#is that tag gonna get this post banned from all tags | Explore Tumblr Posts and Blogs

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

love-belle · 10 months

Text

you are my sunshine !!!

*ੈ✩‧₊˚ in which she's their sunshine and it's sunshine's birthday.

for when you find the people you can call home. ˚ ༘♡ ⋆｡˚

social media au // lando norris x fem!reader

warnings - language

author's note - hello!!! i really hope u like this one!!! also, i have more than 20+ requests in my inbox at the moment so if you've requested something, it may take some time for me to post them, so sorry about that ://// thank u so much for reading, i love you <3

≡;- ꒰ °twitter ꒱

≡;- ꒰ °instagram ꒱

liked by landonorris, lilymhe, alex_albon and 863,229 others

yourusername the kind of radiance u only have at (23) 17

6,528 comments

username OH MY GOD

username HELLO??????

username SO FUCKING PRETTY I SCREAMED

username lando. me n u. mcdonald's parking lot. ur catching these hands.

carmenmmundt happiest birthday to my fav person EVER!!! i love you so much baby, thank you for always fixing everything with just a smile ❤️❤️❤️

-> yourusername CARMEN IM GONNA CRY??? i love you so so so so so much like ur like my fav person ever thank u ❤️❤️❤️

username HAPPY BIRTHDAY QUEEN ❤️‍🩹

*liked by yourusername*

username dumped my bf for u omg

username THE TAYLOR SWIFT LYRICS

username hahahahahah!!!!! just fell in love!!!!!!!!

username my bisexual awakening

alex_albon hbd.

-> yourusername ty.

-> username not these two acting they're they're not BEST friends 😭😭😭

username lando just so u know it's OUR girlfriend now

username JAW DROPPED

lilymhe been looking at this for 10 mins

-> yourusername blushing omg

lilymhe u lowk need to find another caption for ur bday post bc u have been using this since u turned 17

-> yourusername it's my bday leave me ALONE

username SHE'S SO PRETTY LIKE IM SO AHHHSHSH

username happiest bday to one who made lando a simp 😌 we love u so much

username i want her so bad

landonorris HAPPY BIRTHDAY LOVE I LOVE LOVE LOVE LOVEEE YOU SO MUCH

-> yourusername LANDO THANK U SO MUCH I LOVE YOU

landonorris hahahaha can i get your no. are you single are you free this friday do you have a boyfriend

-> yourusername i have a girlfriend lilymhe

-> lilymhe back off norris

-> landonorris wow.

username genuinely in awe rn LIKE

lewishamilton happiest birthday y/n 🤍 have the best day ahead!! cannot wait to see you and lando tonight!!

-> yourusername LEWIS THANK U ‼️‼️‼️ see u tonight im so excited 🔥🔥🔥

username she's so girlboss i love her

username HER.

≡;- ꒰ °instagram ꒱

liked by yourusername, carlossainz55, pierregasly and 986,318 others

landonorris happiest birthday to my person, my love, my y/n. you're easily the most sunshine-y person i have ever met and i love you so much, even if you love lily more than me. i remember telling you about my favourite flower and the very next day, you showed up with a bouquet full of white roses and a cheesy card and that was when i knew that i wanted to spend all of my lifetimes with you. here's to growing old but never growing up. have the happiest day ahead, darling ❤️

tagged yourusername

username ask me if im ok

-> username are u ok

-> username BITCH NO

username SOVBINF

username babe wake up new y/n pics just dropped

pierregasly happy birthday to the actual goat 🐐

*liked by yourusername*

username the caption has me rolling on the floor

username dead deceased six feet under decomposed decaying gone

username they're so 😭😭😭😭😭😭😭😭

lilymhe glad u acknowledged her loving me more than u

-> landonorris you're still banned from our home

-> yourusername no she's not. lily ❤️❤️❤️

-> landonorris and to think i spent half an hour to choose these photos..

-> yourusername sorry babe 🫤

username SHE'S SO SUNSHINE GIRLY

username MOTHER

username she could step on me and i would say thank u

charles_leclerc the og queen 🔥

*liked by landonorris*

username MY PERSON MY LOVE MY Y/N

username further proof of if he wanted to he would

yourusername brb sobbing

-> landonorris OMG PLEASE DON'T

yourusername omg

yourusername ahahahahahaha i love you???

-> landonorris i love you.

yourusername thank u thank u thank u

yourusername frrr ur the best part of my life, ur what i imagined daylight to be like thank u for making me the happiest idk how i got so lucky with u

-> landonorris i love you ❤️

username shakespeare's been real quiet since lando wrote this caption

username they're MY parents

username MY Y/N

≡;- ꒰ °instagram ꒱

liked by yourusername, francisca.cgomes, landonorris and 782,825 others

lilymhe to my soul sister, my best friend, my partner in crime, my 3am call since forever, happy happy happy birthday, my love. there's good in this world and i found a LOT of it in you, thank you so much for being my sunshine on days where everything got too hard. i love you so much, to the moon and to saturn. ( landonorris, suck on the caption)

tagged yourusername

username OH MY GOD

username THE CAPTION HELLO

username i sobbed ngl

username MY SOUL SISTE MY BEST FRIEND MY PARTNER IN CRIME MY 3AM CALL SINCE FOREVER

carmenmmundt 🤍🤍🤍

*liked by lilymhe*

username gfs ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️

username i love them sm wtf

username NOT HER TAGGING LANDO

-> username their (fake) beef is too funny like 😭😭😭😭

francisca.cgomes missing you both so much!!!

-> lilymhe can't wait to see you next week <3

username the wags being best friends ❤️❤️❤️

username this post gave me sm serotonin thank u

username Y/N IS THE DEFINITION OF SUNSHINE GIRLY AND I LOVE HER SM FOR THAT

username they're so ❤️❤️❤️🫤🫤🫤😭😭😭‼️‼️‼️‼️🔥🔥🔥😘😘😘😘🥰🥰🥰🥰❤️‍🩹❤️‍🩹❤️‍🩹❤️‍🩹❤️‍🩹

alex_albon i better be getting a caption this long on my bday

-> lilymhe we'll see

-> yourusername just accept that i'm her fav ❤️

username I LOVE THEM SM

username women friendships are so precious to me like ❤️❤️❤️

username further proof that love stories are not always romantic

*liked by yourusername and lilymhe*

landonorris fuck you stop trying to steal my girlfriend

-> lilymhe *OUR girlfriend

-> yourusername love all of my bitches equally ❤️

username HER TAGGING LANDO IS SENDING ME 😭😭😭😭😭

yourusername do u want me to cry???? lily i love you so much ❤️❤️❤️ thank u so much for always being there for me like i don't know what i did so good in my past life to have YOU as my best friend but i'm so glad i do, i love you ❤️

-> lilymhe i love you so much bae ❤️❤️❤️

username their friendship is so pure like

username lando and alex who???? it's y/n and lily

≡;- ꒰ °instagram ꒱

liked by yourusername, landonorris, lilymhe and 798,928 others

alex_albon happy birthday to the only person i'd want to sit beside me in prison. thank you so much for years of memories, laughing till we cried, going on stupid adventures together that got us yelled at by lily and here's to a lot more. i love you, i guess, even though you made my girlfriend love you more. have a good one, you stupid. time to start buying anti-wrinkle cream.

tagged yourusername

6,728 comments

username HELP OMG

username the WILD contrast between lily's and alex's caption

username NO BC THEY'RE BEST FRIENDS GOALS LIKE 😭😭😭😭😭😭😭😭😭😭😭😭😭😭

danielricciardo "stupid adventures" and it's just the august incident.

-> yourusername OMG THE AUGUST INCIDENT

-> lewishamilton we agreed not to speak of that x

-> georgerussell63 alex and y/n have done questionable shit growing up but the august incident will forever top the list

-> carlossainz55 that was scary, no?

-> landonorris I ALMOST FORGOT ABOUT THAT

-> maxverstappen1 no because charles almost cried

-> charles_leclerc I DID NOT

-> pierregasly you did, mate

-> alex_albon we DON'T talk about it

-> lilymhe still disappointed in all of you

-> username WHAT IS THE AUGUST INCIDENT

-> username HELLO???? WE NEED DETAILS????

