in their fields like history, cooking, art, science, etc. They’re a lot more friendly than the tiktok millennials that tried to start beef with teenagers. Be nice to them.
Follow @neil-gaiman he’s the coolest one here!!
Tumblr isn’t really what it used to be, like what it’s unflatteringly famous for… it’s pretty calm and fun here on most days. A lot of us are grown and know better than to start fights. (It’s not perfect obvi but it’s alright)
If you see an amazing resource that it’s best to not share, DON’T TALK ABOUT IT ON TIKTOK. That’s how we lost the library website. Appreciate these treasures. Don’t use them for an hour of internet clout on the worlds worst app.
Reblog stuff!! That’s how posts stay alive a decade after the op posted it. It’s still good and we love a chuckle and the nostalgia if you’re old enough to remember it
5K notes
·
View notes
Let's Talk About Baeddels.
An (updated) retrospective on Tumblr's movement to make gender essentialism trans-friendly.
This post contains excepts from a longer article on Medium. If you have the time, please read the full article! I also request that you link the longer article if you use this as a source.
All links have been updated with archived versions of posts that have since been deleted (and otherwise might be deleted or lost sometime in the future). I have revised some sections, and included more context and examples, in order to clarify and strengthen arguments.
Disclaimer
Transmisogyny is real, and requires much more acknowledgement than it currently receives. The trans community is very much capable of transmisogyny, and often does enact or enable it; likewise, trans people also often enact and enable transphobia against other parts of the trans community. Trans women suffer at least as much as the rest of us, and trans women — as a class — are not privileged, and do not hold the power to oppress anyone else.
If you take only one thing away from this post, take this:
Trans people all need to work on being better allies to each other. None of us can gain anything without the rest of us.
Establishing an Ideology
The first post on Baeddelism was by Tumblr user @unobject, on October 2nd, 2013:
The post was quickly liked by @lezzyharpy, also one of the first to call themselves “Baeddels”.
This post first provided the name and defining ideology of the Baeddel movement. The implication of the post was, essentially, that because the root of the word “bad” was “baeddel”, and because “baeddel” referred to intersex people and “womanish men”, this old English slur was proof that transmisogyny was the worst form of bigotry; and even, perhaps, the root of all bigotry. (It’s worth noting that this interpretation of the etymology has been problematized.)
While @unobject was the first person to make this connection, @autogynephile (“Eve”) eventually became, in essence, the figurehead of the movement. Of the other Baeddels, some of them were explicitly aware and supportive of the ideology behind Baeddelism, some of them were young or newly-out trans women seduced by the personalities involved, and some of them were tangential enough to the movement that their understanding of it was wholly different from the understanding those at the core of the movement held and promoted. Baeddelism was a sort of trend, for a time, and many participants wore the name without entirely knowing what it meant.
It’s important to acknowledge that as much as there were dedicated members of Baeddelism, and as much as there was a unified ideology behind it, there were also individual Baeddels who did not understand — let alone support — the ideology.
The Ideology
Baeddels essentially built upon the foundation of @monetizeyourcat’s ideology that had been gaining traction on Tumblr in the years prior, with some additions that ultimately defined their movement:
Transmisogyny is the form of oppression from which all (or most) other forms of oppression stem.
Privilege is granted on the basis of assigned sex. (“AFAB” or “Assigned Female at Birth” vs. “AMAB” or “Assigned Male at Birth”)
These fundamentals of Baeddelism were essentially a rebranded form of Radical Feminism. In particular, they drew from the Radical Feminist idea that misogyny was the “primary” form of oppression; that which all other oppression stemmed from. Baeddels only tweaked this idea to replace “misogyny” with “transmisogyny”, which led to the rest of the conclusions Baeddels drew:
There is no “transphobia”
All “transphobia” stems from transmisogyny first, and transphobia as it impacts non-trans-women (or, sometimes, non-transfeminine people) is incidental.
There is no “Trans”
If “transphobia” isn’t real, what else is left of the transgender identity?
While this is by no means the dominant understanding of transgender identity or community, the equivocation of oppression to identity is, in many ways, core to Baeddel ideology (and we see the lasting impact of this in still-widely-used “TME/TMA” termingology). By this logic, if transphobia doesn’t exist, neither does trans identity or trans community (though they obviously believed that transmisogyny, and subsequently trans women, do). Therefore, there are no “trans men”, and belief in the existence of “nonbinary people” is highly contingent on whether an individual believes in the oppression of nonbinary people.
“AFAB Privilege”
The idea that within the queer and/or trans community, people who were AFAB/CAFAB (Assigned Female At Birth) receive unique privilege and positions of power that people who were AMAB/CAMAB (Assigned Male at Birth, a counterpart to “AFAB” and “CAFAB”) do not.
Trans Lesbian Separatism
… was what the movement was ultimately defined by, as the logical conclusion of their other beliefs (much like Lesbian Separatism was the logical conclusion of Radical Feminist beliefs).
Baeddels believed that only trans women can understand, or be truly safe for, other trans women; therefore, contact with anyone who was not a trans woman was deemed “dangerous” and highly discouraged.
Trans Men
… also played an important role in Baeddel ideology, and the resulting treatment of trans men is what is often remembered today. Baeddels generally believed the following, either explicitly or implictly:
Trans men are not oppressed, or experience so little oppression that it hardly matters.
Trans men do not experience misogyny, even prior to transition.
Trans men have access to male privilege, or trans men have an easier time passing, and frequently go “stealth”; thus benefiting from male privilege as well as cis privilege.
Trans men are often (or always) misogynistic and transmisogynistic, and are not held accountable for this.
Trans men oppress cis women.
Trans women enacting violence on trans men is “punching up” at oppressors, and therefore not only permitted, but encouraged.
