#Post: Intro
Text
"Listen to me Olive Oil! Before we get into this, you need to answer three important questions…"
How many walkers have you killed? How many people have you killed? Why?
Hello there! Welcome to fyeahthewalkingdeadocs! This is a place to survive, appreciate, and promote all the incredible original characters out there in The Walking Dead universe!
I will track #fyeahthewalkingdeadocs, so please use this tag #fyeahthewalkingdeadocs if you would like any edits, writings, updates, or anything to do with your original characters you would like to be featured on this blog!
Masterlists:
FAQ
Current Event
Event Rules
Past Events
Promoted Ocs and Fanfictions
#fyeahthewalkingdeadocs#ocapp#Post: Intro#allaboutocs#ocappreciation#ochub#occentral#the walking dead#the walking dead fanfiction#twd#the walking dead oc#twd oc#the walking dead ocs#twd ocs#the walking dead original character#ocsnetwork#toalltheocsivelovedbefore#admin*
15 notes
·
View notes
Text
Welcome to tumblr's own AITA!
The askbox is currently: OPEN
Please submit your own stories to be judged by the court of tumblr! Each story will come with a poll, judgements are as follows:
YTA=You're the asshole
NTA=Not the asshole (the other party is)
JAH=Justified asshole (you’re an asshole, but like, I get it)
NAH=No assholes here (everyone is some level of justified)
ESH=Everyone sucks here (you're all assholes)
INFO=Not enough information to judge (answer questions via reblog or reply, NOT my askbox please!)
Ready to submit yours? Read the FAQ first! (If it doesn't open for you on mobile, try opening it in your mobile browser instead of the app)
20K notes
·
View notes
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
#hellsitegenetics#faq#intro post#flowers#plants#requests#birds of paradise#asks#remember to keep checking back!
1K notes
·
View notes
Text
his joyful little twirl :^)
#new intro is a bit cutesy but i found it very charming :^)#long post#dungeon meshi#dungeon meshi spoilers#i guess? idk some ppl wanna go in blind
738 notes
·
View notes
Text
Hi, New People?
For some unfathomable reason, Tumblr has decided to suggest my blog to brand-new accounts to follow, so I've had a crazy influx of followers who, of the ones that are genuine accounts, probably have no idea what they've signed up for. (sorry.)
Oh, and I also have some new bittern-loving followers who have a slightly better idea but might not know the whole story!
So, here's your chance to escape, if you so choose.
Anyway, I'm Bob! I've been here since like 2012. I mostly make comics, but I also do some prose writing, game dev, and general shitposting. Should you choose to continue following me, you will be subjected to such content as
Canada geese.
Like... a LOT of Canada geese.
Also ferrets, the love of my life. And other art and general musings about my favorite animals, including but not limited to bitterns, grebes, pheasants, parrots, crayfish, eels, every single other type of mustelid, alpacas, etc.
But, because I can't be bothered to make myself a consistent "brand," I also make
Very Gay Comics.
I can't emphasize this enough, because I kinda suspect all those plumbing company blogs didn't know this before following me. I make very gay comics.
I'm working on a new webcomic called Into the Smoke that's gonna launch soon. It's about a gay medium who binds himself to a killer ghost, and I think my new follower with the car financing blog is gonna love it.
Lots more on that soon.
Anyway, I don't want to make a super long post. I just want to make sure y'all understand that if you follow me, you will get
Canada geese
and
Very Gay Comics.
Cool? Cool.
#huh maybe i have a brand after all#artists on tumblr#intro post#I thought they were ALL spambots till I made a new test account and was prompted to follow myself before I could even set a user pic#so I’m sorry if I blocked any actual accounts before that#but not sorry to the ones that clearly were spambots
800 notes
·
View notes
Text
idk whos this horse killer guy but hes kinda hot
#joel smallishbeans#hermitcraft joel#smallishbeans#joels intros are something#not gonna lie the detective is quite hot as well#i dont get why people say joel is obsessed with someone but himself#i broke my right arm recently so there wasnt many posts but now im good and back#smallishbeans fanart
876 notes
·
View notes
Text
She’s just like me fr
899 notes
·
View notes
Text
while I was looking for gabriels in the intro, I noticed this redheaded person w dark clothing and lighthaired person w light clothing that appear to kiss in the theatre:
i'm making this about the 1941 kiss theory
---
edit oct 7: a few kind people have mentioned that they remember a post from the official good omens account (possibly on twitter) that said the two people kissing are War & Pollution, and the shadow beside them is Famine. (If you have the link please send it this way! I have done a fair bit of searching but with no luck and it's haunting me bc it must be real but i can't find it)
@0owhatsamsays also pointed out that in the X-Ray bonus video "Title Sequence Easter Eggs" Peter Anderson says there are specific characters from season 1 in the highlighted boxes, and as you can see, the kissing booth (top level, far right) is one with a little trail of stars coming off of it.