-> username nah bc what'd they do 😭😭😭

username this caption made me drop to the floor and roll down the stairs

username BEST FRIENDS

username no bc they're definitely the kind of duo that would go to jail and get bailed out by their partners

-> username lily would SO be the disappointed mom and gf

-> username meanwhile lando is just along for the ride

username LILY ALEX Y/N LANDO 🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥

username NOT ANTI WRINKLE CREAM

lilymhe of COURSE she loves me more than she loves you, have you seen me???

-> yourusername i have and let me tell you, woah.

-> lilymhe 😘

-> alex_albon out of my comment section you hoes

username LILY AND Y/N WILL FOREVER BE THE SUPERIOR DUO

username im so ❤️❤️❤️❤️❤️❤️❤️❤️❤️

username WORM ON THE STRING

-> username they're so unserious i love them

landonorris my girl my girl my girl my girl my girl ❤️❤️❤️❤️❤️❤️😭😭😭😭😭😭😭

-> alex_albon you're literally sitting on her lap rn

-> landonorris ok and?

-> username LANDO SITTING ON HER LAP HELP

-> username nah it's cause it's so babygirl like ❤️❤️❤️

-> username real like ❤️❤️❤️❤️❤️

username i love their friendship ur honour

yourusername thank you for making the best decision of ur life and meeting lily, it's bc of u that i found my wife ❤️❤️❤️ forever grateful dude

-> alex_albon no problem bro

yourusername and thank u for listening to me shit talk about people i hate and then shit talking with me

-> alex_albon our shit talking sessions are so fun, we're so mean and i love that

username I NEED FRIENDS LIKE THIS WTF

username AHHSHHSHDBXBXNDNS

#f1 x female reader #f1 x reader #social media au #fake instagram imagines #f1 imagines #lando norris imagine #lando norris x y/n #lando norris x you #lando norris x reader #lando norris imagines #lando norris insta au #lando norris fanfic #lando norris fluff #lando norris blurb

2K notes · View notes

violainebriat · 1 month

Text

It's a bit weird typing out a full post here on tumblr. I used to be one of these artists that mostly focused on posting only images, the least amount of opinions/thoughts I could share, the better. Today, the art world online feels weird, not only because of AI, but also the algorithms on every platform and the general way our craft is getting replaced for close to 0 dollars. This website was a huge instrument in kickstarting my career as a professional artist, it was an inspiring place were artists shared their art and where we could make friends with anyone in the world, in any industries. It was pretty much the place that paved the way as a social media website outside of Facebook, where you could search art through tags etc. Anyhow, Tumblr still has a place in my heart even if all artists moved away from it after the infamous nsfw ban (mostly to Instagram and twitter). And now we're all playing a game of whack-a-mole trying to figure out if the social media platform we're using is going to sell their user content to AI / deep learning (looking at you reddit, going into stocks). On the Tumblr side, Matt Mullenweg's interviews and thoughts on the platform shows he's down to use AI, and I guess it could help create posts faster but then again, you have to click through multiple menus to protect your art (and writing) from being scraped. It's really kind of sad to have to be on the defensive with posting art/writing online. It doesn't even reflect my personal philosophy on sharing content. I've always been a bit of a "punk" thinking if people want to bootleg my work, it's like free advertisement and a testament to people liking what I created, so I've never really watermarked anything and posted fairly high-res version of my work. I don't even think my art is big enough to warrant the defensiveness of glazing/nightshading it, but the thought of it going through a program to be grinded into a data mush to be only excreted out as the ghost of its former self is honestly sort of deadening.

Finally, the most defeating trend is the quantity of nonsense and low-quality content that's being fed to the internet, made a million times easier with the use of AI. I truly feel like we're living what Neil Postman saw happening over 40 years ago in "amusing ourselves to death"(the brightness of this man's mind is still unrivaled in my eyes).

I guess this is my big rant to tell y'all now I'm gonna be posting crunchy art because Nightshade and Glaze basically make your crispy art look like a low-res JPEG, and I feel like an idiot for doing it but I'm considering it an act of low effort resistance against data scraping. If I can help "poison" data scrapping by wasting 5 minutes of my life to spit out a crunchy jpeg before posting, listen, it's not such a bad price to pay. Anyhow check out my new sticker coming to my secret shop really soon, and how he looks before and after getting glazed haha....

#ai protection #my art #violaine briat

277 notes · View notes

aliaology · 6 months

Text

BECAUSE I LIKED A BOY

summary: you used to date quinn, the relationship starting not long after him and his other ex broke up. she got mad, made drama about you, and in the end, it flared up by the time your relationship was long gone.

pairings: quinn hughes x fem!reader

warnings: death threats

thin mints. god you loved thin mints, and currently you craved them. actually, you craved the nice memories they brought. the memories where your ex told you he would have some guy get some for you. he ended up being that guy.

quinn hughes. your favorite past lover who will continue to outshine the rest. he treated you well, made you happy. he was perfect.

bonding over the black eyed peas and the smiths was something you found to be hard when it came to other people. but with quinn, it was easy. he made love seem easy and effortless.

but the downside, was his ex. she was pretty, but they had broken up about three months prior to you and him hooking up and then ultimately getting together. no one necessarily knew of their breakup. they didn’t post pictures often of each other due to quinn living in vancouver and his ex living in michigan.

so everyone assumed they were fine, until quinn decided to hard launch your relationship. you were fine with it at first. it was innocent, like the cuddling on trampolines you guys loved to do.

but now you were being called a slut. at this very moment, you were being called a slut and getting death threats. at the time, you were getting the same treatment.

it seemed his ex put the idea that he cheated on her with you, into everyones head. and they believed it. they believed it because of the stereotype against hockey players. the stereotype against girl best friends.

but that didn’t stop your relationship. you were so into it. you were there for everything, even his brothers… until you weren’t. it wasn’t like you both ended on bad terms. in fact, you both ended things, stating it was better to stay friends.

then she released a song. a song where she practically tore you apart, tore you down. you were the hot topic on her tongue.

she painted you out to be the bad guy. the manipulator. the one who made him take you to bed. you were just trying to hold him close and love him.

the only win from the whole situation was the fact he called you his favorite love. that you would always be the favorite.

but to everyone, you were the slut. you didn’t have a choice in that matter. you were the homewrecker. all because you liked a boy.

ynusername

liked by jackhughes, _quinnhughes and 625,737 others.

ynusername all because i liked a boy. coming out oct 14 (with permission). thinking of dating a boy with an ex? i wouldnt recommend it. especially if stuff happens after you had already broken up!

comments.

user and shes gonna eat 😜

user she alr did with ‘skin’ 🤭🤭

user DIE WHORE

_quinnhughes insanely proud of u y/n/n

ynusername thank u quinner 😪

jackhughes AND ALL OF THIS FOR WHAT⁉️⁉️⁉️

lhughes_06 WHEN EVERYTHING WENT DOWN WE’D ALREADY BROKEN UP 😱😱😱

user all hughes brothers being her no.1 supporters is so cute

jackhughes can i get you thin mints this time

jackhughes im exless!

jackhughes no im not but my ex forgot i exist!

jackhughes choose me instead!

_quinnhughes jack please this is embarrassing for u

jackhughes SHUT UP QUINN

user i cant tell if quinn is okay with this or not

ynusername he is 😭 me and him are best friends now and have no hard feelings or any romantic feelings towards one another anymore. plus jack will never have a chance 🤷‍♀️

user ITS GONNA BE A BOP LMFAO

user slut! homewrecker! cunt!

user banned!

user i love i live i laugh

user i alr know this will slap

trevorzegras @/jackhughes shes mine

user STOP.

user puckbunny ass bitch

user i know what im streaming when it comes out!

user i still prefer quinns ex over y/n

user then use her name instead of y/ns xx 😻

erm..! this lowkey sucks LMFAO

taglist (perm!) @hockeyboysarehot (just ask to be added for perm tags! <3)

#hockey #jack hughes #nhl imagine #nhl hockey #nhl #quinn hughes #luke hughes #quinn hughes x reader #quinn hughes x y/n #quinn hughes imagine #hughes brothers #all because i liked a boy

480 notes · View notes

voidpumpkin · 1 year

Text

A Guide For New Users Fleeing From Twitter, From A User Who Needed One When They First Started:

Hi to everyone fleeing from twitter, Elon Musk is shit and he already has had an actively harmful effect on the site, one that will only get worse. So, welcome to Tumblr, it can be kind of intimidating, given its reputation and how many different features there are, I was certainly confused and intimidated when I first logged on and as I'm active on both I sympathise with y’all, so here’s a guide to anyone new:

Put your hashtags in the hashtag section. This is the only way they’ll actually have any sort of effect, or appear when you search for something. Don’t post them on the post itself.

