#we give thanks for the bees!
Text
“This is the night
of which it is written:
The night shall be as bright as day,
dazzling is the night for me,
and full of gladness.
The sanctifying power of this night
dispels wickedness, washes faults away,
restores innocence to the fallen, and joy to mourners,
drives out hatred, fosters concord, and brings down the mighty.
On this, your night of grace, O holy Father,
accept this candle, a solemn offering,
the work of bees and of your servants’ hands,
an evening sacrifice of praise,
this gift from your most holy Church.
But now we know the praises of this pillar,
which glowing fire ignites for God's honor,
a fire into many flames divided,
yet never dimmed by sharing of its light,
for it is fed by melting wax,
drawn out by mother bees
to build a torch so precious.”
-Excerpt from the Easter Vigil Exultet
#one of my favorite prayers#this is the night#Exultet#Easter Vigil#Christ is Risen Alleluia Alleluia#we give thanks for the bees!
45 notes
·
View notes
Text
A Fine Chain
UPDATE: Chapter 14/?
Fandom: Jupiter Ascending
Rating: Teen And Up Audiences
Beta: @gallifreyburning
Relationships: Jupiter Jones/Caine Wise
Additional Tags: Alternate Universe, Light Dom/sub, Power Imbalance, Royalty, Slavery, Collars, Leashes, Other Additional Tags to Be Added, Don’t copy to another site, Dark
Summary: Caine Wise, disgraced ex-Skyjacker and convicted criminal, is suddenly inducted into the service of the enigmatic Queen Nea-Seraphi, mysterious new Recurrence and puzzle to the Entitled social circle. While figuring out the boundaries of his new station, worrying about his old commander, and nursing old wounds from his court martial, Caine finds himself slowly being drawn into the confidence of his royal employer. What could Her Majesty possibly want with a defective splice?
In which the queen is in peril, royal wardrobes are dismantled, and Caine experiences some tribulations.
The wonderful @zahnie has made a PLAYLIST for this fic!!!! Go check it out immediately!
#a fine chain#jupiter ascending#ja fic#jupiter ascending fic#caine wise#jupiter jones#y'all have NO IDEA how petty and disappointed I felt when I couldn't find a better name for the Bee Gun (TM)#like...they ALREADY used the best name so i had to come up with another name#but anything involving venom is just not specific enough to bees and feels more associated with snakes in fiction#and looking at all the weird anatomy charts was giving me very yonic vibes for some reason#however this is nowhere near the weirdest rabbit hole i have gone down for fic research#not even the weirdest rabbit hole where the end result was a single line or words#AND ALSO IT TOOK FOURTEEEEEEEN CHAPTERS for caine to even be able to verbalize the fact that he SHOULDN'T BE HAVING THESE THOUGHTS#i'm so proud of the Good Boy for hitting that milestone. I shall be Hurrying Him Along This Path don't you worry#part of the fun of pacing is that I realize it doesn't seem like a long time to ME bc i'm actually very far ahead of where i'm posting#but to the READERS it will feel like a while and to CAINE he doens't get to do time skips like we do#so the pacing isn't as wonky as I fear it is...i hope#everyone thank gallifreyburning bc TRULY...without her this would not exist
9 notes
·
View notes
Note
Alr hear me out, the service top lucifer with a very insecure reading. (Fem or GN) like he has to coax the reader to like open up (God damn I'm blushing thinking abt it-). Maybe even having to like talk them into even taking thier clothes off. Just a little idea stuck in my head.
Thank you very muchly.
Ooooooohh you’re giving me IDEAS (tbh I’d be the same boat)
~~~~
✨Opening Up✨
Lucifer x f!reader
Warnings: 18+, smut, nipple play, pet names, oral (m & f receiving), p in v, service top!Lucifer
It has become evident that I am unable to write anything concise 😅
I’M SORRY THIS TOOK SO LONG I MEANT TO POST THIS DAYS AGO 😭😭
Tag list: @trashbin-nie
@yellowsubiesdance
@j-jinxee
@stevensdickrider
@airwolf92
@mrssabinecallas
@myhornybrainonlyknowsthis
@bee-sinner
@thesoccerenthusiast
@katshyperfixations
@logybearsblog
@bigfatbimbo
You sat upright on Lucifer’s king sized bed, the King of Hell straddling your lap. You don't know how you even ended up in this position, not on this bed necessarily, but how you ended up as Lucifer's beloved. You believed in your heart that you did not deserve him, but time and time again Lucifer has showered you with praise and adoration like no one ever had before. He was perfect. And you were...you. It didn't make sense.
Regardless, that didn't stop him from holding your face tenderly in his hands while he kissed you with a fiery passion. You were self conscious about being so vocal around him during intimacy, but he made it his mission to elicit as many moans and whines from you as possible. Slowly, he reached down to the hem of your sleep shirt, grabbing a fistful of fabric. Your eyes popped open, your mind racing. You pulled away from his lips and went to grab his wrist that held your clothing.
"I-I'm sorry, love," he apologized, releasing your shirt immediately. You sighed and let go of the grip you had on his hand. "I didn't mean to scare you, I should have asked. Please forgive me."
"No, no," you breathed, "it's alright. I'm not upset, I just panicked. I'm sorry."
Lucifer pressed his lips to your forehead and planted a small kiss. "Please don't ever think you need to apologize to me for how you feel, sweetheart."
"O-Ok," you stuttered.
"Do you want to stop?," Lucifer asked. You could hear the genuine concern in his voice. Hard as it was to believe, he cared about you more than anything.
You shook your head. "No."