#oct 7: on the other hand *puts tinfoil hat back on* A&C were both in season 1 and maybe the W&P post is a mandela effect thing#if anyone has clearer zoomed in pics or has more info to add please enlighten me i missed all the intro analysis on here before s2 came out#good omens intro#1941 go#good omens#a nightingale sang in berkeley square#if i decide this is them then does this mean they kissed in every episode
3K notes
·
View notes
Text
fyeahthewalkingdeadocs Events and Their Rules
“There are rules for a reason. Nothing matters if you’re dead.”
[What are event celebrations?]
Answer: Events are just fun little prompts and ideas that you can do with your The Walking Dead ocs within a certain time frame. It should be noted that events are not mandatory! They are made purely for fun!
Rules for all the events are here below.
DO NOT copy others' edits, if you feel someone has stolen your edits, please contact us with proof and reasoning of your belief.
If one of your posts for the event includes a crossover with another creator's oc, PLEASE make sure that the creator is okay with crossovers and has your permission.
If you want your post to be reblogged onto this blog, it must contain the hashtag pertaining to the event. Example: The Ones Who Live Celebration Event hashtag is #towl 2024
When you send an ask, all we ask is to please be kind and don't try to start unnecessary drama.
For the events, your creations are all up to your perception of the prompt or prompts provided!
Most importantly...HAVE FUN!
1 note
·
View note
Text
Welcome to Ordinor Ultor!
You’ve ruled the Duchy of Akize, the southwesternmost duchy in the Kingdom of Ribaur, for 15 years, since the year 1107 ME.
15 years ago, your Liege had your parents executed for a plot they had no part in.
Despite becoming a ruler while only a teenager, your lands have done well - no thanks to your Liege’s proclamations. Despite the annoying interference, you would have been content to just administer your lands and pay your taxes.
But one day, your Liege goes too far, and wrongs one of your siblings - personally.
You’ve had enough. You and your siblings will chafe no longer under the yoke of that tyrant. You will be free from oppression - whatever it takes.
Choose your character's name, the name of their noble house, and whether they are a Duke (male), Duchess (female), or Dux (enby).
Choose which foreign land your mother hailed from - such as the northern court of Ostroway or the island nation of Sayland.
Pick the type of education you received - were you taught how to use the shadows of Intrigue? How to construct Martial strategies? Or something else?
Interact with your friends and family, possibly including your foreign cousins.
Choose how to deal with your Liege - will they be put on Trial, will you lead an armed Rebellion, or will you take to the shadows to have them Assassinated?
Pick from four gender-selectable ROs - two fellow vassals and two foreign nobles.
Deal with various interest groups - such as the Peasants you rule over, your fellow Vassals, the religious head known as the Hierophant, and more.
Ordinor Ultor takes palce in a low(ish...) fantasy world, with the protagonist's home country of Ribaur being inspired by medieval France.
I'm relatively new to coding, so I can't promise a concrete update schedule yet (also, if anyone has any advice and/or resources for me to use, I'd be very grateful!). That being said...
DEMO BY APRIL 29TH MAY 3 2024
I hope everyone enjoys!
520 notes
·
View notes
Text
Ongsa, do you want me and Tinh to help you pursue Sun?
EARN PREEYAPHAT as CHAROEN, MILK PANSA as ONGSA NANNAPHAT and VIEW BENYAPA as AYLIN feat. FORD ARUN as TINH and JUNE WANWIMOL as LUNA
episode 4 of 23 POINT 5
#23 point 5#23.5#23.5 degrees#23.5 the series#23.5 องศาที่โลกเอียง#earn preeyaphat#milk pansa#view benyapa#ford arun#june wanwimol#ongsasun#aylinluna#gmmtv series#gmmtv gl#:: mygifs!#long post#disclaimer bc i feel like it's needed every time i label any character bisexual#charoen is bisexual bc the director has said on tw before that both her and alpha are bi#hence their colors during the intro#also charoen best girl#she's so cute#and so supportive of her friend's love life
531 notes
·
View notes
Text
You're dead.