There is a character limit for hashtags and a quite high hashtag limit. Go wild. Writing entire speeches is common.

Don’t tag lots of unrelated stuff to your posts, that’ll get you reported for Spam and just hated in general

Don’t censor words, users are fine with swearing, doing so especially with triggering content makes it hard for people to limit their exposure to said triggering content.

There’s no such thing as ratioing.

We don’t have quote retweeting, every reblog, comment, etc counts to op’s post. They can see it all, and will be notified depending on their notification settings.

Change your icon, people will think you’re a bot if you use the default.

Give yourself a bio, it’ll make you look like a person.

Follow people and tags, that’s the only way you’re gonna see the content you wanna see. The foryoupage isn’t to be trusted.

Actually reblog stuff, liking has no effect, reblogging is the only important thing here as there is no like based algorithm. Doing so will also make you appear human.

You can hide your likes and who you’re following. Doing so is not frowned upon in the slightest.

You can block tags, similarly to muting words on twitter.

You can have multiple blogs tied to one account.

You can customise your blog, go wild.

There is no word limit, you can write as you want. But if it gets too long make use of the keep reading feature, (the three dots beside the add gif feature)

There is an image limit of thirty, up from the former ten, though for some they may be stuck at only using ten, tumblr is kinda inconsistent. If you want to add more you’ll have to reblog your own post.

There is no reblogging limit when it comes to a post, though there is a daily posting limit, go wild, only your followers will be upset.

You can have videos, gifs and pictures in the same post.

You can just post audio.

Adult content is still banned, but actual moderation and enforcement is spotty, especially if it’s written.

Spam liking and reblogging isn’t a thing. Go wild.

You have an ask box that people can submit stuff to. You can respond or just delete the post. You can remove anon capability from it (which will get rid of most of the hate), or outright bar it.

You can’t private your account but you can restrict commenting and reblogging. Edit: I’ve been informed that you can in fact make your blog password protected, it’s just that it’s a rarely done thing and not widely known.

Block whoever and whenever, it’s not a big deal. Though if someone you’ve blocked has reblogged and added to a post and someone you follow reblogs that, their commentary will still be included in the post you see.

We don’t have muting, only blocking.

Yes, direct messaging is a thing (it’s the little smiley face)

The only way to promote your is through ‘tumblr blaze’, you pay a certain amount of money and your post will be promoted, but not targeted, so no invasions of privacy. You are subject to the employee’s whims on whether or not it gets promoted and unfortunately hate speech has been allowed.

Tumblr has tendency to hide/consume comments, posts and asks, don’t be surprised if they go missing.

Tumblr searching a blog relies on tags, words in the post and the users name, keep that in mind.

Posts will remain after you delete your account or the original post if they have been reblogged.

Years old posts are still circulating and that is considered normal.

You can queue up posts to be released when you’re not using your account. Or you can just post whenever you’re active. Go wild.

Wizards exist and are very popular on this site. Accept it.

There are posts with no notes that will never gain any more than a sing note for your like. Accept it.

There are posts will no op. Accept it.

Trans and autistic people dominate this site.

Don’t get pissy when someone tags a post ‘tw (insert slur)’, or any trigger warning for that matter, most are just being considerate of their followers who may be triggered by such content.

Twitter discourse is regularly mocked, it’s not gonna fly here.

No, we don’t call each other oomfs, or anything like that. We just have mutuals.

Tumblr in general lacks a lot colloquialisms that began on twitter.

We do have ‘blorbo’ ‘poor little meow meow’ etc.

Trying to go viral or trying to corporate is frowned upon.

Tumblr has a tendency to blacklist things tagged like ‘crowdfunding’ so bring that kind of logic you use for twitter posts over to tumblr.

We don’t have twitter circles, co-posting, etc.

Tumblr is surprisingly good at recommending blogs.

There are no verified accounts, and your follower count isn't visible. This is a good thing, trying to change it will get you laughed at.

People are going to just make up stuff, don’t believe everything you see and if it’s a claim about someone, investigate it rather than just believe it.

You can edit your posts after you’ve posted them, but the versions reblogged before said changes will still circulate. This editing of the original has been used as a spruce of comedy

If your worried about people seeing your potentially triggering, or even graphic content and they haven’t blocked the tags you’ve used you can use the keeping reading feature to put the content under the cut and post a warning at the top.

And this is quite important:

Stay anonymous and have fun. There isn’t an expectation to constantly expose inner details of your life, you aren’t expected to use your real face, your real name, age, etc. You’re not even expected to be truthful here. Exist however you wanna exist and have fun, that should be the point of social media.

Also keep in mind that tumblr has its own distinct culture that is going to take some getting used to. As well as a history any user who’s been here a while will at least somewhat understand.

Also I'll be editing the post with additional info and corrections provided to me.

#twitter #tumblr #social media #Elon musk #giude #psa #hellsite #edited to correct some stuff #hellsite tag #edited again to add stuff and correct some information

4K notes · View notes

diorsluv · 4 months

Text

feather , part 18

“ your signals are mixed ”

series m. list previous chapter next chapter

( socialmedia!au )

yourusername

liked by luca.fantilli, dylanduke25, jackhughes, and 37,976 others

yourusername tell me that we’ll be just fine

view all comments

username15 FUCK IM SO CONFLICTED. THE TAYLOR REFERENCE BUT THIS POST IS HER AND BANK ROBBER

username67 wait ok but seeing her torn up like this is NOT okay

_alexturcotte oh no

lhughes_06 even when u lose ur mind?

→ yourusername tell me that it’s not my fault

username89 GODDDD the fact that luke knows the reference and finished it for her 💔

→ username27 fr it was luke NOT baxter ❌

username23 she and luke need to be together i’m begging

trevorzegras TAYLOR SWIFT

→ yourusername mama taylor 🫡

username58 i don’t like this booker guy and for good reason, like he can’t be out here breaking my girl’s heart like this

username33 ok but luke has that missseraphina girl or whatever her @ is

adamfantilli the matching stitch costumes

jamie.drysdale ily and i’ll always support you but you know what i think and i think it’s time you take my advice

liked by yourusername

username9 lets talk abt how she only responded to two people and one of them was luke

edwards.73 you know we’re here for you

markestapa i’ll beat his ass i swear to god

username71 stop they’re so protective of her

mackie.samo say the word and we’ll be there

username45 tbh the insta drama is kind of embarrassing

username68 she’s not acting like herself and it’s all because of HIM

username34 idgaf what balthazar thinks he can get away with but ik it aint this

username8 fuck bjorn

yourusername

liked by mackie.samo, colecaufield, _quinnhughes, and 88,117 others

yourusername finally posting the lakehouse pics i was gatekeeping for months 🫣🫣

tagged: jackhughes, trevorzegras, _quinnhughes

view all comments

dylanduke25 MARSHMALLOWS ROASTING ON AN OPEN FIREEEE

→ markestapa it’s chesnuts not marshmallows

→ dylanduke25 i know. 😐.

→ yourusername JACK FROST (hughes) NIPPING ATTTTTT YOUR LIPS

username46 are we just gonna pretend like that post from this morning never happened??

→ username59 if she does it, we do it

trevorzegras I MADE IT ON THE MAIN AGAIN!!!!

→ yourusername trev sweetie you gotta stop acting like i don’t post you constantly

username31 is that luke’s back or quinn’s back

→ yourusername it’s quinn!

colecaufield there’s no way you got QUINN to tan with you

→ _quinnhughes bro you were there when she took the pics

→ colecaufield oh was i??