"You're sure?," Lucifer questioned further, "because if you're uncomfortable, we can-"
You cut him of mid-sentence with a quick peck to his lips. He smiled bashfully, a cute blush spreading across his face. "Believe me, Luci, I want this. I mean I really want this, but..." you found it difficult to articulate what you wanted to say.
"Well, if that's the case darling, what if I go first then?," Lucifer proposed. You cocked your head, unsure of what he was talking about. He reached up and began to unbutton his shirt, starting from the top and working his way down. Oh...OH.
Your face instantly feels hotter and your breathing becomes staggered. You tried to say something, but the words caught in your throat. Your mouth had never felt drier. He finally reached the last button of his shirt and you finally see some of his chest. You could almost feel your brain short circuiting.
"Do you wanna do the honors, my dear?," he asked playfully. You gulped as your hands reached towards his shoulders. Gingerly, you slid his sleeves down each arm, slowly revealing more and more skin to you. Once his shirt was completely removed, you couldn’t help but stare. His chest was so smooth and toned, almost like it had been sculpted. “Like what you see?” Lucifer questioned coyly, noticing your unwavering expression of awe.
"W-Well that's hardly fair," you whispered, finally finding your voice, "you're an actual angel. Of course you're going to be gorgeous, I-" you slapped your hand over your mouth once you realized what you had said. "Please pretend you didn't hear that!," you begged through your hand.
Lucifer's face was flushed pink, he could help but smile. He chuckled as he went to remove your hand from your face. "Is that what you really think about me, sweetheart? I'm truly flattered to hear that coming from someone as exquisite as you."
"You...You really think..." you started to say but couldn't finish. Tears began to well up in your eyes, you tried to rub them away before Lucifer could see but it was too late. Lucifer cupped your face and ran his thumbs under your eyes to clear away the tears that had fallen. Your breath hitched, you tried to take in deep heavy breaths so you wouldn't start sobbing.
“Hey, hey, hey, shhhhh,” he spoke with a soothing tone. He removed himself from your lap and sat down next to you, embracing you in his arms. “It’s okay, angel, it’s ok. I upset you and I’m sorry, I never want to be the reason you cry.” He rested his head on top of yours while you clung to his chest. The scent of him hit your nostrils, it was like breathing in a warm spring day. Purely intoxicating. It calmed you down, you started to breathe normally again. You felt safe in his arms, you could have stayed there for the rest of your life.
You wrapped your arms around his torso, your tears finally drying. “Thank you, Lucifer,” you murmured. He gave you a tight squeeze before you lifted yourself back up, sitting at his hip and leaving your head on his shoulder. “You weren’t the reason I was sad, you know? You never have been.”
Lucifer turned his head to you, “Really? Then why-?”
“Because I’m afraid,” you quickly responded. “I’m afraid that I’m not good enough for you. That I never will be. You’re the all mighty Lucifer, King of Hell. You have so much strength and power and respect. And I’m…I’m just me.” You sighed and pulled your legs up to your chest to rest your head on your knees. “I’m sorry, I shouldn’t have-”
“Darling?,” Lucifer spoke at last. He brought himself in front of you on all fours and placed his hand under your chin, forcing you to look at him in his scarlet eyes. “ “Just you” is perfect. You don’t need to be anything but yourself! I understand what you’re feeling, and it’s okay to express that. But please know that I love you just the way you are. You are my true strength.”
You chuckled softly, leaning into his hand that was now pressed against your cheek. You took his words to heart; he loved you. He loved you so much. You had to show him that you felt the same way. You drew in a few quick and deep breaths before reaching for the hem of your sleep shirt.
“Wait, wait, what are you-” Lucifer tried to say, but you were too fast. Your shirt disappeared from your body and was tossed across the room. Silence filled the space, the only thing you could hear was your heart threatening to burst through your chest.
It was at that moment you noticed you couldn’t see Lucifer’s face. His hands had flown up to block his view of you.
“Lucifer?” you called to him.
“Y-You didn’t have to do that, love,” he stuttered. “I never wanted you to feel that you had to-”
“Please look at me, Luci,” you pleaded. “I love you. And I trust you. Let me show you. Please.”
You saw Lucifer’s hands slowly fall away from his hands, his eyes still screwed shut. “Are you sure?” he asked softly.
You leaned in to plant a kiss on his soft lip. Lucifer’s eyes shot open in surprise, you pulled away before he had a chance to react. Blood rushed to your cheeks when you saw him staring at you. Your first instinct was to cover yourself and shy away, but you pushed those feelings deep down. You were going to be vulnerable, you needed to be brave. Not just for him, but for yourself. You gripped the bed sheets so hard that you felt your nails digging into your skin through the silk.
After what seemed like an eternity, Lucifer had snapped out of his trance. He started to crawl towards you on his hands and knees, only stopping when his lips were inches away from your own. You felt his hot breath on you, you were finding it more and more difficult to keep your composure.
“You…are breathtaking,” he cooed, crashing his lips into yours hungrily. His tongue begged for entrance to your mouth, and you happily allowed it. You felt yourself slowly drifting down onto your back as you and Lucifer desperately devoured each other. He pulled away from your lips, trying to catch his breath, but you noticed he wasn’t looking into your eyes. His attention had drifted a little further down. He swallowed hard.