Trans men are inherently violent, or become aggressive and violent when they go on testosterone HRT (Hormone Replacement Therapy)
The impact of this ideology is often discussed among transmasculine people because of the depth of harm it caused, directly and indirectly — and it was very much intended to. Harm caused to transmascs was not only permitted or excused, it was often actively celebrated.
Nonbinary People
… are often overlooked when summarizing Baeddelism, but Baeddels did have plenty to say about them. Baeddel ideology relied on the idea that privilege was granted on the bases of assigned sex, and nonbinary people’s genders were thus treated as irrelevent; they essentially did not believe nonbinary people truly existed.
CAFAB nonbinary people are either trans men attempting to invade women’s spaces, or cis women pretending to be trans.
CAMAB nonbinary people are actually just trans women who haven’t accepted it yet. They must transition, or they are transmisogynistic.
Intersex People
Intersex experiences, and intersex history, were often co-opted and erased by Baeddelism. This was often more a byproduct of their beliefs than an overtly-stated idea, but most notably, the term “Baeddel” itself is likely more applicable- if not exclusively applicable- to intersex people, rather than trans women. Making their reclamation of it as a “transmisogynistic slur”, or their claim that the word’s existence means that “transmisogyny is the root of all oppression”, incredibly ignorant- if not actively harmful misinformation.
Notably, Baeddels also believed that intersex people- being “more androgynous” (a harmful misonception)- were able to pass more easily as the opposite assigned sex, and that intersex people (even within transfemme spaces) had “intersex privilege”. Some even believed, and openly claimed, that intersex people were “hermaphroditic”; a slur against intersex people, and typically implying that the individual has both sets of reproductive systems simultaneously.
Trans Women
… did not receive universally positive treatment, either. Baeddelism was very much a cult-like group built around the firmly-held conviction that they were absolutely correct, and that anyone who disagreed with them was The Enemy. Trans women who disagreed with them were generally seen as brainwashed and self-hating, and trans women who did agree with them were expected to subjugate themselves to the ringleaders of the movement.
Within Baeddel circles, trans women were most frequently victimized by the abusers allowed to run rampant because “trans women do not, and cannot, harm anyone else.” — including, apparently, each other.
“They were also bad shitty abusive people in general.
“… a bunch of them passed around a pile of smear campaigns and false rumors about virtually any trans woman that they had a even the slightest animosity for. Including the victim of the kinkster rapist. They’ve done other fucked stuff, like chased two twoc off this site for trying to make a zine, but yeah. That’s like, just some of it. I’m not up for going over the messy details of the whole shitparade.
“Full disclosure, I made a lot of excuses for these sacks of crap, even while they were out there spreading false crap about me […] I wasn’t aware of the worst shit they were doing until much much later.”
- @punlich
Inside the Movement
Though individual Baeddels often existed in vastly different social circles from each other- particularly offline- those who lived through the movement highlight commonalities in their experiences.
One interviewee recounts the manipulation present in their initial involvement with the movement:
“It came to me at a point where I was very quick to weaponize anything anyone told me about their experiences, because I was always a fighter. I’ve been an activist for a long time, you know, and when these trans women would come to me with their experiences I would believe them. I wanted to. But the way they acted didn’t add up when compared to what they were saying. I felt really lonely there, and stupid all the time. I felt like I was being a bad trans person.”
[…] “Online they were more willing to say things that were, for lack of a better word, stupid. They would say things that lacked any kind of logical sense. But in person, they would go into this kind of toxic femininity- this weaponization of weakness. And I think that’s because online they were often in these echochambers, but in person they had to rely on much more subtle manipulation.”
- Vera
It seems at points that the environment created within this movement- and the social circles that composed it- was almost cult-like in nature and in need for control.
“It was very isolating. I didn’t see my friends for a while, I was kind of just living with them, cooking and cleaning for them, starving myself, and slowly growing crazy. I was just being consumed by this weird academia and theory that had no basis, because everything was online and Tumblr-based.”
- Vera
Perhaps most chilling, however, are the patterns in their attitudes toward sexual assault. One interviewer recounts being subject to sexual assault, and upon posting about their experience to a Facebook group, being met with hostility from Baeddels present in the group- who quickly used their social influence to have them banned from some of their only support systems at the time.
“I ended up with pretty much no one to talk to about the experience at a time when I was already really, really struggling, and it’s one of several factors that led to me dropping out.
“The Baeddel who got me banned also messaged me directly at some point during all of this, and I tried to get her to understand the pain she was causing me. She basically laughed it offand said it was my fault. She seemed to find a lot of joy in how much it hurt me, and blocked me soon after.”
- Anonymous
Another recounts sexual consent violations from a friend-turned-Baeddel:
“[My ex-friend] had previously been fetish-mining me for her mommy kink. I was freshly estranged from my own mum, and she stepped in to be like, “I’m your new mum now,” and would pester me to call her “mum” in Welsh- as at that point she was going by a Welsh name. I played along, but it transpired that she was basically using that to get off, and she had a thing for infantilising transmascs and being this mum/mom figure.”
- Luke
And yet another interviewee discusses verbal sexual harassment during interactions with another Baeddel:
“I had one [Baeddel] directly tell me that I’m beneath her as a trans man, and that I should “Shut my smelly cooch up” and only use my voice to uplift trans women. I was a minor at the time.
“She then sicced her followers on me, and they bombarded me with messages telling me I’d “never be a real man”, that I needed to “sit on the side and allow them to have the spotlight”, and even telling me to kill myself- because I was inherently toxic to them. I was 16 years old, pre everything, and I couldn’t even pass at the time. They didn’t seem to care that I was a minor, or a newly hatched egg.”
- Anonymous
While Baeddel ideology itself does not explicitly condone or excuse sexual assault, it’s striking how common these stories are; especially considering how small in numbers actual Baeddels were.