→ _alexturcotte nah it was me rmb i’m the only one that’s seen her recently

→ colecaufield STOP RUBBING IT IN MY FACE

mackie.samo we never see you post yourself anymore 😔

→ yourusername i’m more focused on the scenery around me matthew.

→ mackie.samo OKAY OKAY u didn’t have to pull out the government name

→ markestapa she’s lying she just doesn’t have enough storage on her phone anymore

username26 that pic of jack and quinn i’m dyingggg

jackhughes remember when you burned 12 marshmallows in a row

→ yourusername remember when you said you were in love with me when you got drunk for the first time

→ jackhughes YO

→ _quinnhughes yeah how the hell do you burn that many marshmallows consecutively

lhughes_06 oh so am i just banned from all your posts now

→ yourusername 👎

username83 PLEASE I NEED MORE LAKEHOUSE POSTS

username15 didn’t quinn accidentally post jack trying to drown her on his public story once 😭

→ username2 WHAT.

next chapter notes ) a little tamer than the past few chapters, AND WE’RE GETTING RID OF BOOGER SOON SO LET’S CELEBRATE

tags: @aliaology @hockeyboysarehot @absolutelyhugh3s @jackquinnswife @freds-slut @love4ldr @blueeyedbesson @43hughes

#luke hughes fanfic #luke hughes fic #luke hughes x reader #luke hughes x y/n #luke hughes #quinn hughes #jack hughes #cole caufield #alex turcotte #trevor zegras #jamie drysdale #luca fantilli #adam fantilli #rutger mcgroarty #ethan edwards #mackie samoskevich #dylan duke #mark estapa

300 notes · View notes

pep-rambles · 2 months

Text

Lucifer is a Swiftie headcanons because I kin this man so much I am projecting my other hyperfixations on him

But also I mean c'mon,

Look at him

yes there is RadioApple in this

-It probably started from Charlie. When she was in high school (post emo phase obviously) she may have enjoyed Taylor Swift (maybe Fearless got her through her senior year because I can't stop projecting) Lucifer started listening to try and have something to bond with his daughter about. But about the time Charlie kind of lost interest is about the time Lucifer doubled down on his obsession.

-He has been to basically almost every Eras concert, usually in really good seats because many a swiftie has offered to sell their soul for tickets. He said keep your soul just let him tag along.

-He is definitely an Evermore stan mostly because of relating too hard to the divorce narrative of it.

-Speaking of, Charlie has threatened to lock him out of his Spotify after catching him on the floor crying to “Champaign Problems” on repeat too many times. She never would but most definitely tried to ban him from listening to it for a month.

-She then caught him crying to “You’re Loosing Me”

-Angel Dust is most definitely Beyhive (killer bee probably) and though initially joking that they are rivals the two men bond over their love for the two queens of pop, recommending songs and videos to each other.

-Angel is a Reputation Stan though

-After one of Lucifer’s many tiffs with Alastor, Charlie is expressing her frustration asking her dad why can’t they just get along and Lucifer explains that he doesn’t trust Alastor because “I think his ever-present grin is a little troubling” and is a little upset when she doesn’t get it

-One day, Luci is sitting in the Lobby doing his work while listening to Taylor on shuffle. He’s casually minding his own business jamming out to one of her poppier love songs and Alastor wanders in commenting on the “Obnoxious trite little diddy” Lucifer doesn't even hesitate to take the bait

L: HOW DARE YOU! SHE IS A TALENTED GODDESS!! A DOWNRIGHT MUSICAL CHAMELEON! You are such a snob Alastor! Good music didn't stop getting made after your tiny little lifetime.

A: I never said it did but it's certainly not this frivolous noise!

L: Oh, you uninformed uncultured cur! She is a fucking poet!

He then proceeds to play examples for Alastor of her most creative and heart wrenching lyrics (he absolutely makes Al sit through all 10 minutes and 13 seconds of ATW)

After all that though Lucifer will never get Alastor to admit that he finds T.S. musically talented (or that Lucifer did in fact catch Al tapping his foot a couple times)

-Alastor does come to Lucifer, after a bit of research, admitting that though he does not find her music enjoyable, he respects her business cunning. Luci figures that's good enough. For now.

-because I bet my non-existent Eras tour tickets that Lilith was a hater. I’ll leave it at that.

-OP works at Barnes & Noble and let me tell you there are about 80 different Taylor Swift magazines that even my swiftie ass thinks is excessive but Lucifer has every single one

-including the Taylor Swift paper dolls magazine (yes this is a real thing). He probably gets a few because he convinces Charlie to use them as a team building activity.

-He has at least 3 copies of each of the covers for the 2023 TIME Person of the Year magazine.

-Also all cardigans. On a casual day he definitely lounges in them and has a set rotation of when to wear each one (and I am totally not gonna draw that nope)

-Well, it seems Lucifer is no longer crying to the depressing break-up songs on repeat but now he seems to be angrily listening to “Gorgeous” on repeat. Charlie asks him about it and he goes full denial mode “No no Charlie I'm not thinking of anyone specific, I've just been really into this song lately.” Everyone else in the hotel, besides Alastor, has already figured out what's going on

Alastor: If I have to hear that obnoxious noise one more time I will reduce that tiny maniac’s room to rubble as well as the abode of whatever sad sack is making him play it.

Angel: *knowing smirk* I'm gonna hold ya to that one, Antlers.

-Al may very well hear it one more time if Lucifer uses it as his confession song (I don't fully commit to this headcanon, I just think it's funny)

-Anyway boy’s probably in his Reputation stan Era b/c LWYMMD is like his long overdue big F-YOU to Heaven song

btw this is NOT gonna end at these headcanons I am running with this idea like scissors.

@nunalastor

@julsiemagne

@nose-nippin-fun (I know you're not a swiftie but we talked about this so idk if you care I can un-tag you if you want)

252 notes · View notes

ultimate-submas-tournament · 11 months

Text

Do you like Submas? Do you like polls? Do you wish there was more polls to vote for train boys on?

Then boy do I have the tournament for you!

Introducing the

ULTIMATE SUBMAS TOURNAMENT

Where all the Ingos compete to find the best Ingo, and all the Emmets compete to find the best Emmet- and then they duke it out!!!!!

Come explore this melting pot of different AU creations from across the website- including your own!

That’s right! You too can compete in this for fun event! Get yourself out there!

Here’s the rules and how to sign up:

1) No bl///shipping AUs or bl///shipping blogs may enter. This is a platonic only submas tourney.

2) No NSFW 18+ AUs or NSFW 18+ blogs may enter. I want this to be welcoming to younger folks to so I’m gonna have to draw a line here.

3) You can only enter your own AU. You can share this post with other submas creators, but you can only personally enter AUs that you have made content for.

4) You can only enter AUs that have content made for it. It doesn’t matter if that content is a fic, a few drawings, or a series of interconnected tumblr asks- as long as there is content you can link me to, it qualifies.

5) You may enter up to two AUs (one for each brother). This may be lowered to one AU per user if the demand gets too high.

6) While non inc/st ships are not outright banned, AUs must be more than “canon compliant warden Ingo but he’s dating Melli”. Give us something fun to work with.

7) AUs can, and are encouraged to crossover with other content. Cretur AUs are also allowed because turning blorbos into cretur is fun.

8) Only Ingos and Emmets may be entered. We all love Elesa but this ain’t her tourney. (Fusions can be entered, but they will be placed in a fusion only bracket that will not affect the main tourney)

9) Lower your expectations. This is for fun, there is no prize, and statistically you will not win. Please do not whine and complain when you are inevitably knocked out.

10) BE NICE TO THE CONESTENTS. Holy heck don’t make me catch y'all harassing other people for ANY REASON. I will block you. Don’t make me do it.

How to enter:

Reblog this post with

1) The name of your AU

2) A link to your fic /tumblr tag /masterpost

3) An image that you want to represent your AU. (If you have no image, one of my associates or I will draw a simple one- but it won’t be very good and you shouldn’t expect much)

4) The name of the preferred brother you wish to enter (preferred brother may be overruled if the brackets get too uneven)

(If you plan on entering a second AU, you must do these steps again with a second reblog. The first AU you enter will be considered the priority if we get too many entries.)