“May I?,” Lucifer asked breathlessly. Your face felt extremely hot and you couldn’t find the power to speak, so instead you nodded your head vigorously. He gave you a cheeky grin before lowering his mouth down onto one of your nipples. The noise you made sounded more high pitched than you meant it, but God, did it feel amazing! His tongue worked one nipple as his hand played with the other. You loved the sensation of him sucking and licking at your sensitive skin, the tiny bites from his teeth driving you insane. He rolled your other nipple between his two fingers, the pinches he gave sent your brain into overdrive. You never knew how sensitive you were, but Lucifer was more than happy to service you.
All of a sudden you noticed a different sensation, you felt something press against your inner thigh, dangerously close to your clothed pussy. It took your brain a few seconds to realize what was happening.
“Uhh, Lucifer, a-are you…”, you mumbled. Lucifer looked up from your chest with a puzzled face. “I can feel umm, I-I can feel your uhh…”, you didn’t know why you couldn’t say it. Maybe you were too embarrassed, which seemed silly considering what position you found yourself in. You pointed down towards your pants where Lucifer was wedged.
“Oh…OH,” Lucifer exclaimed pushing himself from you and onto his knees. “Oh my gosh, I-I’m so sorry! I didn’t realize you could uhh, feel that…please forgive me!”
Seeing him so flustered somehow calmed some of the nerves you had before. It was cute, really. Demon overlord Lucifer getting embarrassed about unintentionally pushing his hard on against your thigh. You let out a small giggle.
"It's alright, Luci," you chuckled. "I'm flattered, really!"
Lucifer smiled, placing his hand behind him to rub the back of his neck. "I'm still sorry about that, love. I'm a little embarrassed."
“Well,” you breathed, “I guess it’s only fair that I embarrass myself too then, right?” Without warning, you grabbed the waistband of your pants and ripped them off along with your panties in one fell swoop. You laid naked in front of Lucifer, whose whole face had turned a shade of red you’ve never seen before.
“Ffffuck,” was all Lucifer could muster. You watched his Adam’s apple rise and fall, attempting to regain his thoughts. Looking at you, it was plain to see how soaked you were.
“Like what you see?,” you teased. Lucifer nodded his head eagerly, still at a loss for words. You lifted your hand and curled your finger, beckoning him to you. Obediently, Lucifer crawled on the bed towards you with no reservations. “You’re not the only one that’s worked up here. Now we’re even.”
“My love, please…” Lucifer whined, “please let me taste you.”
"Don't you...wanna get more comfortable first?," you asked him, knowing the problem in his pants had probably only gotten worse for him.
"Not until I've had my fill of you, sweetheart," he smiled before forcing his head between your legs. The moan you let out was guttural, almost feral, he lapped your folds like a starving man. He took long, drawn out licks up your slit before focusing on your clit. His lips kissed and sucked on your sensitive nub, sending waves of pleasure throughout you entire body. You couldn't pull away if you tried, he had wrapped his arms under your legs so you couldn't escape his assault on your cunt.
"Sh-shit, oh-oh my God Lucifer, FUCK," you moaned. You could feel a smile form on his face as this seemed to have made him pick up the pace. You screamed from his tongue darting in and out of you, feeling so close to snapping. Your thighs started to fold in on his head and you grabbed a fistful of his hair trying to regain some assemblance of control. “Fuckfuckfuck, mmmm…gonna c-cum, aaggghh, gonnacumgonnacum!” Lucifer’s tongue relentlessly circling your clit finally caused your body to spasm, your orgasm causing you to scream out in pleasure. Lucifer didn’t stop though, he let you ride out your orgasm and hungrily devoured your release. Once you finally came down from your high, Lucifer lifted his face from between your legs and flashed you a toothy grin, seemingly quite proud of his work.
“You alright, darling?,” he asked innocently, almost pretending like he wasn’t the cause of what you had just experienced.
“Y-yeah, I’m…I’m fine,” you breathed. “Just…Jesus, that was intense! Give me a little warning before you go all in on me like that again!”
Lucifer laughed. “I’m sorry, love, I couldn’t help myself.”
You rolled your eyes at him playfully. “Oh, I’m sure you couldn’t. Now, let’s get these off you, hmm?,” you said tugging at his pants.
Lucifer stood up from the bed quickly. He undid his belt and let his pants drop to the floor. From the outlines of his briefs, you were surprised that they could contain him at all. Before he could pull at the hem, you jumped off the bed to stop him.
“Allow me,” you offered, getting on your knees in front of him. You reached up and grabbed onto his briefs, snaking them down his legs. His cock sprang free of its cage and hung in front of your face, its tip already leaking. Without thinking, your wrapped your lips around the head of his cock. Lucifer let out a moan that you’ve never heard before, filled with absolute lust and need. You took one of your hands and grabbed the base of his shaft, slowly stroking up and down while your mouth continued to work on his head. You ran small licks against the slit, tasting and lapping all of the precum that was forming. You loved the taste of him.
“Love…f-fuck,” Lucifer panted, trying to fight through his moans, “if you don’t s-stop now, I-I’m gonna cum. I wanna…wanna feel you. P-Please…”
Reluctantly, you pulled your mouth away from his cock with a *pop*, pouting slightly. Lucifer leaned down to grab your torso and tossed you onto the bed like you were made of paper mache. That angelic strength of his always caught you off guard. Lucifer crept between your legs, planting a tender kiss on your lips.
“I promise,” he whispered against your lips, “next time you can finish what you started, but right now I need you. Need to feel you.” Lucifer brought his fingers to your needy cunt, feeling the slickness of your folds. Your breath caught in your throat at the sensation. He took his other hand and lined up the tip of his cock to your entrance. “Are you ready, my angel?,” he asked softly.