It was, in fact, this exact problem that would eventually cause the movement to dissolve.
The Downfall of Baeddelism
Sometime between the group’s formation in 2013 and their downfall near the end of 2014, @autogynephile (also “Eve”), the defacto “ringleader” of the Baeddel movement, began what Baeddels referred to as a “transbian safehouse”.
This was apparently intended as a place for unhoused trans woman lesbians and trans women who, in general, had sworn off contact with men; the ultimate goal of the lesbian separatist ideology at the core of the Baeddel movement. It was thus also referred to as a “commune” by some, and as a “cult” by others.
One occupant of the “safehouse”- Elle- later posted to Tumblr that they had been raped by Eve during their stay, and detailed their experiences.
The Baeddels, rather than believing the victim and ousting the rapist from their movement, chose to close ranks around Eve instead.
Various reasons were given for this:
The victim must be lying
The victim- and anyone who believed them- was simply transmisogynistic.
Anyone who disagrees with the Baeddels is an Enemy Of The Movement, a “carceral thinker”, and a danger to trans women as a whole.
Trans women are incapable of sexually abusing anyone.
“Standing with Eve” was the ultimate sign of loyalty to the movement, and thus a mark of pride and honor.
It was okay to keep being a Baeddel no matter what, because Rape Accusations Should Be A Personal Matter.
(You can read more about Eve’s own denial of these events here and here.)
Years later, even people involved in the initial group have spoken out against the movement and actions of those involved:
“I was in ~the Baeddels~ for years and like… we straight up did horrible shit.
“We harassed anyone that disagreed for any reason, our politics were terrible, our isolationism made an environmental ripe for abuse that I have firsthand experience of, there is nothing in that group worth salvaging or defending.
“Also acting like people are just bringing this up out of the blue is silly like… it’s being brought up because people are still trying to defend the shit we did instead of fucking recognizing that it was wrong.
“Creating this myth that hate on the Baeddels is just a way of keeping trans women in line is a tacit defense of the horrid shit we did.”
- @lezzyharpy
“like I’m sorry but I served my time in shitty awful Baeddel group in early mid 2012s and it fucking sucked ass.”
“… Like it’s straight up cult-like the way you build this self-reinforcing network wherein ayone on the outside looking in with any criticism is unsafe, not to be trusted, only there to hurt trans women, and the only people you can trust is this self-selected group of trans women.”
- @lezzyharpy
Why It Matters, and Why Baeddelism Never Really Fell
Baeddelism itself has seen multiple attempts at resurgences by various individuals, including documented experiences with self-proclaimed Baeddels as recently as 2018- well after the movement first “fell” in 2014.
Most proponents of “Baeddelism 2.0”, a revival of the original movement, argue that the abuse that occurred within the original movement was either completely fabricated by detractors (sound familiar?) or, at minimum, not actually inherent to the ideology.
And, of course, there are some original Baeddels still active on Tumblr today.
Baeddelism never actually went away.
“Baeddelism” was only one name for a set of beliefs that existed long before the specific term did, and hasn’t gone anywhere since the original Baeddel movement died down.
What the Baeddels did was put a name to the ideology @monetizeyourcat was cultivating before them, and what Cat did was popularize, centralize, and justify a way of thinking that had existed before she ever made her blog.
This ideology has since been referred to, loosely, as “TIRF-ism”: Trans-Inclusive Radical Feminism.
It is rare that anyone actually refers to themselves as a “TIRF”, and there is no real centralized TIRF movement; rather, a loose collection of radical feminist beliefs circulates various transgender spaces. The validity of these beliefs is generally taken for granted: of course (trans) women are The Most Oppressed People; of course (trans) women are Inherently and Unequivocally Victims In All Situations; of course (trans) men are Inherently Oppressors; of course (trans) men are Dangerous and Evil… and so on.
Like Radical Feminism, and subsequently Trans-Exlcusive Radical Feminism (TERF-ism), those ideas are fundamentally dangerous.
The defining tenants of radical feminism are that misogyny is the root of all oppression, and that rather than misogyny being an issue of power and control on a society-wide level, it is instead, or also, a matter of oppression and privilege on an individual level: men are always oppressors, and women are always victims.
These beliefs fundamentally exclude and erase the experiences of other marginalized people.
Namely, people of color and indigenous people, who’s experiences with and concepts of gender do not fall within the strict and rigid lines that white, western, colonialist people’s do.
Radical feminism is not a redeemable ideology. It cannot be reshaped into something good. It is fundamentally broken, and the movements born from it- lesbian separatism, political lesbianism, TERF-ism, TIRF-ism, and Baeddelism- are proof enough of that. They each promote only surface-level variations of what is fundamentally cult-like thinking: only the in-group can be victimized. Only the in-group is safe; the out-group is inherently and universally dangerous. Only the in-group understands you. All members of the in-group are, fundamentally, incapable of abuse.
We cannot allow these ideas to be perpetuated within or without the trans community.
Learn the Signs & Prevent Harm
Here’s what we can do to prevent this from happening again:
Learn what Baeddel ideology and TIRFism look like, even detached from the name.
Learn what radical feminism looks like, even detached from the name. Even from people who claim to oppose radical feminism.
Act on dogwhistles. Call them what they are.
Do not allow people to downplay the harm all forms of Radical Feminism have caused. Remind each other that Radical Feminism is not a redeemable ideology, and seek out other branches of feminism instead.
Remember the harm that has been caused. Remember that it will be caused again if these things are allowed to go unchecked.
Listen to and uplift marginalized people. Allow them to speak to their own experiences, identify their own needs, and name their own oppression.