(Entries may be denied for things like: side bl///shipping accounts, pedo//ilia, harassment or other things in that same vein. They may also be denied for more benign things like, “hey I love you lots but this is just canon Ingo”)

Entries must be submitted by the first of June!! Thank you for participating and ALL ABOARD!

#submas #submas au #subway master emmet #subway master ingo #subway bosses #subway boss emmet #subway boss ingo #bracket tournament #pokemon

828 notes · View notes

54bpm · 1 year

Text

Tips For Vtubers

Howdy there, I’m Liv and I’m a vtuber much like you, but I’ve been here the whole time so I’m here to compile stuff for you to help make your transition less scary.

To start, here’s is a post with a lot of tips for general tumblr use and here’s one for giving your blog a custom theme.

Beyond that here’s other things that aren’t mentioned but are gonna be relevant for you:

If you’re coming back to tumblr know that you can’t follow from your sideblog, if you want to follow back it will be from your main, as will your likes, replies, asks. Decide what to do with this information now before you settle into a blog.

Fully explore the settings, there's a ton of stuff hiding in there. AND do it on PC at least once, some stuff is not in the app.

Blogs have individual block lists, no idk why either. So if you want someone banned from everything you need to do that manually.

Also enable tumblr Labs! It’s got reblog graphs which are rad (my beloved orbs) And alternate dashboards, the Blog Subscriptions one is my fave because it means all you have to do is turn on notifications to get all your fave guys in one dashboard.

Contrary to popular belief there is still a porn and adult content community here, if you want to get anywhere near them you have to have age in bio or they’ll smite you. EDIT: I posted more about how to navigate lewdposting here.

Tiktok embeds don't play nice with tumblr for some reason, if you also do tiktok then just reupload your videos and link your account there underneath.

The link post type will show up for your followers but there’s a chance it won’t show up in any tags, so don’t do going live posts like that.

BUT you can straight up embed your stream into your posts! As long as you're using the New Post Editor you should see this menu:

Click the video camera, link to your twitch and bam. There it is. You can also do this with the video post type! If you're ever worried about your post format getting bonked just go through the tags and see what posts that DO make it are doing. Together we can overcome spaghetti code.

General "tumblr culture" is to not comment on posts but its not one thats set in stone, your fellow small vtuber account is probably dying for interaction so comment on posts! scream in the tags! send funny asks! Getting interaction right now is going to be a big comfort during a weird time.

Oh yeah we have ask boxes built in, no marshmallow needed.

ALSO we have pinned posts just like twitter, but as long as you want! Put your ref & socials & art tag (yes you can keep your fanart tags) & your minors DNI & a picture of your cat if you want.

OH I do suggest picking out tags for your personal content if you plan to also do reblogging, makes it easy for newcomers to find what you're doing.

#vtuber and #indie vtuber are full of fanart for the big guys. If you wanna find each other use #vtuber uprising

Okay this post is getting so long but final tip: check out custom pages. They're on the custom theme menu and they're basically mini webpages on your blog that can have their own coding. You can do Literally Whatever. Lore! Credit page! Ref sheets! I once put a choose your own adventure where you navigated by clicking specific parts of a picture on tumblr pages. I Mean Anything.

That's all for now, please add other tips if you want. And please reblog! Not just this post but other peoples too! This will all be way less of a drag if we can find each other. 💖

EDIT: One more thing, lolisho shit Does Not Fly here. They are some of the only tags that tumblr has actually shadowbanned and there is a reporting criteria for it to get taken down. It also doesn't fly on my blog! Begone!!

#vtuber #indie vtuber #vtuber uprising #envtuber #livs words #i felt like a specific to us post would b good #since we have specific stuff to worry about like going live posts n etc #also please do themes i wanna see yall go apeshit #post edit #while i doubt that tumblr has the vibes that makes people think lolisho would be welcome here #the post is starting to get big enough that its worth mentioning #resource #tutorial

1K notes · View notes

corrodedbisexual · 1 year

Text

The ultimate shadow ban survivor guide

I've seen multiple people I follow, or their mutuals affected by shadow bans lately (makes me wonder if it's @staff's attempts to fight bots going totally haywire). As someone who survived a 2-month-long shadow ban on my main this winter, I thought I'd make a post.

First step of being shadow banned: calm down and take a breath. A shadow ban is just a stupid glitch in tumblr's anti-spam system. You're not losing your blog. You're gonna need a whole lot of patience, and deal with inconveniences, but it's fixable.

Read the incredibly useful post All About Shadowban by @that-damn-girl. It outlines the symptoms quite well. The only thing I'd point out is "your original posts won’t be visible to your followers either" - afaik that doesn't happen. Everything you post and reblog will still be visible to your followers, and also they can interact with your posts - like them, reblog them, reply to them.

Just like the post says, contact support. I recommend using a different email than what your banned blog is registered to; not because your ticket won't go through (mine actually did, as I found out when they finally replied), but because you might not receive an email confirmation for your ticket (it's somehow tied to the anti-spam thing, I think), and you're going to worry and try to send more tickets, like I did.

Now wait. And wait, and wait, and wait. They are SLOW. I've seen some miraculous 1-day unbans in the #shadow ban tag, but most people, like me, wait around a month for support to reply. Those are the same guys going through thousands of bot reports every day in addition to user tickets.

If you're going to wait, might as well keep blogging. Now if this is your sideblog that's shadow banned, consider yourself lucky. Make a new temporary sideblog, use it to post your original stuff so it goes into tags (mind that it might take a few days for a new blog to start showing up in tags). Reblog everything to your shadow banned blog so you still have all content in one place and your followers see it. If it's your main that's banned, you can still do that, but there's the extra pain of not being able to reply to posts or send non-anon Asks, since that is only done from main. Might need to register a separate account for that.

Some more fun facts under readmore.

Fun fact #1

Trying to send support follow-up emails in the request confirmation email isn't going to do anything to speed up the process. But I did tweet at them using this tumblr support summoning picture by @cornmayor and offered a raccoon blood sacrifice to resolve my issue when it was like a month with no response. This is what they replied.

3 hours later I got an email that my shadowban was lifted. I honestly don't know if it was a coincidence, but I mean, this is tumblr staff. Maybe they do accept blood sacrifices.

Fun fact #2

If you're wondering why my shadow ban lasted 2 months if I got a support reply after 1 month, well. It's hard to say exactly how their ban/unban system works bc support replies exclusively with pre-written template sentences, but basically they fucked up. The first time they told me my blog has been restored, I gained pretty much all functions back, except that my posts were still not appearing in tags. Which means probably that being hidden from tags is some kind of different flag on your blog that they forgot to remove. So I had to send a follow-up ticket and wait another month.

My advice is, when they tell you it's fixed, don't take that at face value, go and check all the functions you'd lost (replies, messaging, asks, tagging, appearing in notes, getting mentioned by others).

#tumblr #shadow ban #shadowban #tumblr support #reference

623 notes · View notes

love-belle · 10 months

Text

my entire universe !!!

*ੈ✩‧₊˚ in which they're all one big happy family.

for when you find everything you spent your life looking for. ˚ ༘♡ ⋆｡˚

social media au // pierre gasly x fem!reader

warnings - language

author's note - hello!!! i absolutely loved writing this so much, dad!pierre so ❤️❤️❤️❤️ and he'd be such a girl dad likeeee !!! anyways, i hope u liked it!! thank you so much for reading, i think i'd be able to post another social media au by tonight but im not sure :/// i love you all so much <3

≡;- ꒰ °instagram ꒱

liked by pierregasly, carmenmmundt, lilymhe and 789,426 others

yourusername can't believe that im a MOTHER like i MADE that baby and the baby is real cute

7,267 comments

username BABY ADELAIDE

username addy's mom is y/n y/l/n and her dad is pierre gasly what's there to explain

username i love baby adelaide so much omg

danielricciardo missing miss addy ❤️❤️❤️

-> yourusername she misses her uncle danny ❤️

username i would die for baby adelaide

username y/n really is MOTHER

*liked by pierregasly*

lilymhe missing my best friend ❤️‍🩹

-> yourusername me or addy???

