1 think Biology is very cool.... I might persue something biochem related! I also really liked the genetics units in my classes, so I think this is a really cool gimmick blog. I'm gonna type in random stuff from here on out, are you able to find a match?
Random phone recommendation gibberish:
I'm going through a bunch of different things and I just can't get any it just seems to have been deleted from my computer and it's just been a lot of stuff and I can't find anything to do and it's not working I so I just need a password and password to get my password and then I'II be back to work on my phone so I I'm not really gonna get to work anymore I'm not even going anywhere I I'm gonna go go home I just actatcgatcgggctagcgacgaugacaggtcaggactgggcacacgggcacgttttacttgctgctggattttcaaaccgtgtttgactatatacgggc
String identified:
' gg tg a c t tg a t ca't gt a t t t a t ct a t' t a t t a ca't atg t a t' t g t a a a a t gt a a t ' ac t ' t a ga gt t a ' t gg a ' ga g g t actatcgatcgggctagcgacgagacaggtcaggactgggcacacgggcacgttttacttgctgctggattttcaaaccgtgtttgactatatacgggc
Closest match: Eremobia ochroleuca genome assembly, chromosome: 21
Common name: Dusky sallow
275 notes
·
View notes
You know what be cute cuddling with horangi with a deep voice more rumbly just waking up and he give the best hugs.
Sure he might let you go of you give a few kisses and cute bumping of the nose. He needs you to giggle first and he lets you go.
And okay you being stubborn and don't want to sleep okay carry you bridal style. Or maybe carry like those mama cats carry they kitten cause you're being to wiggley
The thought of someone being carried by the neck like a kitten is so funny to me ngl, that's a König thing to do for sure. But this is so sweet aww
Alright, ya got me. Have a little good-morning fluff drabble. On the house
-
A sudden shiver pulls your body from sleep, bleary eyes taking in the deep blue-grey of the room, soft and fuzzy. Just dark enough that all of the sharp edges and corners blur, making the entire room feel wispy and ethereal. Comfy.
A cool breeze tickles over your exposed shoulders, sending another shudder reverberating through your ribcage.
Ah, that'll do it.
You had never bothered to shut your window last night. It had been...a bit too hot for that.
You smile at the thought, slowly sliding a leg out from under the sheets into the frigid air.
A warm arm tightens around your torso.
How does he always know?
You let yourself fall again, pulled back against a pillowy chest. You wiggle, shifting your hips, and another arm slides around your waist, holding you still. The delicate outline of a nose and lips press into your neck, soft breaths tickling over the sensitive skin.
"Horangi."
He only grunts, gravelly and deep, shoving his face even further into you.
"I need to close the window."
"I'll keep you warm."
You giggle at the slurred voice, heavy and resonant. It always is when he first wakes. With a sigh you shift again, curling your fingers around one of his arms. Tracing the lines of ink you know by heart.
He shivers.
And with you so tight against him, it sets you shivering too.
"Will you let me shut the window now?"
A sound, gritty and rough, rumbles his throat. Halfway between a groan and a sigh. His head tilts, nose and lips skating over your skin.
His tongue darts out just as fingers slide up your side, and you squeal, writhing against him.
A laugh shakes his body, rumbling thunder crackling and rolling, his chest heaving against you before he lets you go.
As you roll, a hand catches the back of your head, fingers curling into your hair, guiding you back, and his lips are on you, warm and wet and too soft. His fingers are tight in your hair, but the knuckles of the other hand stroke your cheek, gentle and smooth.
You sigh, head falling back into his hand, feeling his smile against yours.
And then he's pulling away, tucking the blanket over his whole body as he flops belly first into the mattress. "Better close the window, then. And get right back here."
You grin at that, skipping across the room to slide the pane closed, pausing to watch the rivulets of water run down the cool glass. They merge into each other, streaking across the canvas, stray paintbrushes full of blues and greens and greys, shining first this color and then that as the low light catches them.
Hands wrap around your hips, tugging you back, and you squeak.
'Wha-hey!"
His hands rise, flinging you up and catching you, arms tight under your legs and shoulders. "You took too long."
"It was five seconds!" You throw your head back, laughing as he lays you on the bed. "I'm sure you can wait that-"
Your retort is cut off with an oof as he drops his entire weight onto you. "Too long."
You giggle, wiggling an arm free to brush his hair off his forehead. "Whatever you say, tiger."
He rumbles happily, burying his face into your chest. And within seconds, he's asleep again.
676 notes
·
View notes