Or, at least, you should be.
You remember what it felt when the bullet pierced your chest, the blood rushing out too fast, too much to stop.
The man in red smirking above you.
And yet, here you are. Alive. Safe in bed.
One week before the day of your death.
Redo; Rewind is a story about time. Of an ordinary person working an ordinary office job. Sure, you might work for an info broker and, sure, you sometimes (often) commit acts of corporate espionage for said job, but that's just business.
This is something far beyond that ordinary life.
Time travel. It seems you of all people are capable of it. To manipulate time and bend it to your will. It may not be something you asked for, but you need it now more than ever.
Someone wants you dead. And they've already succeeded once. You can't allow it to happen again.
(Please note that Redo; Rewind is currently rated 18+ for depictions of violence/death, references to drug and alcohol use, explicit language, and heavy themes.)
Play as a customizable MC! Choose your MC’s appearance, gender, skills, and more!
Romance, befriend, or antagonize any of the 3 romance options.
Learn how to master your time control ability and use it to your advantage.
Avoid past mistakes and inadvertently come up with new, much worse ones!
Try not to die. Again. And again. And again...
Victor/Victoria Zhang [M/F] - Your boss and owner of VZSystems, the front for their true work as an info broker. Clever, professional, and cold—a classic business major. That's how they appear, anyway. Having worked for them for sometime now, you know that, despite their intimidating appearance, they hide a much softer side underneath. Will you maintain the status quo as employer and employee, or will you cross the boundary set by your positions?
August Astaire [M] - Hitman, assassin, whatever you want to call him, the man's a killer. That much is clear after he put a bullet through your chest. But is that all there is to him? As arrogant and cruel as he seems, you can't help but wonder if there isn't more to him than meets the eye. Maybe if you play your cards right you could even turn an enemy into an ally. But, even if he plays for your team, how much can you really trust him?
Amara Ingram [F] - Your coworker of about two months now. You don't know her well yet, but she seems genuinely kind, with a good sense of humor and a sharp mind. Since being hired, she's quickly earned her place, proving to be an invaluable asset with her skill in engineering and programing. Undoubtedly, someone you're glad is on your side, but could your feelings for her extend beyond the professional?
[Demo] - Available Here! (Last update: March 23rd 2024)
[ROs] - Additional Details Here!
#interactive fiction#interactive novel#twine if#twine wip#cyoa#if wip#intro post#redo; rewind if#redo rewind if
668 notes
·
View notes
Text
Such Happy Campers is an interactive horror/romance novel made in Choicescript.
DEMO / COG FORUM POST
status: demo consists of three chapters + prologue, sitting at 64.385 words [excl. commands]
You are an employee of the Cloverleaf program. Your job is to organize and oversee their seasonal vacation for kids from low-income backgrounds and troubled homes. This summer, said vacation will be hosted at the rustic Camp Solace, a cabin campsite situated right next to the picturesque Lake Solace and flanked by acres of woodland.
Camp Solace is idyllic, calm and far removed from the bustle of civilization.
V̵̲̂e̶̝͆ŕ̸͍y̷͎̏ ̷͚̎f̵͈̀ā̸̦r̵̀͜ ̸͓͘r̴̜̂e̴͉̕m̵��̺o̷̢̓v̶̒͜è̴̘d̴̳̐ ̴̀͜i̵̡͊ñ̷̘d̸̼̀e̷̪̽ȇ̵̯d̴̜͒.̷̰̚
It'd take you quite a while to reach the nearest town in case of an emergency…
Ý̷̭ö̸͎́u̷̘͗'̴̘͘d̸̛̰ ̶̢̐ḇ̸̌ẻ̸̦t̴̝̅t̷͚̒e̷͓͑r̸͔̿ ̷̱̆m̸̜̔a̸̳̍k̵̰̍ě̸̖ ̸̦̚s̷̛̺ṵ̴̔r̵̘̅e̸̝̽ ̸͈̑n̴̡̛o̶̬͑t̶̺̊h̸͖̋i̵͎̽ṅ̵̜g̸̗̽ ̴̹̿ḧ̵̘́ā̷̦p̸̖̎p̵̻̑e̴̗͌n̵̡̒s̶̜̈.̶̥͂
But you're not alone in this! Working alongside you are Basil Laurier, the free-spirited scion of the wealthiest local family, Anita Merrick, the smart but skittish university student intern, and the Malak siblings, both skilled and experienced teachers.