-> lilymhe yes.

username still in disbelief that y/n and pierre have a CHILD like they're actually PARENTS

username adelaide ❤️❤️❤️❤️❤️❤️❤️

lewishamilton roscoe misses his best friend 🤍

-> yourusername she misses HER best friend ❤️‍🩹

username i live for the grid basically adopting addy

charles_leclerc my fav god daughter ❤️

-> landonorris MY god daughter

-> danielricciardo actually no

-> maxverstappen1 move it's me

-> lewishamilton not really no

-> carlossainz55 it's me actually

-> yourusername i'll just stay out of this one 🔥🔥🔥

pierregasly we make cute babies

-> yourusername fuck yeah we do

pierregasly she takes after her maman

-> danielricciardo thank god

-> yourusername LMFAOOO

-> pierregasly you're now banned from our house.

≡;- ꒰ °instagram ꒱

liked by yourusername, carlossainz55, georgerussell63 and 864,427 others

pierregasly nine months of the most important job ever ❤️

7,976 comments

username DAD!PIERRE

username IN LOVE WITH THEM OMG

username tearing up ngl

carlossainz55 my fav gasly and then it's pierre

-> pierregasly ok fuck u i guess

username ADELAIDE AND PIERRE 😭😭😭😭😭

-> username iconic duo

username he's such a girl dad i love him

lewishamilton can't believe it's been nine months already

-> pierregasly i know like time flies

username I LIVE FOR BABY ADELAIDE CONTENT

username i would go to war for baby addy im not even kidding

charles_leclerc she's growing up so fast

-> yourusername charles don't he'll start crying AGAIN

-> pierregasly she is 😭😭😭

username i feel like a proud mother omg

username the way we basically witnessed them getting together and now they're PARENTS like

-> username we went from them awkwardly flirting to them having baby together 😭😭😭😭😭😭😭

-> username we've come so far ❤️‍🩹

yourusername my whole world ❤️

-> pierregasly we love you so much

yourusername the bad papa ever 🗣️🗣️🗣️

-> pierregasly 🤟😏

-> username HELP THE EMOJIS

≡;- ꒰ °instagram ꒱

liked by danielricciardo, lilymhe, carmenmmundt and 789,625 others

yourusername the loves of my life ❤️

tagged pierregasly

7,246 comments

username IM GONNA CRY

username THIS FAMILY BRUH

username they're so ❤️❤️❤️❤️❤️❤️❤️

username pierre in the first photo 🫤🫤🫤🫤🫤🫤🫤 i love my parents so much 🫤🫤🫤🫤🫤

lilymhe ❤️❤️❤️

*liked by yourusername*

username BABY ADELAIDE IS ADORABLE LIKEEEE

username they're so family goals 🔥🔥🔥

username what do i gotta do to be adopted by them question mark

charles_leclerc maman misses her petite fille ( grand daughter )

-> yourusername bringing over addy asap she misses her grandmère ( grandmother )

username the fact that baby adelaide is literally the paddock's princess

-> username she has every single driver wrapped around her finger and she can't even talk

username i have only had baby addy for some time but if something happened to her i would kill everyone in this room then myself

username this family gives me so much serotonin ❤️❤️❤️❤️❤️❤️

danielricciardo BABY GAAAAASSSLYYYYYY

*liked by yourusername*

username ok but we NEED to know who's her godfather

-> username REAL like it's such a mystery

landonorris stealing baby adelaide watch out

-> yourusername pierre is asleep rn but he would kick your ass

-> landonorris i 👏 don't 👏 care 👏

username god me when

username this is so domestic i love

username pierre is so babygirl in the first photo like

-> yourusername he's always so babygirl

-> yourusername im getting this comment framed btw

-> username HELP BABYGIRL

≡;- ꒰ °instagram ꒱

liked by yourusername, landonorris, carmenmmundt and 896,426 others

pierregasly my whole universe ❤️

tagged yourusername

comments are disabled for this post

#f1 x female reader #f1 x reader #social media au #fake instagram imagines #f1 imagines #pierre gasly instagram au #pierre gasly x y/n #pierre gasly x you #pierre gasly x reader #pierre gasly #pierre gasly imagines #pierre gasly imagine

1K notes · View notes

falseposting · 5 months

Text

if humans had wings (basically angels but not holy at all)

0 notes

🫧 dyed-wings-society Follow

Hey guys, just a PSA to not use BloodFeather's products. Their dye can really mess your wings up since they're loaded with unnatural and unsafe chemicals. Im suprised ppl r still buying this stuff when theres way better alternatives (TRUEFLYGHT, StuffOfDreams, etc.)

🦋 whats-a-wingspan-again Follow

hey op. what do you do if you use this stuff. op. op i just split dyed my wings with this stuff op. help it burns

🪷 flylow-glidehigh Follow

oh i know this one!!! immediately get into a hot bath with all your good products (like soap, softner, whatev) and soak wings for about 5 minutes till the color starts coming off. rinse and repeat till it's all gone!! though, in more severe cases, you might have to get it treated at the doctors (lets hope this isn't the case)

🦋 whats-a-wingspan-again Follow

ARGHH THANK YOU SO MHCH YOU WONDERFUL PERSON.

#this is gonna take so long #but worth it #i hope they ban this stuff from stores #ok no more tags i gotta run

14,325 notes

🪽 winged-folk-polls Follow

#collecting info

156 notes

🍯 gladiatorofgliding Follow

hate how theres not representation for people who actually can't fly. id kill for a movie where the main character can only slightly hover above the ground for a few seconds and/or glide. i want to see a movie where the main characters wings haven't fully grown in yet due to a disability. please.

🎰 overdecoratedexplosion Follow

let me introduce you to scootaloo from my little pony.

🍯 gladiatorofgliding Follow

THIS IS MY DAUGHTER NOW. I LOVE HR SO MUCH THANK YOU FOR THIS

🪀 childrens-show-mentions Follow

Scootaloo from My Little Pony: Friendship is Magic.

#media: mlp:fim

3,200 notes

🎧 touchdowntoearth Follow

ok guys.do not fly with headphones in. i couldn't hear anything and i was so deep into my flying session that i crashed into a literal flying class for youngins and. oh my god i feel so bad nobody talk to me

💌 cupidology Follow

#posts that have 10,000 notes

178 notes

#falseposting #unreality #🔎 > alternate world #fake posts

147 notes · View notes

alxtiny · 6 months

Text

Hiiii ! Back to request again !

Got inspired by San singing Rewrite The Stars in his Toktoq live and thought of this.

What about idol San and idol (fem or gn) reader being part of groups considered as rivals or rival agencies but San and reader are dating. No one knows about it until one day, they do a collab stage in which they perform Rewrite the stars together. And at the end of the song, in the heat of the moment, they kiss on stage, in front of everyone

Requested by @s1riushwa

Rewrite the Stars | Choi San x Reader

Synopsis: where you and san wish to change the way the world works

Pairing: choi san x gn!reader, idol au

Genre: fluff, slight angst

Word count: 1.2k words

Warnings: none :)))

Notes: I am seriously so sorry for posting this so late it didn’t show up in my notifs and I didn’t think to checks inbox and submissions and ended up not seeing your request, i hope this meets your expectations 😭😭😭

masterlist

The tension between JYP Entertainment and KQ Entertainment was always palpable, both companies boasting top-tier idols. However, hidden beneath the rivalry was a secret that no one knew—except for you and San. Despite being idols from rival companies, you and San had been secretly dating for over six months.Your groups had no dating bans, but you both decided to keep your love life private, away from the prying eyes of the media.

You know I want you

It's not a secret I try to hide

You know you want me

So don't keep saying our hands are tied

The atmosphere backstage was electrifying as you prepared for the highly anticipated joint performance between JYP Entertainment and KQ Entertainment at the annual music awards show. The crowd in attendance would be a mix of diehard fans from both companies and newbies alike. You’d have an opportunity to showcase just how talented each company is and put aside their differences.