Remember who the real oppressors are, and do not pit marginalized people against each other. The people perpetuating and benefiting from transphobia are cis people- and more specifically, cis people in power.
Build solidarity with other marginalized people. One group of trans people cannot gain liberation without liberating all trans people, and one group of trans people cannot be targeted without the rest of us suffering as well.
Remember that there is no group or identity incapable of enacting abuse, violence, harassment, or other harm against another. Victimhood should not be determined based solely on an individual’s identity.
Remember that there are no acceptable targets for violence, cruelty, harassment, and abuse.
For more context and a list of red flags, read the rest of the article here:
410 notes
·
View notes
A more in-depth guide for creating visual novels, especially in the horror, horror-romance, etc circles
Some of you have seen my previous, smaller post on crafting visual novels, especially in this little space of Tumblr that a lot of us have found themselves in. Since that post took off, I've wanted to create a longer guide to help touch on some points I've thought about for the past few months.
In case you've never heard of me, I'm Kat, also known as catsket. I have a Bachelor of Fine Arts in Game Design. I've been making games for nearly 5 years, and I've been doing visual novels more "professionally" for 2. You may know me for Art Without Blood, 10:16, God is in the Radio, or Fatal Focus. I'm here to help you make your first visual novel.
Please note that my advice does not fit everyone, and you may disagree with what I say. That's okay! It doesn't work for all. That's why there's thousands of resources out there.
FOR THOSE OF YOU WHO HAVE NEVER MADE A GAME
So, you have an idea for a huge visual novel. Horror, a shady and obsessive love interest, a little bit of woo-hooing. 100k words. Maybe a million. What is this, the 07th Expansion?
I notice a lot of people getting into visual novels are artists first. That's okay! I wanted to do art for games before I realized how much I enjoyed writing. And even less of you have probably touched Visual Studio. Again, perfectly okay. We all start somewhere.
My number one piece of advice? Make shitty games.
What does that mean?! My recommendation to those who have never done games is to make a bunch of shitty ones. Think of a theme, or hell, even join a game jam, where you make a game that fits a theme in a short amount of time. Spend about a week on your game. Focus on making something polished. Polish your mechanics. Polish your output.
I recommend, if you can, to make at least 4-6, if not more, kind of shitty games before hopping into longer projects. Making a game is a skill, just like art, just like writing. And game development is combining ALL of these together into one big soup being stirred by a skeleton hand puppet. You'll get into the rhythm and see what works for you.
It also helps you learn, perhaps, the second most important thing here: do you even like making games? There are cases out there where people have created video games (not saying visual novels) just for clout. That's no fun for you, that's no fun for your players. And you might go through this process and find that you don't like making games. That's completely okay! It's not for everyone.
Also, you can use these shittier games to gather an audience. I've built my audience because, for the past few years, I've been releasing games that slowly give me growing fields of eyes every day. A success story overnight is a rare one. It takes time. It's like building a brand, but you aren't a brand, you're an artist.
REV UP YOUR ENGINES!
Ren'py is the number one engine you will be recommended. It is very beginner-friendly, with lots of tutorials, assets on itch.io to use and download, and support. The engine comes with a few tutorials in the form of games, whose code you can freely browse. This is the engine I use most often. Most visual novels you see are made in this engine.
Twine is a text-based engine that most people use for interactive fiction. You can add images and audio, though, if you don't mind messing with HTML. I use Twine for text games and for outlining for my larger games. Ever played Degrees of Lewdity? Yeah, I know you have. Don't ask why. That game was made in Twine.
RPG Maker has multiple versions and has been used for exclusively VNs if you don't mind fucking around with plugins. It can definitely give your game a super unique feel. I recommend RPG Maker MV, since it has the most resources. This line of engines usually costs money, but it often goes on sale for under $5-$15.
People will recommend TyranoBuilder, but as a user and player, the lack of options and the format the games often come in is just...not fun to navigate. It advertises itself as little to no code, but it's often evident in the final results. Some good games have been made in it, though, so if you want to use it for prototyping/practice, you can. I'm not a fan, but that doesn't mean that fans don't exist! This engine costs money.
Not an engine, but check out Ink! Super useful scripting language that's used for more professional projects.
DEMOS, DEMOS, DEMOS
You've got an idea for a long-term project, and now you want to show it to the world! But wait, wait, don't do that yet!
When should I start advertising my game? This is a personal opinion, but I say that you should not start advertising your game until 50-60% of your demo is complete. Why? As I've discussed with some fans of indie VNs, they can name quite a few projects that have been in the "working on the demo" age for 1-2+ years. I've been in the Kickstarter MMO circles. If you, making a single-player experience with little mechanics to balance and polish (aka a visual novel), are taking that long on a demo, I am going to assume the game is not coming out. There are some games I have seen out here that have been in "working on the demo" phase where I haven't seen a single ounce of what the project will look like.
What should I put in my demo? The purpose of a demo is to showcase the mechanics and the vibes and the mechanics of your game. It's a demonstration. In my last post, I pointed to the Dead Space 2 demo that was showcased at E3 (RIP), that takes place about 2 hours into the story and shows how enemies are defeated, some animations, bits of the story, etc. Usually, because it's less about mechanics and more about vibes, visual novel demos showcase a certain percentage of the full thing (5-10%.) Can you showcase the vibe of the game here and what players should expect? If not, show off another portion.
How long should I work on my demo? Before, I said 3-4 months. That can be true, that can also not be true. Think about how long the demo takes you in proportion to how long the actual game should take you. Don't put too much effort. The demo is to showcase the vibe. It's to see how much the public and fans may enjoy the game.