You grinned and nodded your head. With that, Lucifer closed the space between you once more with a fiery kiss as his cock entered you inch by inch. Your cries mixed with his as he finally entered you completely.
“You feel…amazing, darling, fuck…” Lucifer choked out. “Are you okay?”
“Yes,” you murmured, “I-I’m okay. You can move.”
“Anything for you,” he smiled. Lucifer slowly began to rock his hips into you, his cock filling you up completely with each thrust. You could feel every inch of him ruining your pussy, hitting just the right spot every time. It didn’t take long for his pace to become erratic and uneven. He buried his cock deep inside you, both of your moans filling the room.
“Lu-Lucifer, o-oh shit, Lucifer, I-I’m so close,” you pleaded. “Please don’t stop, p-please don’t.”
“Cum for me, darling. Wanna feel you cum.” Lucifer groaned. He bit down on your should as he continued to pound into you, biting and sucking your tender skin. You were shaking, he was going too fast, you were coming undone.
“Cuminme…FUCKCUMINME,” you screamed and wrapped your legs around him as your orgasm flooded over you. You felt your walls pulsating around his cock, it was too much for Lucifer to handle. You heard him cry out and felt him twitch inside you, filling you up with his hot cum.
Coming down from your highs, you both laid there for a moment trying to catch your breath. You played with Lucifer’s hair as he laid across your chest, completely worn out. A minute or two passed before Lucifer sat up and pulled himself out of you. He laid down next to you, staring at your flushed face.
“Are you alright?,” he asked. “Did I hurt you at all?”
“No, you didn’t hurt me,” you smiled. “That felt…really good. Thank you, for everything.”
Lucifer hummed and leaned up to press a gentle kiss to your lips. “No, thank you, love.”
You chuckled returning the kiss. “Would…you mind if I held you, Luci?”
Lucifer’s eyes widened, but he smiled wide. “Of course not, I’d love nothing more.”
Lucifer rolled on his side, giving you the chance to push your body against his back and wrap your arms around him. You both didn’t move until the morning.
~~~~
Hope you enjoyed my second attempt at NSFW content lmaooooo
AND YEAH I MADE HIM THE LITTLE SPOON, IT’S WHAT HE WOULD WANT
#hazbin hotel#hazbin hotel x reader#hazbin hotel smut#lucifer morningstar#lucifer smut#lucifer x reader#lucifer morningstar x reader#writing prompt#my writing#this was meant to be a cute short thing but i can never stop myself lmao#my signature is just posting goofy faces of Lucifer to remind everyone this is who we’re thirsting over
2K notes
·
View notes
Text
sv5 | that lavender haze
summary: [ florist!sebastian vettel x f!driver!reader — social media au ] your florist husband spoils you with his creations
faceclaim: phoebe tonkin
author’s note: seb the love of my life <3
[ masterlist / guidelines / lola's masterlist / series masterlist ]
liked by sebastianvettel, lewishamilton, mercedesamgf1 and 35,201,234 others
yourusername catching the waves 🏄🏻♀️
view comments
sebastianvettel Ich liebe dich 🥰
↪ yourusername can't wait to be home with you again 💗
ausgp can we keep you down under please? 🦘
↪ f1mia back off 🦅🇺🇸
user mother AND mommy omg
mickschumacher can you teach me how to surf instead 🙏 lewishamilton doesn't understand that not everyone is naturally talented at everything
↪ lewishamilton i don't know what to tell you, mate 😂 keep calm and keep your balance, it's all chill
↪ mickschumacher easy for you to say 🙄 you're not the one drinking seawater every five minutes
yourusername has added to their story
liked by yourusername, mickschumacher, charles_leclerc and 124,129 others
tagged: yourusername
sebastianvettel Welcome home yourusername ❤️ the flowers missed you and so did I 😉
view comments
user i love how y/n's husband's instagram is basically just a fanpage for her 😂
↪ user nah you can't forget the flowers ‼️
↪ user seb loves two things in life and they're his flowers and his wife 😌
user i don't even go here but i'm all for the golden retriever and black cat vibes 🤭
mickschumacher seb i have a bee problem in my backyard...
↪ charles_leclerc you know you could just text him right 🙃
↪ mickschumacher he checks his phone once every three months if your name isn't y/n l/n-vettel 💀
↪ sebastianvettel and I'm not ashamed of it 😄 but what can I help you with?
↪ mickschumacher a colony of bees moved into my garden 😅 i don't mind them but is there anything i should watch out for?
↪ sebastianvettel As long as they're not being overly aggressive you shouldn't have any problems 👍 keep me updated though
↪ mickschumacher thanks seb you're a lifesaver 😊
yourusername thanks for the flowers schatz 😘
↪ user ugh they're so Parents 😭
liked by charles_leclerc
↪ user charles liked your comment 😂 i guess even the drivers agree
↪ landonorris you didn't hear it from me but seb and y/n are the unofficial official grid parents
liked by mickschumacher, lewishamilton, yourusername, and 23,109,234 others
tagged: sebastianvettel
mercedesamgf1 We have a special guest this weekend at the #JapaneseGP 🐝 sebastianvettel is here at Suzuka to promote biodiversity and build some bee hotels with the drivers 💪
view comments
charles_leclerc Appreciated the art tips 😉
user this man 😭 "what do you think about this weekend's race?" "well obviously my wife is going to win everything"
↪ user as he should honestly
↪ user when you're in a "being a wife guy" competition and your opponent is sebastian vettel 💀
kevinmagnussen Thanks a lot Seb 😂 the kids want beehives now!