You claim it's not in the cards

And fate is pulling you miles away

And out of a reach from me

But you're hearing my heart

So who can stop me if I decide it's on my destiny?

As you and San stood side by side, waiting for your turn to perform, you exchanged a knowing glance. The chemistry between you two was undeniable, and your fans had noticed it too. They often tagged your companies in tweets, suggesting that you and San collaborate on a stage together. Tonight, that dream was about to become a reality.

What if we rewrite the stars?

Say you were made to be mine

Nothing could keep us apart

You'll be the one I was meant to find

The announcer began calling out your names before introducing the two teams’ newest starlets. The crowd roared with anticipation as you took the stage. You held your mic up, clearing your throat as you readied yourself to sing.The music started, and the stage lit up, casting a warm glow on both of you.

It's up to you, and it's up to me

No one could say what we get to be

So why don't we rewrite the stars?

And maybe the world could be ours, tonight

The opening notes of "Rewrite the Stars" filled the air, and you began to sing, your voice blending seamlessly with San's. Suddenly, the stage went dark, and bright lights shone on the two of you. For the first time ever, you shared the same stage. Your voices blended perfectly, your dancing synchronised, and the cheers of your combined fanbase echoed throughout the arena.

You think it's easy

You think I don't wanna run to you, yeah

But there are mountains

And there are doors that we can't walk through

It was almost like everything you’d worked towards since becoming stars came full circle in that moment. This could have been your big break, but instead, it felt more like you were living a dream. The lyrics spoke of defying the odds and rewriting destiny, a fitting sentiment for your relationship.

I know you're wondering why

Because we're able to be just you and me within these walls

But when we go outside

You're gonna wake up and see that it was hopeless after all

As the song progressed, your eyes met San's, and in that moment, it felt like the world around you faded away. You sang with passion, pouring your heart into every note, and San matched your intensity with his soulful voice. The audience was captivated, swept away by the emotion in your voices. As the last chords rang out, everyone exploded into thunderous applause.

No one can rewrite the stars

How can you say you'll be mine?

Everything keeps us apart

And I'm not the one you were meant to find

That night, your joint performance set the tone for your relationship and laid the foundation for what was sure to be an epic romance. Although the two companies kept your relationship under wraps in the heat of the moment, San leaned in and pressed his lips to yours. It was a soft, sweet kiss, filled with love and tenderness. The crowd gasped in surprise, and then erupted into cheers and applause. Your fans and his fans alike were overjoyed, their tweets and messages immediately flooding social media with support for your relationship.

It's not up to you, it's not up to me, yeah

When everyone tells us what we can be

And how can we rewrite the stars?

Say that the world can be ours, tonight

The kiss only lasted a moment, but it spoke volumes. It was a declaration of your love for each other, a moment of vulnerability shared with the world. As you pulled away, San's eyes were filled with affection, and you couldn't help but smile at him. As you finished your performance, the applause grew even louder, turning into a standing ovation that lasted for several minutes. All the while, your cheeks flushed red with embarrassment, feeling like you were blushing again for the first time since meeting San. Bowing with the biggest smiles on your faces, you exited the stage.

All I want is to fly with you

All I want is to fall with you

So just give me all of you

Backstage, your fellow idols congratulated you both, showering you with hugs and high-fives. The performance had been a success, not just because of your vocal prowess, but because of the genuine love and connection you shared. Your fans continued to express their support online, sharing clips of the performance and praising your relationship.

It feels impossible

Is it impossible?

Say that it's possible

In the days that followed, the video of your performance went viral, garnering millions of views and countless positive comments. People admired your bravery, your willingness to share your love with the world. The media picked up the story, highlighting the overwhelming support from fans and fellow idols alike. Everyone agreed that this was the start of something special. Even JYPE and KQ Entertainment couldn't deny that there was nothing but love between you and San.

And how do we rewrite the stars?

Say you were made to be mine

And nothing can keep us apart

'Cause you are the one I was meant to find

After winning awards for Best Collaboration and Rookie of the Year, it seemed that things were going to continue to get better and better. One week later, news broke that JYP Entertainment and KQ Entertainment had decided to do more collabs together, agreeing to promote each other's artists in order to further develop their business.

It's up to you, and it's up to me

No one could say what we get to be

And why don't we rewrite the stars?

Changing the world to be ours

The announcement ignited controversy amongst the entertainment industry, sparking heated debate among industry insiders and fans alike, but to you it didn’t matter because you knew your fans and atiny supported your relationship. After seeing all the comments on Twitter and Instagram, it was clear that the decision to make your relationship public was one of the best decisions you'd made.

Send an ask or a message to be added to taglist

Requests are open!!!

DISCLAIMER: THIS IS PURE FICTION AND NOT RELATED TO THE MEMBERS OF ATEEZ IN REAL LIFE PLEASE DO NOT TAKE IT SERIOUSLY

Taglist:

78 notes · View notes

sanjisboyfie · 7 months

Text

one piece smau: dating vivi edition

— IM AWARE SOME OF THESE HAVE RLLY BAD BLUE EDITTED HAIR BUT I WANTED TO TRY IT OUT AND SEE HOW IT WAS 😭

— a little different because its still modern au but i wanted to go with teh idea that vivi was still royalty and reader is her rlly hot bf that the public likes, but tabloids hot bc they dont think hes good enough for her ... whatever that trope is im a sucker for so thats why i made it this way

— male reader B)

liked by king[name], igaram, ttchopper, and 530k others

queenvivi: visited drum island <3

tagged: king[name]

dni_nami: popcrave is gonna love this onneee cuz u look so good here vivi !!

-> queenvivi: thank u nami, i miss u sm !

-> uso_pp: popcrave jus posted on twitter "queen vivi slays in recent photo, shocking the entire country"

king[name]: WHAT DO YOU MEAN YOU'RE MY GIRLFRIEND ???I FEEL SICK TO MY STOMACH YOU'RE SO BEAUTIFUL

freeluffy: vivi when r u going to visit us :////

[liked by princesanji, dni_nami, and 70 others]

king[name]: DO YOU NEED A PET? DO YOU NEED A DOG? I'LL BE A GOOD PET FOR U MY QUEEN

-> queenvivi: ??? babe i'm gonna change your password very soon

-> king[name]: WOOF WOOF WOOOOF

-> dni_nami: this why the media hates u [name]

liked by pell, queenvivi, and 70k others

king[name]: will go to as many boring royalty events if it means im by her side <3

tagged: queenvivi

randomroyallyobsessedfan: UGH THEY'RE SO CUTE I LOVE THEM I CANT WAIT FOR THEM TO GET MARRIED

queenvivi: you're so handsome in all of these, im the luckiest woman in the world

roro.zoro: can't you get into a lot of trouble with literally every country for complaining abt this???

-> king[name]: proof?

-> roro.zoro: mf wtf do u mean proof??? THE PROOF IS RIGHT IN THIS POST

igaram: i'm going to murder this dumbass boy.

-> king[name]: oooh im telling on you to miss terracota

[liked queenvivi, dni_nami, and 100 others]

princesanji: i can't believe they make queen vivi cover her blue hair for these events, they are suffocating her natural beauty </333

liked by dni_nami, freeluffy, and 103k others

deuxmoi: do you guys remember when vivi and [name] started dating? the royal couple are everyone's favorite pair !! happy four years to the two of them, to many more in the future to the cutest couple in the worllddd!!! p.s. honestly thank god for [name] because we got to see vivi in his iconic leather jacket, hello?! she looks so good!!

tagged: king[name] and queenvivi

randomroyallyobsessedfan: atp if he doesnt propose to her i will

-> anotherrandom: if she doesnt marry him atp i will

uso_pp: its crazy we r literally friends with the queen of a whole country

-> freeluffy: no we are BEST friends with vivi, usopp :DDD

[liked by queenvivi, king[name], and 200 others]

ttchopper: i remember when they first met, vivi was a blushing mess the entire time

-> queenvivi: please do not remind me. its so embarassing chopper.