My game is 18+, what should I do? Make a splash screen when the game is downloaded to let players know your game is 18+. If it's going to contain sexual content, you can hide it with itch.io's adult content filter. Write it on the page itself that your game is for adults only. Don't put your demo behind a paywall. This is genuinely ridiculous. The purpose of a demo is to showcase what a game is like before a player purchases it. That defeats the point of a demo. I've seen this happen, and it discourages players from approaching, especially because most demos never make it past the demo phase. So...I'm paying you $10 for 2-3k words of a game that may never come out?
Should I make a social media for my game? YES! Go for it. These anchors are how people will find your game. Make a Tumblr and open that ask box. Make a Twitter. Go to BluSky. Advertising is not bad. Some YouTubers even take e-mail suggestions from developers. Feel free to shoot your shot. The worst they can do is not respond.
HOW TO SET UP YOUR ITCH.IO PAGE:
Getting your itch.io to a presentable state can be very challenging! There's many ways to do it. I highly recommend using this page image guide for learning how to size your images to make your page pop!
Itch.io themselves has suggested to not publish a page until the game or demo is released. You can make the page and keep it as a draft, but do not publish it until you're ready!
Your cover image is the image that will appear in the search of the website, on any front pages, in collections, and on your profile. What have I seen that works? Key art of one of the characters up close and the title of the game! If you can make it a .GIF, do it! Bitches love .GIFs!
Itch.io recommends 3-5 screenshots on your page. I recommend 1 of these 5 be a .GIF that shows how gameplay feels. This is effective, even for visual novels!
Write a 3-5 sentence summary about your game for the description. What is your story about? What is the draw?
DO NOT BE ONE OF THOSE PEOPLE WHO IS GOING TO SAY "This is not like other visual novels. It doesn't have that cheesy this or that or-" No one cares. Genuinely. You're putting down other games in your genre and elevating yourself to the pompous level.
TAG YOUR GAME! itch.io gives you a list of tags to choose from when you go to tag. DON'T USE THIS! Try to go for more specific tags. Arimia has a very good guide on how to use itch.io's tagging system to your advantage.
GENERAL GAME MAKING ADVICE
SCOPE KNIFE IS SUPER USEFUL! Everyone makes games that are way over their workload. It's okay to cut out features and add them later. Prioritize making a finished game before hitting those stretch goals.
PLAN, PLAN, PLAN! Writing outlines is super helpful. I use Twine for my outlines, because you can connect your passages together and make really well-thought webs.
IT'S OKAY TO ASK FOR HELP! Whether it's from friends, professionals, or anything in-between. They can help with assets, editing, etc.
HONE YOUR SKILLS OUTSIDE OF GAMES! Write some poetry. Do some sketches everyday. Improve on your craft to improve your games
MUSIC IS HARD. THERE ARE RESOURCES. Most of us aren't musicians. That's okay. Make sure the music you get for your game is allowed to be used. You can use anything non-commercial if your game will not cost money or donations. I try to do songs in the public domain or free to use overall with credit if I don't have a musician. Consult the Creative Commons website if you're unsure how you're supposed to use a certain piece of music. If you don't use the right stuff, not only can it put you in legal trouble, but it can put streamers in hot water if they play your game and they can't upload the video because music is copyrighted.
PLEASE, DO SOMETHING ABOUT YOUR UI. Wanna know an easy way to get your game to look more professional? Edit the damn UI for your game. Make a new textbox, even if it's just a black box. Change the font. Eventually, players recognize the defaults and patterns of games made in certain engines and may attribute a lack of UI changes to a developer being lazy. It doesn't take very long to change the colors around and move text! Please do it to add a little pop to your game.
DEADLINES ARE AWESOME. Not everyone works well under pressure, but if you give yourself an infinite amount of time to make something, it'll never get done. Set goals for yourself for how much you can work on something.
IF YOU HAVE TO GIVE UP, GIVE UP. Making things is hard, especially long-term. Emergencies happen, jobs happen, life happens. Let your fans know that a project isn't happening anymore. Don't leave them in the dark. You don't need to tell strangers your medical history or anything, but transparency + honesty are really hot traits. You should use those in your creative work. This is one reason why I advocate for not publishing or advertising things until you know it's stable.
SHOWCASING YOUR CONTENT
People love to see WIPs for games! This is what the devlog is good for! A devlog is a post where a developer talks about and showcases some things happening in the game? What can you add to your dev log?
PERCENTAGES! How much of the artwork is done? How much of this character's route is done?
SNEAK PEEKS AT ARTWORK AND SPRITES!
GIFS! GIRLS LOVE GIFS!
Anything else to showcase your game's content! Posting consistent updates retains and even gains a fan's attention for your work.
RUNNING YOUR TUMBLR
You've joined us, and you've made a Tumblr for your blog! Link it on the itch.io page, so people can come find you after playing your awesome demo!
Do I have to respond to every ask? No. It's your blog. Delete whatever asks you want.
I got a hate comment! What do I do? Delete it and move on. I have a more detailed section on hate below.
I want to interact with [blog]! How do I do that? Reach out to the devs for silly little collabs. If you come onto a developer slightly headstrong, they might feel you are being abrasive or using them for content.
If people make fan content, interact with it! Encourage it! Reblog it. Show your love.
OTHER IMPORTANT THINGS
PROFESSIONALISM IS KEY. These may be pet projects, but you want to appear some level of professional on your actual itch.io page.
Being dismissive of player and fan complaints or criticisms will make you appear childish.
If your game is broken, fix it. I have been told by some amateur developers to ignore game-breaking bugs. It does not make me, a player, want to engage with your content. It seems messy and unfinished.
With the above point, it's 100% okay to have bugs and errors upon release. Every developer and their brood mother has. To decrease these issues, get playtesters. Friends can play your games, spot any errors, and help you point out things that can be improved upon. I recommend having playtesters at every stage of development.
Make sure your game runs before you publish it. Please.