Now go take care of those happy little campers.
Customize your MC’s name, appearance, outfit and apartment!
Be a good camp counselor and protect the kids in your care!
Romance a charismatic heir, a chronically sleep-deprived psychology student, a temperamental musician or a reserved martial arts instructor!
Get to know your team and form lasting friendships!
Uncover the lakes long-forgotten secrets and save Camp Solace from the horrors that are slowly closing in on you.
TW: mentions of bullying, troubled childhoods, mental illness. Non-graphic.
#choicescript#choice script#hosted games#interactive fiction#if: intro#if: wip#interactive story#interact if#updated intro post#if: such happy campers#horror comedy#horror romance#romanceable characters#writeblr#original fiction#writers on tumblr#amwriting
619 notes
·
View notes
Text
Project DARK is an 18+ character-driven SPY IF inspired by a rather eventful weekend binging on Mission Impossible movies. It can be described as Suicide Squad meets Mission Impossible. MC, a retired villain, will be a new operative in a team to bring down their old best friend.
You were a jewel thief and hired mercenary, outsourcing your skills at thievery and espionage for all types of...shady characters. Yeah, you were aiding in the possible destruction of the world in exchange for money, but details, right?
You were the best in the business alongside your partner, Spider. You're not supposed to get close to people in this business, but Spider somehow weaseled into your life and became your best friend.
But then they died, killed by operatives of Mission Shadow, the one organization that has been hunting you down since day one. You decided to retire, changing your name and identity in an attempt to make an honest and private life of what you have left.
Until Project DARK finds you.
Project DARK: an experiment to put the most together the most skilled shadow villains to train and defeat the biggest threat they've faced.
Your best friend, whom you thought was dead.
They need you and your skills. You know Spider best. No longer are you the villain, but a Project DARK operative joining as the newest recruit to the ranks.
Good luck.
Customize your operative from appearance, personality, gender identity.
Tailor your past: were you a merciful villain, or a merciless one? Did you make enemies or try to make friends? Liked for being kind and easy to work with or hated for being the literal worst?
Romance members of your team or your target, with some having special relationships.
Choose what kind of operative you'll be and shape the dynamic of the team.
Try not to fall into old habits and get sucked into the dark world of crime. You left that life for a reason.
THE TARGET | Spider [m or f]: your old best friend and the new target. They've been busy since their 'death' and have grown a network of connections that can dismantle the world as you know it. They're apparently planning something big. Big enough that the organizations of the world created Project DARK to take them down.
Special romance: can have had previous thing with them that was never confronted or simply have been best friends.
THE LEADER | Elias/Elena Steel: one of the best operatives, personally recommended by MI6. The only non-villain on the team, E is also appointed leader and doesn't like you much, considering the fact that a mission of yours ended with their closest partner dead. While you may have not pulled the trigger, E blames you all the same.
Strict and as cold as steel, it makes sense why E is the one with the team on their shoulders.
Special romance: enemies to lovers. E hates your guts.
THE SECOND IN COMMAND | Nick/Nina Sharma: second-in-command and a retired illegal weapons dealer, N is, surprisingly, E's closest friend. N has long given up that life, but before their new work as a operative, you knew them as a distant associate. You two have crossed paths on multiple occasions, most of them happening with them almost killing you or vice versa. N can't help but be nice, but you can tell they're not really a fan of you.
Special romance: may have had a lapse in judgement and have had a one night stand...or multiple.
THE BRAINS | Zane/Zena Omari: One of the most skilled hackers and a familiar face on the FBIs most wanted list, Z is on the team in order to be able to go back home without getting arrested. Oddly enough, they're not what the media says they are. Friendly, warm, comedic. Z seems to be having too much of a good time, even with the circumstances surrounding their presence.
THE WEAPONS EXPERT | Luca/Lucia Cruz: L doesn't know you much, and doesn't care to. Hyper-focused on the mission, L's disinterest in you is a breath of fresh air. You don't know what they did and how they got here, but you do know they were facing a life sentence. Still, things aren't always what they seem.
Maybe it won't stay that way.
#cog#cog wip#choice of games#interactive fiction#interactive fiction wip#interactive novel#interact-if#interactive game#if wip#dashingdon#dashing don#hosted games#intro post#wip
1K notes
·
View notes
Text
WAIT
ENHANCE
OH
OH NO.