-> king[name]: my own girlfriend is embarassed of me </3

princesanji: it should have been ME

-> king[name]: you're a fraud dni w me thanks xoxo

liked by robinkills, king[name], and 450k others

queenvivi: what lana said that one time

tagged: king[name]

dni_nami: i pyo to that song where is my credit

king[name]: stop i am NOT a serial killer the tabloids r gonna have a field day w this reference pls

-> uso_pp: if hes a serial killer then whats the worst that could happen to a girl thats already hurt. im alreayd huurutttt

[liked by queenvivi, king[name], and 200 others]

igaram: QUEEN VIVI BLINK TWICE IF U NEED HELP

-> pell: i'm going to confiscate your phone, she is fine. please relax igaram.

liked by queenvivi, princesanji, and 200k others

king[name]: alexa play seven by jungkook EXPLICITY VERSION. EXPLICIT VERSION. EXPLICITY VERSION.

tagged: queenvivi

robinkills: it's like [name] wants to get banned from seeing vivi again

-> king[name]: the entire country trying to keep me out will not stop me from seeing my beautiful girlfriend

dni_nami: seriously??? of all songs???

-> king[name]: its the way that you can ride its the way that you can ride

-> dni_nami: PLEASE SHUT TH EFUCK UP

-> queenvivi: babe please stop i can't keep explaining these references to my father he might kill you

-> king[name]: LEAVE YOU WITH THAT AFTERGLOOOWWWW

roro.zoro: 3d a better song but alright

-> uso_pp: the way you couldn't be more wrong???

king[name]'s story

i would lay down my life to protect this woman form any harm to come her way, some of you simply will NEVER understand

queenvivi replied to your story: i love you so much, let's stay in tmrw to relax

#≡;- ꒰ ° smau series ꒱#one piece #one piece imagines #one piece smau #one piece modern au #one piece x reader #one piece x male reader #x male reader #male reader #vivi x male reader #vivi x reader #one piece vivi #male reader imagine #vivi imagines

138 notes · View notes

saezurumurmurs · 20 days

Text

A BL Platform For Everyone

NB: Please reblog this for visibility!

A little over two years ago, me and my BL crew were in our little chat sharing recommendations.

Cat had an impressive spread sheet, Marcie and I had iCloud Notes, and it was pretty much chaos.

I looked at it and said out loud, "There has to be a better way for us to keep track of our reads and share recommendations. There has to be right?"

Cat said she wished someone would build a BL app with everything already there. Me, a developer of almost thirty years, paused while a floodlight (not a light bulb) went off in my head.

“Well I could maybe build one… cause like, I build stuff. How would that be?”

By the end of the conversation Cat had invited me to build an app for BL.

Four weeks later, in late February of 2022, digitaljuicy.com was online.

In the last couple of years, I’ve been listening to the fandom, paying attention to feedback, poured over analytics, read your responses to the Reader’s Survey and continued to craft a platform with all this in mind.

What I have been building is 100% for us... there is nothing but BL and it is an attempt to encompass ALL of BL. Not just the bits and pieces.

But for two years I've been struggling. Struggling in many ways, but specifically to get what I wanted out of the platform. I tried and failed so many times.

In September of 2022 I tried to raise venture capital to build the platform I wanted for us. I pitched it to accelerators and true blue venture capital.

Juicy is what is called 'pre-seed'. Which means were still so new and evolving, under-resourced and while there was interest, there was no joy. No funding was raised.

In December 2023, I realised it was time to rethink Juicy. i have been on the deepest dive for months rebuilding Juicy from the ground up and preparing the framework for the mobile app.

I’ve built something I want to use… and wild, I’m building it and using it as a fan at the same time. I'm at the point where it's impossible not to want to share.

And what kind of platform do I mean? At its most basic level:

You can track your reads, watches and plays

You can review and recommend the titles to the community, your friends, strangers on Twitter, your friend you're trying to corrupt outside the fandom. Your poison.

Timelines for you, for titles, for episodes, chapters… just about everything. I mean everything: The creators, the publishers, the studios, the actors... you can leave reviews and status posts on EVERYTHING. No algorithms, no force feeding... just discovery, recommendations and honest reviews by this community about our community and the industry we feed.

Collections! Lists of stuff you're reading, dropped, want to read, want to buy, love or hate, all pretty and organised and shareable..

A growing database resource of titles, tagged up to its eyeballs with a minutiae of data.. with reading an streaming links and anything else we find that we think is relevant.

But it is also a lot more than this.

I wanted it to be more than what it was. I want to turn Juicy into a mobile app, add some more functionality and more specifically, platform all of BL for its non-Asian fandom.

We get left out of so much, I feel like we need our own thing.

I don’t know about ya’ll, but I was tired of being banned on social media for sharing content. How you gonna ban me for saying a 2D fictional character needs to be shot with shite and strung with cobweb? But they did… and I know it’s not just me.

What about the creators? How do they interface with the non-Japanese or non-Korean fandoms? On which misogynistic hell site?

What about the publishers and merchandisers? What about the little Etsy sellers? Why does BL have to hidden away in the databases of mangaupdates, anisearch and anilist? Why does every single manga tracker out there seem to have pitiful listings for BL?

Is it because we’re a female or queer audience?

Look at this lil video I made:

youtube

Either way, I’ve long felt it’s time for us to do our own thing. So I’ve been building it. Pixel by pixel. Feature by feature on my own.

Juicy has been a small chat group, but I’m the only developer. We’ve always been clear about what we wanted to build: A platform for the fandom, the creators, the publishers, the merchandisers… my goal is a one-stop platform for BL and I am damn close to presenting this new iteration.

This was and remains the core of what I’m building: The largest English platform for BL on the planet. The functionality is one thing, but building a database like that is not a one-person job.

So now I need your help.

First to keep the servers online, so I can continue to build and develop and finally, finally release the mobile app. I can't tell you how much I want that.

I’m close to pushing the new Juicy 3.0 out, and I’m very in love with the work I’ve done since December. It’s a new look, and it works 1000 times better than the previous iterations of Juicy.

I just have hit a wall financially, and need your help and support to get it over the line.

Juicy's ass is fat and I been carrying her mostly alone for two solid years.

I’m going to launch a Kickstarter for this project in a bit so I can hire another developer to help with the trickier bits and fine tune the mobile app, but for now, I felt a Patreon would at least help us keep the servers up and maybe, just maybe allow us to afford a few crucial bits that will elevate your experience as a user.

And because I’m a developer, and I can do some pretty kinky shit with APIs and such, if you support this Patreon campaign, you will get some nice feature perks on the platform automagically. You won’t have to pay again to access these perks in-app later.

As many perks as I can cook up anyway, not the least of which will be access to some of the nicer functions and features I’ve already built into the platform.

When the mobile app launches, you will get it first and for free! Plus we’ve been talking about a lot of other ways we can make the platform fun beyond what I've done already.

I plan to monetise the platform in various ways, but in a profit sharing model. You contribute to the database, you contribute content, you get a share of whatever the platform makes. This is already built into the system. This will be open to anyone willing, but to Patrons first.

Finally, I'm limiting the number of people who can subscribe via Patreon to 1000 people. Once we hit that number, the rolls will be closed to new membership, and everyone directed to the platform to pay for any services or merchandise.

My goal for this group of Patrons is that you become an exclusive and tightly knit inner circle.

My hope is that you will help me actively shape what Juicy will become. Your votes and say will carry weight. Your feature requests considered and if possible implemented first.

You will get access to exclusive merchandise, exclusive giveaways and promos (like free stuff), and exclusive programming from the team.

With your help we will produce an exclusive podcast for Patrons only discussing all things BL and Juicy (honestly our conversations are generally wild and hilarious... it will be a rollick for sure), along with other content for Patrons only. We've even planned watch parties and other fun shit... I swear, we want you all to be our greatest ambassadors so we are planning as many treats as we can.

Your access on the platform will be specific to your Patreon subscription and your treatment will be VIP for the life of your subscription.

Finally, the way my auADHD are set up, I have no interest in the dramas of the BL fandom, so this is never going to be about gatekeeping access to anything. It’s about making more access possible. You can help bring us all together and make us stronger as a group.

So do you think Digital Juicy sounds like something you’d like in on?

Okute Sea

Saezuru Murmurs

34 notes · View notes