You can still be silly and giddy! There's no reason to not be, especially when you get positive comments! The point of this is to not be outright rude to potential players and fans.
IGNORE HATE COMMENTS. In this case, a hate comment is a statement that contains no constructive criticism and are only here to be insulting or malicious. People are going to leave you with actual piles of dog shit in your ask box. They are trying to provoke you. Giving hate comments any attention, even if you're there to "clap back" proves that they got to you, even if you don't take the hate to heart. They will continue to pester you. Delete any hate comments and ignore them completely. Laugh about them with friends in a private setting, sure.
THINK BEFORE YOU REFERENCE! I know one big thing in this community is adding references to other games in yours, such as plushies of other characters or putting them on posters. The best thing you can do it ask the developer before adding this. How would you feel if some random person you've never met put your character in a video game? Most of us would feel weird and potentially violated. Open communication with devs is awesome. I am usually okay with it as long as someone asks for permission.
As a complete aside, I prefer more tasteful references to other games as opposed to 523482346 plushies and posters. These have been slightly overdone. Why not theme a candy after another game's character? Maybe your characters know each other.
OTHER RESOURCES I RECOMMEND
Devtalk is a server dedicated to independent visual novel creators. You can find jobs, resources, advice, talks, and, like, everything there! Devtalk is super useful. Everyone in there is so cool. They have a really great and comprehensive list of resources that I could not even begin to cover.
Visual Novel Design is a great YouTuber. No other words, check the guy out!
Ren'py and whatever other engine you're using has documentation that's super useful to follow.
Arimia not only has amazing VN resources, especially for marketing, but she also just has? Amazing games that you should check out?
And for a shameless self plug, I'm the lead of Sacred Veins, a collective of devs creating narrative games, whether it be horror, humor, romance, or everything in-between. Come hang out with us!
476 notes
·
View notes
New Desktop Dash, No Bueno
Okay so, new dash layout on desktop.
As seems to be a common reaction: not a fan.
Let's talk about some of the issues:
1. Really visually cluttered
The new sidebar crowds out the dashboard content and the bright blue popup notifications (now at the side AND top) and create-post bar pull your eyes in different directions. There is no space for the eye to rest on anymore - it's all noise. The end result is that everything flattens - there's no focal point anymore.
It's also pretty overwhelming - even for someone like me - so I can't imagine it would be very user-friendly to someone who was photosensitive or struggled with visual overload (especially when paired with the high-contrast 'true blue' default site palette and animated icons for the changes-on-tumblr/staff-picks/trending buttons).
2. The activity pop-up now covers dashboard content
This is really bad from a usability standpoint. In the old layout the activity pop-up used to drop down over the recommended blogs sidebar. Now it actively gets in the way of looking at core content. The dash is why we are here, burying it like this is baffling.
The search bar now drops down over the recommended blogs banner instead, but where the old design had non-critical space on each side of the dashboard to visually allow both features to pop in, this new layout is way worse for efficiency. And for what? Having a rarely-used former drop-down menu now permanently active? The old banner with quick-links for the key use-features (notes, messages, askbox) made much more design sense.
It also means that the activity pop-up gets now completely covered by the blog pop-up that opens when you click the notification, so double demerit there. 0/10.
3. It's harder to navigate to the activity page, and the new page-stretch means you can't see new notes without scrolling down
That first bit is kind of a nitpick but cramming the 'See everything' link down at the bottom of a browser window isn't a great navigation choice. (Again, the visual signifiers and eye-direction in this new design are incredibly poor.)
That the main activity page now requires you to scroll to even see the top note due to the new display ratio is really egregious. It makes another key site feature just slightly less convenient and accessible in a very irritating way. Bad choice.
4. The new ratio pushes the Radar and Main Sponsored slot completely off-screen
This one is directed the tumblr staff: that's also a bad choice, guys. That's your main ad-slot for people loading into Tumblr so hiding it is going to hurt both your ad-impressions and your ability to promote the ad-free option. The new layout ratio also means that the in-dash ads are going to be a lot more invasively screen-filling - and let's be real most users will either add-block or leave before purchasing ad-free. I have no idea what the new layout is trying to achieve but if ad optimisation is the goal then this ain't it, chief.
To be honest I cannot comprehend the rationale for this change. I guess it's visually a bit more like Twitter... but that site is currently being demolished from the inside by poor management decisions so maybe it's not the best aesthetic to be aping.
Well then, what do?
Okay so, new dash bad. And so, in true Tumblr spirit: we complain. However, to get results we must deploy the art of kvetching productively.
If you want the old dash back (or at least, a better new-dash design that corrects some of these big weaknesses) what you should do is head over to https://www.tumblr.com/support and lodge a feedback ticket pointing out the problems. The more users who do that, the more likely you are to see an effective response.
Remember, tagging @staff and @support in posts won't fix this. There's no guarantee they'll see it among the notes barrage.
Also: please don't be rude or abusive when you lodge tickets. Whoever is manning those blogs and inboxes probably isn't the person who forced through this change. Save an intern, be polite.
Go forth in disgruntlement to keep this hellhole a hellhome.
1K notes
·
View notes
Not to be rude or derailing your answer to the ask about the scorched earth post, but I do think quite genuinely that the site is becoming more openly hostile to its userbase, or at the very least its disabled userbase. While I’m not a fan of mobbing people’s personal blogs in targeted harassment campaigns, I think some people are also ignoring that staff blatantly said in a recent post that epileptic users would need to pay for ad-free to have their safety assured
I kind of don’t think that’s being ethical or user friendly, to me that sounds like they’re refusing to meet basic accessibility requests and answering with ‘pay us money to be safe’. Strobing and flashing ads aren’t just eyestraining, they can legitimately lead to serious injuries for epileptic folk, and telling people with epilepsy to just pay up or get lost is kinda… I dunno… disgusting?