↪ sebastianvettel Glad to know that someone was listening when I was giving my talk about the role that bees play in our ecosystem 😔
↪ landonorris in my defence someone brought cookies and i was hungry...
↪ sebastianvettel you are 24 years old, Lando
↪ user why can i feel seb's disappointment through an instagram comment 😭
yourusername sometimes i wonder if he'd leave me for his bees 😂
↪ lewishamilton don't worry, you can crash on my couch if he does. roscoe needs a permanent babysitter
↪ yourusername two decades of friendship and that's all you see me as?
↪ lewishamilton let me by during the grand prix and i'll think about it
↪ yourusername mercedesamgf1 i'm telling toto
↪ sebastianvettel I would never leave you for bees, liebling. Clean energy, on the other hand...
liked by sebastianvettel, lewishamilton, susie_wolff and 132,293,402 others
tagged: sebastianvettel
yourusername Happy anniversary, my love 💐 12 years and counting
view comments
user the bouquet emoji because he's a florist omg 🥹
user my favorite thing ever is how 5-time wdc y/n l/n-vettel's husband is Just Some Guy who's completely smitten with his wife and makes her all the bouquets she could ever want 😭
↪ user they're like cottagecore addams 😩 i adore them so much
↪ user COTTAGECORE ADDAMS HELP 🤣🤣🤣
susie_wolff Congratulations and our best wishes!
↪ yourusername thank you ❤️😊 the same to you and toto!
sebastianvettel I'm the luckiest man in the world to be able to call you my wife and partner 💗 You're P1 forever, especially in my heart
likes and reblogs are appreciated!
taglist: @scenesofobx @vellicora @boiohboii @julesbabey @flannelforthetoads @misartymis
#solwriting#f1 x reader#formula 1 x reader#formula one x reader#formula 1#f1#f1 fanfic#formula 1 fanfic#formula 1 x you#f1 social media au#f1 imagine#f1 smau#sebastian vettel#sebastian vettel x reader#sebastian vettel x you#sebastian vettel imagine#sebastian vettel fanfic
1K notes
·
View notes
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
#hellsitegenetics#faq#intro post#flowers#plants#requests#birds of paradise#asks#remember to keep checking back!
1K notes
·
View notes
Text
mr. big (social media au) - cs55
masterlist ||
Summary: The one where there he was, wearing armani on a sunday, your boyfriend, Carlos.
Pairing: carlos sainz x romance writer!reader (model used: random people i found on pinterest)
Warnings: none other than some cursing? carlos being an old money dream as always
Request: "For a smau, would love to see romance writer!reader with Carlos (he is just Disney prince vibes) where fans aren’t quite sure how they got together but the influence him on her work is greatly appreciated" by my lovely @percervall
Author note: OKAY JUST REALISED I AM A CARRIE AND BIG APOLOGIST, WHO WOULD'VE THOUGHT (i might be freaking out about them, but i will always be a charlotte girl)!!! (might honestly turn it into a series because who doesn't love a satc x old money crossover???)
Please also note that all of my works are protected under copyright, and not available for reposting on other platforms.
yourusername
Liked by carlossainz55, yourbestfriend, readersdigest and 438,927 others.
yourusername: busy, busy, busy bee.
user: thank you mother for feeding us with another hot billionaire novel
yourusername: you are more than welcome
user: how is she not only one of the best romance authors, but also a fashion icon??
user: can't wait to read what carlos inspired this time!!
carlossainz55: you are not wearing you glasses again, cariño
yourusername: why don't you come put them on yourself??
user: oh, they are so cute it's sickening
user: GIVE US THE MANUSCRIPT AND END OUR SUFFERING
view all 2,387 comments.
user: how did they get together again??
user: i think he ran into her at one of her book signings in madrid?
user: i thought it was when she went to the paddock for some good old r&d?
user: i heard somewhere that a friend set them up
yourusername posted a new story!
carlossainz55 posted a story!
yourusername
Liked by carlossainz55, landonorris, goodreads and 682,928 others.
yourusername: life lately & "between love and loathing" out june 23rd.
user: we love the romantic getaway, and a new book!!
user: we're being fed in more ways than one, and i am not complaining at all!!
user: oh shit, we're about to read the best romance novel of all time
view all 13,726 comments.
carlossainz55: i'm so proud of you, you have no idea
yourusername: way to make me cry
yourusername: i love you though
carlossainz55: te quiero más
user: I CAN'T BELIEVE THEY ARE THE OLD MONEY COUPLE WE NEEDED ALL ALONG AND WE DON'T KNOW HOW THEY STARTED DATING
user: it will remain forever a mystery
user: but at least we have content to keep us going through these hard times
carlossainz55
Liked by yourusername, scuderiaferrari, charles_leclerc and 977,520 others.
carlossainz55: one of us made the pancakes, and one of us stood there looking pretty.
yourusername: hey, it was your turn to make breakfast
carlossainz55: and i loved every second of it
yourusername: even doing the dishes?
carlossainz55: especially doing the dishes
user: this is by far the most romance book thing this man has done
user: i still don't understand how they started dating, but good for them i guess
view all 35,726 comments.
landonorris: hey, i didn't get any pancakes, did you? @charles_leclerc
charles_leclerc: didn't even know we were having pancakes, where are our pancakes @carlossainz55
landonorris: and cooking in a towel?? how is that sanitary??
charles_leclerc: he's breaking at least a dozen health codes
carlossainz55: i hate you both
yourusername: you are all a pr nightmare
scuderiaferrari: i agree
user: damn he got lucky
yourusername
Liked by f1wagss, carlossainz55, sarahjessicaparker and 736,928 others.
