#biochemic | Explore Tumblr Posts and Blogs

maidish · 2 years

Text

♡ ∿ 𓏧 BIOCHEMIC

a gender relating to / connected to biochemistry!

75 notes · View notes

pdpxhzvnm5 · 1 year

Text

Bbw backshots Pinay Squirter Pandayo Tsumupa Deepthroat - Pinay Blowjob Expert Hard Fuck Squirt Cum Swallow Man with vagina and penis porn clips chubby boy gay nude first time Meli cabalgando pija negra White girl Gabriella Paltrova big ass booty abuse by horny black BBC (Monster cock big cock) Follow me on instagram for more Leno metendo no cu duma vadia e ela gozando ela adora pau no cu Free young boy emo gay porn doctor fetish Fucking Student Boy Aaron Hot lesbians Reena Sky and Akarra Summers Bratty Sis Slutty Sisters Fight Over Step Dads Cock Sex movies small gay and boys video download The camera man went out

0 notes

ruthlesslistener · 11 months

Text

really feelin' that characteristic finals crunch time experience rn

#i shoulda just gone to college in the middle east they know how to teach shit better than here lol #though my biochem professor is actually a really good teacher (hes chinese)#this is more about like. stats n shit #meme #stem major #academic meme

3K notes · View notes

attleboy · 2 months

Text

no clue when i'm gonna get actual art to you guys next, but you guys seemed okay w my shitposty stuff so silly aggie doodles be upon thee

#have a biochem exam coming up which has been consuming my mind so i haven't sat down to seriously make art in. a while. sorry 😔#the amazing digital circus #tadc #pomni #ragatha #jax #buttonblossom #just a lil bit #my art

902 notes · View notes

a-really-bad-decision · 1 year

Text

So is caleb a fulltime wizard buster now, or is he still teaching at the soltrice academy? Cause if he is, the speculation among his students has got to be fucking insane. Like imagine if every single time your nerdy, soft spoken, beanpole of a calc professor went on a two month leave of absence, another high profile war criminal gets thrown in jail. I would be losing my mind.

#and half the time the war criminal in question is your fucking biochem professor #critical role #critical role spoilers #cr campaign 3 #caleb widogast

4K notes · View notes

fallenstarzz · 4 months

Text

Who do you guys think was Kateaaron's real biggest hater: Andrew or the Vixens groupchat

#there is NO WAY they approved of him for like. at LEAST the first six months #like I dont know what I would do if my friend (who is a solid 10) said she was dating someone. and when I ask who #she says oh Aaron Minyard. you know the rude cold unnaproachable guy in my biochem class. the one who has no friends.#and also I can't be seen with him in public or his attempted murderer brother is going to beat me up #I could not see a friend going through that in silence. AND HE'S NOT EVEN TALL. KATELYN WHATS THE EXCUSE HERE #katelyn mackenzie #aaron minyard #all for the game #aftg #kateaaron

480 notes · View notes

buzzfeedunsolvable · 9 days

Text

No hate to Steven or anything and a lot of the flack he's gotten in the yt comments is unwarranted, but one thing I think is interesting is how on Watcher he was painted as a business-guru type and yet he was like... a chemical engineering major. Like so was I for most of college and you know what we never learned? How to run a business

#I say 'most' bc I switched out of chemical engineering in my fourth year (switched to biochem)#but still #I think maybe a lot of non-STEM people hear engineering and think engineering = smart #and therefore qualified to run a business #when being a successful STEM major or engineer specifically has nothing to do with intelligence #I've encountered many STEM majors at 'good' schools who are dumb as bricks #a girl I roomed with got flying colors in organic chemistry and yet thought she could get high off of molly through the walls #tracking tag #rambling #watcher

226 notes · View notes

pinkblink · 1 year

Text

I just thought everyone would like this. The “default” human in my biochem class was a female body. It’s something so small but this Kinda thing matters. It’s so common that a male body is shown as the default when studying biology and anatomy, so it’s refreshing to recognize the inherent bias.

#feminism #female represention #biology #women in stem #biochem #biochemistry #anatomy #stem #stem major #womens rights #bio #progress #science #hopefem #hope tag

936 notes · View notes

hellsitegenetics · 3 months

Note

1 think Biology is very cool.... I might persue something biochem related! I also really liked the genetics units in my classes, so I think this is a really cool gimmick blog. I'm gonna type in random stuff from here on out, are you able to find a match?

Random phone recommendation gibberish:

I'm going through a bunch of different things and I just can't get any it just seems to have been deleted from my computer and it's just been a lot of stuff and I can't find anything to do and it's not working I so I just need a password and password to get my password and then I'II be back to work on my phone so I I'm not really gonna get to work anymore I'm not even going anywhere I I'm gonna go go home I just actatcgatcgggctagcgacgaugacaggtcaggactgggcacacgggcacgttttacttgctgctggattttcaaaccgtgtttgactatatacgggc

String identified: ' gg tg a c t tg a t ca't gt a t t t a t ct a t' t a t t a ca't atg t a t' t g t a a a a t gt a a t ' ac t ' t a ga gt t a ' t gg a ' ga g g t actatcgatcgggctagcgacgagacaggtcaggactgggcacacgggcacgttttacttgctgctggattttcaaaccgtgtttgactatatacgggc

Closest match: Eremobia ochroleuca genome assembly, chromosome: 21 Common name: Dusky sallow

#tumblr genetics #genetics #asks #sent to me #requests #moths #dusky sallow #good luck with biochem brother.#plantify

275 notes · View notes

cafeluv13 · 10 months

Text

21.06.23

giving it all for the last month of the semester!