So it looks like in a livestream (not on a post so far as I've been able to see) either photomatt or zingring made a glib and inappropriate response to an epileptic user asking about flashing ads and suggested that maybe they needed to pay for ad-free.
That's bad, I don't like it, and if it was supposed to be a joke it was a shitty one.
Zingring, tumblr's COO addressed that comment in a post where she said:
Buying ad-free (or gifting ad-free to someone else) is always an option, but that is not the solution (and of course, some folks simply can’t afford it). Sorry that it sounded dismissive in the session! That was not my intent.
I still think that's inappropriate (it's not that ad free isn't *the* solution, ad free shouldn't be *a* solution to accessibility), but it looks like Zingring has addressed this issue multiple times.
She got tagged in this post listing ways that tumblr could improve accessibility for photosensitive users and seems to have pretty consistently followed up; she has explained that there are rules against flashing ads that are sometimes violated by the advertisers and asks people to please report ads that break those rules so those advertisers can be blocked, has noted that there is apparently a "stop all autoplay" option in the works behind the scenes. She does also seem to take it seriously when users reach out with complaints about accessibility issues and seems to be willing to explore options.
Looking through that blog, this does not seem to be a site that is hostile to users with accessibility issues so much as, like everything else that's wrong around here, it is ridiculously understaffed so every project that someone wants to have as a priority is a project that someone else needs put on the backburner.
However, to very gently push back: how much of what you're experiencing as hostility from tumblr is actual hostility and how much of it is seeing posts like this, which suggests that tumblr is removing accessibility features because the lightbox didn't have double-tap-to-zoom on mobile for some users for a short while, claims that the blocking/flagging issue is a false flag against trans women, shared the inaccurate fearmongering post about tumblr live's ToS, and also claimed that tumblr "allowed" flashing ads that violated the in-place rules that tumblr has for advertising?
(this kind of goes with the 'nobody understands the ToS' but also nobody understands ads; tumblr does not have enough staff to look over the ads that go on their site every day, no social media company does, they rely on advertiser agreements as a sort of enhanced honor system and reports from users if the advertisers don't hold up their end of the bargain; the only way around this for any site that uses ads is to not have ads and that post is explicitly saying don't pay for tumblr because they are doing ads wrong - either they have to run ads and some bad ones are going to slip through and users will have to report them or tumblr will have to be 100% paid by the users or tumblr will go away. If you see ads that are unsafe for photosensitive users on *any* website you should report them to the site because the site almost certainly doesn't know that there's an advertiser violating the ad ToS unless someone tells them)
Generally speaking, I am actually *not* seeing worsening accessibility features, I'm seeing improvements compared to where we were five years ago - alt text on images is now built-in and devs are working hard on making tumblr more compatible with screen readers (as noted in the changes blog regularly); tumblr itself started offering different dashboard themes for users after years of complaints about contrast levels and readability; the "tiktok/twitterified" desktop dash view that everyone hates is supposed to be more readable on wider screens.
Compare this post in October of 2022 when Changes celebrated adding animations for posting (and told users those could only be disabled at an OS or browser level) with this post from July 2023 when they rolled back a feature because of an unexpected use case that could cause problems for photosensitive users.
These aren't things that I'd expect to see from a company that didn't care about accessibility, or that was openly hostile to questions around making the site more accessible.
I don't disagree with you that the comment from the stream about buying ad free was inappropriate; it absolutely was and it must have made photosensitive users feel like shit. But in the three months since that comment tumblr has been very responsive about getting flashing ads removed as soon as possible and seems to be working on more permanent fixes. I think this may be an instance of able-bodied people not realizing how shitty and dehumanizing their joke was (and it was) and taking the steps to do better.
If you don't think they're doing better, I probably can't convince you. I certainly don't think that tumblr is perfect about accessibility and I think that users need to continue pushing for improved user control of how the site displays and interacts with various devices. But compared to the kind of responses users complaints got from staff in 2018? I feel like things have improved a lot.
560 notes
·
View notes
im sorry but i need to geek out somewhere and screaming into the void on tumblr is less likely to get me flayed than on twitter, especially if i get terms wrong. plus i can do a read more and yall can click into the tech talk if you want to verse it bombarding your twitter timelines
so idk if i only liked it or if i actually put it in my queue but i saw a post that talked about a few pieces of tech that focus on user repairs and being sustainable (fairphone and frameworks laptop) and after doing some more research into what they have to offer i actually really excited that these products are finely hitting the us market and that people are moving away from the belief that super smooth streamlined glassy = the future. being able to reliably repair and keep what you have alive verse throwing the whole thing away when maybe all you needed to do is add more ram to your current laptop (something that i would do with my laptop to keep using it for a few more years if it wasnt glued shut and i was at risk of cracking the screen) or swap out a fuse.