yourusername: and there he was, wearing armani on a sunday, carlos sainz.
user: SHUT UP!!! SHUT THE FUCK UP!!
user: what kind of an iconic cunt slay is this
user: and just like that... they became the coolest couple on the internet
user: NEW NOVEL IDEA, SEX AND THE CITY RETELL WITH CARLOS
user: girl wtf
yourusername: no let her cook
yourusername: you might be onto something here
user: don't know if i want to be her or be carlos
view all 44,736 comments.
user: everybody say thank you mom for blessing us
carlossainz55: amor
yourusername: amor x2
user: oh she's working overtime god bless you
#monzabee#formula 1 x reader#social media au#f1 social media au#f1 fanfic#f1 fanfiction#f1 x reader#carlos sainz#carlos sainz x reader#carlos sainz imagine#formula one x reader#carlos sainz social media au
1K notes
·
View notes
Text
Million Dollar Man [LS18 smau]
Lance Stroll x reader [social media au]
Masterlist
Summary: Lance's girlfriend isn't afraid to show how much her boyfriend loves and spoils her. Unfortunately, "fans" seem to think she's a gold digger. But who would Lance and Y/N bee if they just let it slide?
Warnings: A lot of hate towards the reader by online trolls and just toxic fans, at the end she and Lance shuts them up but if you're not in the right head-space to read this, then please don't.
yourusername posted on instagram
liked by lance_stroll, fernandoalo_oficial, astonmartin and 192,344 others
tagged: astonmartin and lance_stroll
yourusername life lately... how about you? 🍰💐
view all 3209 comments
user1 more like: life lately 💸💸💸
user2 LOL
lance_stroll life lately has been great ❤️
liked by the author
user3 Lance don't worry we're going to save you!!
user4 our guy is lyinggggg i can feel it
user5 Oh my god let them live a happy life you trolls🤦♀️
user6 how can you know it's happy when she clearly uses him for money?🤨
user5 And how can you know it's not? Besides I don't think she uses him for anything🤷♀️
user4 then your just as naive as him user5 lol
user7 she's so classy a love it!😻
user8 Can she even drive or she just wanted to take a photo in his car?
fernandoalo_oficial You are slaying Queen!😉
fernandoalo_oficial Did I do it correctly yourusername?
yourusername it's great nando, just please never use that emoji again and you'll be ready do graduate from my gen-z university!
fernandoalo_oficial Damn it I knew all you use these days is this one: 💀
yourusername 💀
user9 OKAY I DON'T CARE ABOUT ANYTHING ANYONE SAYS ABOUT HER AND LANCE CAUSE I LOVE Y/N AND NANDO INTERACTIONS MORE THAN MY OWN LIFE!!
user10 i'm convinced she holds both aston drivers hostage in her basement and is forcing them to comment on her posts
user11 It's probably not even her own basement but Lance's😭
user12 nah she ain't even that pretty
user13 omg no way this post is the way I found out lance mf stroll has a girlfriend?🤠
user14 GIRL you have so much lore to catch up on
user15 Yeah welcome to the worst wag ever fandom xd
user13 wait I'm so confused... why do we hate her???
user14 bc she's basically a gold digger, like from the moment her and lance started dating she's been posting only about shopping and showing off herself and her bf's money
user12 plus she ugly af
user15 Yeah and there are rumors on twitter about her being really mean to everyone and that the whole paddock hates her and stuff...
user13 okay I get that but tbh we can't believe everything that's on f1 twitter
user14 idc she's a bitch even without the rumors
user15 I can tell Y/N is trying so hard to have the rich girly aesthetic... it's actually embarrassing😂
astonmartin Wow you have a great car right there😍
user16 more like her sugar daddy lance has it lol XD
user17 guys be fr if you had a rich boy you'd be spending his money too!!!
twitter
yourusername and lance_stroll posted on instagram stories
yourusername posted on instagram
liked by estabanocon, lance_stroll, astonmartinf1 and 206,948 others
tagged: astonmartinf1 and lance_stroll
yourusername thank you spa for having me! what a race, congrats to my favourite driver lance_stroll on p9 & his teammate fernandoalo_oficial on p5! great team work, hope to see you on another grand prix in the future astonmartinf1 💚🏆
view all 4022 comments
astonmartinf1 we hope to see you on another grand prix as well Y/N!����
liked by the author
user1 you don't have to lie admin, it's waste of money on her... better give the paddock pass to someone else
astonmartinf1 well, we definitely won't give it to you user1, so no need to worry about it 😙
user2 daaaamn, the admin is coming for y'all haters
user3 Of course she had to wear the racing suit... c'mon that's so embarrassing🙄
user4 actually it's pretty normal, I'm pretty sure Max's gf also wore his racing suit at some point
user3 Yeah but I at least like and respect Kelly... Y/N is a horrible gold digger
user4 well then I'm pretty sure it's your problem, not hers🤷♀️
user5 girl stop pretending you care about racing we all know you do it just for pr and cash xdd
user6 Honestly I'm not a Lance Stroll fan, but he deserves someone better than her...
lance_stroll Thank you to my favourite wag! 🥳❤️
yourusername love you baby!!!💞
user7 favourite wag😂 good joke😂😂
user8 am I the only one who finds their interaction cute??
user9 yeah you are user8... like just look at it, it's so forced... wouldn't be surprising if their whole relationship was fake
user10 You can hate on her all you want, but she's actually gorgeous in the third pic😻
user11 YUUUCCKK🤮🤮🤮
user12 you see I would be fine with this post if she didn't have to show off the aston martin car again!!!