#the rest of my biochem and histology exams fall on the same day so i'm preparing in advance #good luck to everyone else on their upcoming exams :)#study blog #studyblr #med student #med studyblr #studyinspo #study aesthetic #studyspiration #aesthetic notes #note taking #studygram #study notes #studywithme #student life #study desk #original post

516 notes · View notes

sandinthemachine · 1 year

Note

You know what be cute cuddling with horangi with a deep voice more rumbly just waking up and he give the best hugs.

Sure he might let you go of you give a few kisses and cute bumping of the nose. He needs you to giggle first and he lets you go.

And okay you being stubborn and don't want to sleep okay carry you bridal style. Or maybe carry like those mama cats carry they kitten cause you're being to wiggley

The thought of someone being carried by the neck like a kitten is so funny to me ngl, that's a König thing to do for sure. But this is so sweet aww

Alright, ya got me. Have a little good-morning fluff drabble. On the house

-

A sudden shiver pulls your body from sleep, bleary eyes taking in the deep blue-grey of the room, soft and fuzzy. Just dark enough that all of the sharp edges and corners blur, making the entire room feel wispy and ethereal. Comfy.

A cool breeze tickles over your exposed shoulders, sending another shudder reverberating through your ribcage.

Ah, that'll do it.

You had never bothered to shut your window last night. It had been...a bit too hot for that.

You smile at the thought, slowly sliding a leg out from under the sheets into the frigid air.

A warm arm tightens around your torso.

How does he always know?

You let yourself fall again, pulled back against a pillowy chest. You wiggle, shifting your hips, and another arm slides around your waist, holding you still. The delicate outline of a nose and lips press into your neck, soft breaths tickling over the sensitive skin.

"Horangi."

He only grunts, gravelly and deep, shoving his face even further into you.

"I need to close the window."

"I'll keep you warm."

You giggle at the slurred voice, heavy and resonant. It always is when he first wakes. With a sigh you shift again, curling your fingers around one of his arms. Tracing the lines of ink you know by heart.

He shivers.

And with you so tight against him, it sets you shivering too.

"Will you let me shut the window now?"

A sound, gritty and rough, rumbles his throat. Halfway between a groan and a sigh. His head tilts, nose and lips skating over your skin.

His tongue darts out just as fingers slide up your side, and you squeal, writhing against him.

A laugh shakes his body, rumbling thunder crackling and rolling, his chest heaving against you before he lets you go.

As you roll, a hand catches the back of your head, fingers curling into your hair, guiding you back, and his lips are on you, warm and wet and too soft. His fingers are tight in your hair, but the knuckles of the other hand stroke your cheek, gentle and smooth.

You sigh, head falling back into his hand, feeling his smile against yours.

And then he's pulling away, tucking the blanket over his whole body as he flops belly first into the mattress. "Better close the window, then. And get right back here."

You grin at that, skipping across the room to slide the pane closed, pausing to watch the rivulets of water run down the cool glass. They merge into each other, streaking across the canvas, stray paintbrushes full of blues and greens and greys, shining first this color and then that as the low light catches them.

Hands wrap around your hips, tugging you back, and you squeak.

'Wha-hey!"

His hands rise, flinging you up and catching you, arms tight under your legs and shoulders. "You took too long."

"It was five seconds!" You throw your head back, laughing as he lays you on the bed. "I'm sure you can wait that-"

Your retort is cut off with an oof as he drops his entire weight onto you. "Too long."

You giggle, wiggling an arm free to brush his hair off his forehead. "Whatever you say, tiger."

He rumbles happily, burying his face into your chest. And within seconds, he's asleep again.

#wrote this in a biochem lecture #thinking about a very different kind of biochem #whoops #horangi #horangi x reader #still not really sure about his characterization tbh #so I'll just be learning as I go #also horangi has a cool tattoo sleeve because tattoos are hot #and he speaks in grumbles and unintelligible sounds in the morning #anon replies

676 notes · View notes

ryan-sometimes · 3 months

Text

Might seem like a joke but this is genuinely my calendar for this Thursday

#when you’re a biochem student by day and a goth mommy by night

140 notes · View notes

nepenthean-sleep · 2 years

Text

red blood cells are literally like "got rid of 😤💯 all my organelles 💪🤼😤 so i could store more 💯🏆 HEMOGLOBIN 😤🥇 #grindset #livefastdieyoung"

#idk why this shocked me LMAO i guess i thought theyd be more complex #anyway #sorry for biochem posting it will happen again #science #medicine #biology #neph.txt

1K notes · View notes

kreideprinz-studies · 3 months

Text

errrmmm...... biochem !!!!!!!!

#studyspo #study motivation #study blog #study #notes #mine #studying #studyblr #college studyblr #uni studyblr #uni studyspo #chemistry #biochem #uni blogging #go seahawks !!!!!!!

95 notes · View notes

stuckinapril · 2 months

Text

Going out tonight for the first time in a month. I’m sitting in a leather skirt and a sequined club long sleeve and Naked Wolfe boots. My tits look great. Curls are amazing. The faintest hint of a shimmer on my eyelids. And yet here I am doing Anki cards while we wait for the Uber

#My levels of neurotic are reaching worrisome heights #I’m trying not to feel guilty that I’m even going out rn even tho I haven’t had a night out in so long #I’ve even surpassed my 300+ card limit for the day and yet here I am. Crunching more biochem flash cards.#I love studying but something has to give I cannot relax I’m such a textbook pre med rn #I’m getting smashed tonight that’s final

66 notes · View notes

only-lonely-stars · 1 year

Text

Because I'm curious:

Please rb for greater sample size!

#tumblr polls #stem #wistem #chemistry #biology #physics #biomed #biochem #engineering #math #mathematics #science #i am very curious because i tutor and i get a lot of students who care but didnt get good instruction #and i also get students who just want to pass the class and move on with life #so do you enjoy STEM? do you like science at all?

798 notes · View notes