i know big corporations dont like it but i truly do believe with how much tech we use on a daily basis that the way that we are going to be more environmentally friendly is to move back to tech that we can hang onto for as long as we can and to recycle and then reuse what we cant. like with the frameworks laptop. i saw that they just partnered with coolermaster to create a case specifically so that you can reuse you motherboard, cpu, etc and make a portable workstation. you could dual wield with the laptop you just upgraded if you want to dedicate specific tasks to one or the other. they also specifically mentioned that you could screw it into the back of a monitor and create your own all in one. guys thats cool as shit??? if you had a 3d printer and some time you could even create that yourself
on top of the actual hardware part moving to open source programs when your able. when i update my desktop i plan on running linux. it might have a learning curve compared to windows but in terms of performance??? ive heard that it runs smoother even on older machines, that its more efficient because isnt running stuff in the background that tracks your data and shit. now i understand that not everyone can do that because there are some programs that dont play nice with linux but for my needs at least it does everything i would need it to. and maybe a couple years down the road we do figure out how to run these programs on certain flavors of linux since its open source and people fiddle with it so much. (still looking for alternatives to like word and excel though, i use google docs since its free but i want to move away from them as much as i can too since they laid of their youtube music team (i believe?? it might of been a different branch) for trying to unionize)
if anyone knows of any other smaller companies that actually focus on sustainability and user repairability please let me know. theres certain pieces of tech that i think are now unfortunately behind a software repair paywall, things that used to be just machines and are gaining more bells and whistles like cars and refrigerators if that makes sense. but the more we push for these things to be repairable by us the consumers id hope that would change, or there would at least be options that dont need specific companies to repair them or else they blow up
158 notes
·
View notes
happy disability pride month
reminder that if you're mad at tumblr and are having reservations about the blackout (valid) and aren't sure what to do, leaving a negative and explanatory review on the tumblr app store (actually expressing why the site is becoming more frustrating to use) and deleting the app may help.
Please do not leave tumblr completely during the only month where disabled voices are actually heard. Please support your disabled friends and disabled tumblr users this month.
here's a couple reminders of what people want changed, please feel free to add more!
flashing lights on ads (inaccessible, not disability-friendly)
ads with noise
inability to turn off tumblr live permanently
the push towards short-form videos that no one wants
maybe request that the staff communicates better with users and operates with more transparency rather than just... making changes no one wants.
497 notes
·
View notes
hello from the hallowoods dashboard simulator
😈 valerie-meme-stone
I'm not ready for my spotify wrapped to just be stonemaiden. like i get it spotify i know i'm gay
53 notes
📝 the-poetry-panopticon Follow
Unfriendly reminder not to sign up for a Dreaming Box subscription! The Botulus Corporation is not to be trusted! Here's an article explaining the language in their contract and why it's concerning! In addtion, they use AI generated images in the Prime Dream, which we should all know by now is unethical.
14,034 notes
🥗 bisexualranchdressing Follow
dang this is crazy. i thought wildfire smoke was bad but what the fuck is this????
🌅 nerdy-tragedy-theorist Follow
well according to color theory
🌅 nerdy-tragedy-theorist Follow
never mind i've got nothing
739 notes
⚡ evil-electrician Follow
friendly reminder to stop spreading misinformation about the black water! people are saying that it brings people and animals back to life but that's not exactly true! although their body may be back, they're not the same person and they will likely become violent and dangerous. please stay inside and be really careful what you and your pets eat or drink.
🐈⬛ cats-not-capitalism Follow
fuck you op i'm keeping my undead cat
⚡ evil-electrician Follow
good luck keeping your fingers
48,230 notes
🐧 morally-grey-penguin Follow
1,383,248 notes
eccentricelina-deactivated04232030
i must not go to sleep in the lake today. afternoon nap is the mind killer
eccentricelina-deactivated04232030
mmmmmm cozy
eccentricelina-deactivated04232030
where is my skin
eccentricelina-deactivated04232030
going back to sleep honk shoooooo
635 notes
🌮 mysteriously-crafty-nacho Follow
reblog this post to go north with the person you reblogged this from
54,092 notes
🧊 botulus-corporation Follow
The Botulus Corporation is with you during this difficult time. Join our happy dreaming family where you and your loved ones will be safe from the rain. Tumblr users get 30% off on a Dreaming Box subscription!
🐨 chief-koala-typhoon Follow
73,932 notes
🌿 shiny-wolf-tragedy Follow
it fucken rainny
🐼 dreamland-panda Follow
love that they'll be a literal apocalyse and tumblr users will just make memes. never change tumblr
72,138 notes
👁️🗨️ the-magnus-brotocol
choosing between the irl amazing digital circus or probably fucking dying was not on my 2030 bingo card but okay
👁️🗨️ the-magnus-brotocol
at this point i just gotta expect that if the year is divisible by 10 then something terrible will happen
94 notes
🐺 werewolves-are-hot
hey do you think i can get a real werewolf boyfriend now that monsters are real
🐺 werewolves-are-hot
any cute werewolf boyfriends in this part of the woods
429 notes
🌷 pleasant-arcade-land
oh man it's been a couple months since I last updated this fanfic huh! so I just drank some black water by accident and now I have a few extra fingers, and honestly that took some getting used to, but it's actually pretty convenient now and is really helpign me get more words in lol im still here writing homestuck fanfic in 2030 hehehehehe anyway new chapter here
38 notes
🌑 the-void-whispers Follow
so, it looks like tumblr might be dying soon due to, well, *gestures wildly.* You'll have to kill me before I join Twitter now that the Botulus Corporation bought it (and no, I am not calling it B, that is just stupid) so if you want to hear from me you will simply need to look out for passenger pigeons. in the meantime, ill be here until tumblr straight up dies and i have a crying session about it
🦌 gamer-guy-bath-water Follow
we do not grieve ice when it melts, or celebrate the sapling when it rises from the soil. they just are. life and death and rebirth are one constant state. and without change, there would be nothing to watch
⚔️ sword-lesbian-enthusiast
add that to the list of banger quotes from tumblr memes
82,362 notes
215 notes
·
View notes
Tumblr Alternatives
In light of recent news, here are some tumblr alternatives that I am aware of.
Cohost (very much like tumblr, seems to be the most popular alternative)
Bluesky (more like twitter, I find it harder to use)
Pillowfort (nostalgic 2015 tumblr build, doesnt seem to have a lot of users)
Dreamwidth (old internet kind of build like a 2000-2010 website)
Mastodon is also an alternative but I do not personally recommend it since it's not the most user friendly.
Please feel free to add reviews, other websites, or your accounts.
96 notes
·
View notes