#Pokemon#Pokemon SV#Pokemon Scarlet and Violet#Pokemon SV spoilers#I TRIED POSTING THIS HOURS AGO BUT I GUESS IT WAS SWALLOWED BY THE TUMBLR VOID#Video#Shima speaks#Anyway 😬😬😬#I CAUGHT THEM T POSING#The screen faded to black and I SAW it in the SPLIT SECOND#But bro that’s so BAD.#NINTENDO.#You are a multi million dollar company#I should NOT be catching your characters T posing in your INTRO CUTSCENE#THAT’S SO BAD!!!!#I’ve seen lots of other glitches and I’m already like. Oh no. Oh nooo.#Listen I’m loving the game so far it’s VERY fun but the graphics 😭 And the clipping and the janky animations and THIS 😭😭😭#This is NOT the polish I’d expect from a main series Pokemon game#SWSH looked better than this. And people tore SWSH to fucking SHREDS over the quality
8K notes
·
View notes
Text
👥DEMO 👥 PLAYLIST 👥 PINTEREST 👥 COG FORUM
You keep having the same dreams over and over. It happened, years ago, before you left. You thought you had left Eastend behind for good.
It seems you can never truly escape your past. The Priest had warned you.
There's a girl you've never seen in your dreams. Yet, she seems so familiar - as a forgotten teddy bear you left in the attic of your home. She feels right, she looks wrong, she's wrong. Because she's not you, she says. And the two of you stand on the road...a bright light blinds you but the smell of iron reaches you. You do not need your eyes to deduce the ending of the nightmares.
Metaphorical dreams have never been your forte...except this is real. On the day you arrive, she's still alive. And smiling...laughing...walking with her friends. She looks like a normal girl of your age.
You black out - from the shock you think. The familiar iron smell being all too close, it makes you nauseous. At least, the earthen scent that lingers on your clothes counters it a little.
Why are you in the woods again?
....Why is there blood on your hands?
Welcome home, whispers the wind.
• Customize the vessel whether be it in looks, personality or identity.
• You are free to romance four of the cast. Maybe more, there are many eyes on you.
• Your choices will shape you as they shape the town. They will have consequences on the people around you and those who aren't anymore. Be careful you never know what effect the ripples may have.
• Explore your past to shape your future.
• Fight your nightmares should you be so inclined - or welcome them, there might be surprises in the deep dark part of your mind?
• Choose whether or not you'll doom your childhood town - although, that might not be left to you. Leaving is an option too, after all, you've already left once.
• Survive - or don't. You didn't think you were the only one who could save them, did you?
Eastend is rated 18+ for sexual themes, substance use, explicit language, explicit violence, death and more.
Beverly Arevalo [F,23], your childhood friend. At least, one of you perceived it that way. She has always been difficult to read and understand, you were one of the few who could years back. Maybe you can rekindle your friendship - maybe it will grow into more. The only thing you know for certain is that there are many unknowns surrounding Beverly.
Aina Valen [F,26] is that stereotypical preppy girl, at least what you know of her. You were never quite close when you still lived in town, but things have changed and so have both of you. Surprisingly enough, she works at the library now, having taken over her brother. You're not aware of what happened between them, only that she seems overly bored whenever you pass by the vitrine. At least she insists on telling you you are the 'spice' of her days, whatever that may mean.
Benjamin Li [M,26] his preferred nickname, Benji has always shown kindness to you and this didn't change with your unexpected return. He somehow always has a nice word for you or others in his vicinity, it's refreshing quite frankly. There are always critters following him around but they say animals are good judges of characters so that's a good sign, right?
Hezekiah Lyncroft [M, 24] was always a pain in your ass, even younger. Always arguing with you over anything and nothing, he was the reason for many headaches. Back then, there were rumours about his home life, ones you remember well. At least, he seems to be in a better place nowadays, even though he's still a pain to be around. But not all pains are bad.
+ familiar faces and strangers you've yet to meet
Demo stands currently at 5.8k words. It is meant as short introduction to the setting and story. Hope you enjoy despite the length :)
#interactive fiction#interactive story#interactive novel#interact if#if wip#if intro#intro post#choice of games#cog#choose your own adventure#eastend if
503 notes
·
View notes
Last Seen Blogs
sandyroseuniverse
Roses main page
mavikulakliklikiz21
Mavi Kulaklıklı Kız
talkingintothinair
Talking into thin air.
windsonde
Windsonde
sawwhatisaw
SawWhatISaw