user13 Hey did you notice she tagged Nando in the caption and he didn't reply to her? I call it ✨karma✨ lol
user14 maybe he escaped from her basement😭
user15 💚💚
user16 sorry but I can't help it. There's just something fishy about Y/N and I can't bring myself to like her at all
user17 Guys who is this girl and why does she get more hate in her comments than hailey bieber??💀
user18 I hate how she makes the whole Grand Prix about herself
user19 no but fr... like honey, idc about you and your favourite driveeer
user20 Tf?? She literally called LANCE her favourite driver how is that about her... you haters are so dumb🤦♀️
user21 I bet she read the comments on twitter about how she's bad gf for not going to any races and decided to fix her image by this XD
user19 lmfao didn't probably work the way she hoped
messages between Y/N and Lance
lance_stroll posted on instagram
liked by yourusername, sebastianvettel, f1 and 330,219 others
tagged: yourusername
lance_stroll As some of you now, I am not very active on social media. Today I'm making an exception for Y/N, my lovely girlfriend I've been dating for almost a year now. She is one of the greatest, most kind, caring and selfless people I know. I don't know where the idea of our relationship being unhappy, one-sided or even insincere came from, but I would like to make it very clear once and for all that these assumptions are as far from the truth as they can be.
In my life, I experienced a lot of hateful comments and reactions myself. It is not something I wish anyone should have to go through and it's disgusting. I love Y/N with all my heart and I hope that one day, she'll make me the happiest man alive and allows me to marry her, build a family together. No one will ever again speak about her in an inappropriate way, or they'll be blocked and possibly face legal actions taken agains them. I am very serious about this.
Y/N, I'm not afraid to call you the love of my life. I never want to see you cry because of some meaningless hater. Love you to the moon and back, sweetheart ❤️
view all 4823 comments
user1 It's just so heartbreaking how Lance himself had to go through so many waves of hate because of his dad and now he had to watch Y/N go through it too...😓
yourusername love you to the moon and back too lance!!!💖
lance_stroll Wouldn't have it any other way honey!😌
user2 you know it's serious when sebastianvettel shows up
astonmartinf1 once the it couple, always the it couple!💚 proud to say we were never a hater😘
user3 i still think it's fake
fernandoalo_oficial and I think you are fake🤪
user4 LMAO nando come and get the haters lets goooo
user5 That's how you shut them up xd
fernandoalo_oficial how do you children say it? I AM LANCEY/N DEFENDER
user4 yeah yeah nando exactly that or you can say your a lancey/n truther
liked by fernandoalo_oficial
user5 omg I can't believe I just had online conversation with THE Fernando Alonso😭
user4 GIRL ME TOO AND HE EVEN LIKED MY COMMENT😭😭
f1 What a beautiful couple you are!🙌 Hope to see you in the paddock after summer break!😏
user6 "they'll be blocked and possibly face legal actions taken agains them" daaammmnn man is standing on business here
user7 Tbh I never understood why y'all hated on her sm she's literally so beautiful and seems kind as well🤷♀️
lilymhe pretty giiiirl
lance_stroll I couldn't agree more!❤️
yourusername oh stop you two I'm blushing
user8 Can we take a moment to appreciate how beautifully the caption is written?🥹 Lance really has some poetic talent!
liked by yourusername
user9 aaah she's still a gold digger and he's too blind to see it😂
user10 Yeah she probably charmed him in bed or sm
user11 Ohh user9 and user10... I wonder how it feels to know Lance and probably some other drivers hate you🫢
chloestroll My brother and my future sister-in-law!🥰
liked by the author and yourusername
yourusername 🥰🥰
user12 im actually so happy to see y/n replying to some of the comments and just being active without so much hate on her now!!!
yourusername posted on instagram
liked by lance_stroll, kellypiquet, fernandoalo_oficial and 299,102 others
tagged: lance_stroll and dior
yourusername they say if he wanted to he would... I say he wants to so he does 🌹❤️
comments have been limited
lilymhe she ate you jealous people up with that caption
liked by lance_stroll and fernandoalo_oficial
lilymhe also alex_albon me when??
dior Wow!❤️🔥
lance_stroll That's what real men do instead of trolling others on the internet.
yourusername daaammn baby
lance_stroll What? I'm just stating facts 😌
kellypiquet shopping trip to Paris when?😍
yourusername anytime you want!!!💕
astonmartinf1 So lucky to (basically) have you on our team💚
fernandoalo_oficial I call that a slay admin
astonmartinf1 ...should I tell him slay is kinda out dated??
yourusername aaah let him have his moment
fernandoalo_oficial WHAT?! YOU TRAITORS I THOUGH I WAS GEN-Z APPROVED
yourusername 🫢
THE END
Author's note: I hope you liked my first ever social media au story! I'll be glad for every feedback, comment, like, reblog and everything! You can definitely send me asks and requests for another smau's and even 'normal' fanfictions. Have a great day!
#lance stroll x reader#lance stroll#fanfiction#formula 1#f1#f1 x reader#f1 fanfic#f1 imagine#fernando alonso#x reader#social media au#social media fic#formula one#fanfic#couple#rich couple#aesthetic#kelly piquet#lily muni he#aston martin#aston martin f1#social media#instagram#twitter#text messages#sebastian vettel#chloe stroll#strollonso#f1 fic#dior
2K notes
·
View notes
Text
Rest and Relaxation
"who's that?"
"that is the queen bee regina george. do not look her in the eye. she can smell fear."
cady rolled her eyes at damian giggling. in the small amount of time that she had known him, he had been very dramatic. janis also rolled her eyes. "she can't smell fear. but he is right, don't look her in the eyes." cady watched as the blonde girl walked up to her table holding cheese fries, sitting next to the girl that damian said "has hair full of secrets".
there was a thud as the trio turned spotting a girl struggling to carry her backpack, books, and lunch. the girl looked over at the trio, noticing janis and damian and shyly waved. they all waved back and watched as she stumbled past them.
"who's that?" damian shook his head. "that's y/n, regina's girlfriend." cady looked at the two shocked. she didn't think regina was gay. "really? she's so...shy." janis nodded as they watched y/n finally make it to the plastics table. regina's face lit up at the sight of her girlfriend. y/n smiled back and sat next to the blonde, unloading everything on the table. regina pulled y/n into a kiss, making the girl blush.
"hi baby. how is your day going?" y/n blushed deeper at the petname. "its going fine gina. i just have a lot of work to do." y/n was a nerd in the best sense. she had the highest gpa of the whole school, she was a mathlete, and she was in all advanced classes. she also had a really bad habit of overworking herself. regina hated watching her girlfriend burn out so she did her best to step in before it got bad.
"how about you come to my house with us after school? we can do a spa day for you. get you to relax a little. i know how stressed you've been." y/n's heart melted at her girlfriend's worry. as much as she wanted to do that, she had a mathletes meeting after school followed by sat prep until late at night.
y/n shook her head. "i wish i could gina, but i have mathletes until 4 and then sat prep until 8 and then i still have to finish my essay." regina sighed, scooting closer and scratching y/n's back to get her to relax a little. their moment was ruined when y/n's brother shane walked up to them. "ladies, nice to see you guys today. y/n, chris was wondering if you could possibly look over his history paper and see if its good enough for at least a b minus."
regina was about to speak up when y/n beat her to it. "yeah, just give it to me before i go to mathletes and tell him i'll have it back to him by tomorrow morning." shane smiled and ruffled his sister's hair, placing a brief kiss on her head. "thanks sis. i'll let him know." y/n smiled as her brother walked away. regina looked at her girlfriend worriedly. y/n shook her head. "it's fine gina. i'll be okay."
the bell rang, dismissing lunch as y/n stuffed all of her things in her backpack, kissing regina and heading off to her next class. gretchen watched regina deflate as y/n walked away. she put a hand on her shoulder and smiled at her. "she'll be fine regina." the blonde sighed. "i hope you're right."
y/n sighed as she opened her locker the next morning. she didn't get home until late last night and woke up earlier than usual to go with shane to football practice to give chris his essay and finish up any homework she missed the night before. she was exhausted and just wanted to go home. unfortunately for her, the world doesn't work like that and it was only going to get much worse.
for backstory, regina and y/n had been friends since 4th grade. regina had been very protective over the girl since they first met all those years ago. they met when regina stepped in and stopped a few boys from shoving y/n around. and since then, nothing had changed. regina was just as if not more protective over the girl. they had come out at the end of 8th grade which just boosted the protectiveness. ever since they came out as a couple, less people picked on y/n, though there were some who just didn't get the message.
enter ian. who had harbored a major crush on regina even after she came out. he was the stereotypical high school male. he was the captain of the basketball team, he was ripped, he was hot and every girl in north shore (except the plastics and y/n) wanted him. he felt like he was a better match for regina than y/n was and never failed to make his opinion shown every once in a while.
regina and the plastics hadn't made it to school yet and shane was in the locker room so this was his perfect opportunity. he and a couple of his friends walked up to y/n, who was reading over her ap chem homework and not paying attention. "hey there nerd. i see your guard dog isn't here." y/n rolled her eyes. "no ian, regina isn't here yet. can i help you with something?"
that was apparently the wrong thing to say as ian slapped the papers out of her hand and shoved her against a the locker next to her. at this point, people had started recording on their phones. y/n winced at the impact as the group of boys started laughing. "you don't get to have an attitude with me nerd. i think you forget where you fall on this food chain. allow me to remind you."
he brought his fist back to swing at y/n but the punch never came. the only thing y/n saw of her savior was pink nails before she was let go and ian was flying the other way. y/n looked up to see an angry regina flanked by an equally angry karen and gretchen. the two obviously weren't as close to y/n as regina was but they also had a protectiveness over her.
ian looked up scared as his friends fled the scene. karen and gretchen helped y/n pick her stuff up and dusted her off. ian shrunk in fear as regina towered over him. "i don't think you understand where you fall on this food chain, but allow me to remind YOU. you do not compare to y/n. she is so far above you that you don't even exist in her world. that being said, if i ever see you mess with her again, you will be finished."
he nodded and scrambled away. regina looked at the crowd that had formed. "anyone else have a problem with my girlfriend?" the crowd scattered as everyone went back to what they were doing. regina smirked victoriously before pulling y/n into an empty classroom, karen and gretchen standing guard outside.
regina looked over y/n for any injuries before y/n's grabbed her shaky hands and kissed both of them softly. "i'm okay, gina. just a little shaken up." regina let out a breath she didn't even know she was holding before pulling y/n into her arms. "i'm so sorry i wasn't there. i couldn't find my keys before we left so it put us behind-" y/n pressed her lips to regina's. the blonde instantly calmed as the two kissed, y/n being the first to pull away. "breathe babe. i'm okay. he's not going to mess with me again."
regina nodded and pulled y/n into another kiss, this one quicker than the last. "will you please come over after school today? i wanna take care of you. it's the weekend so you can stay the whole weekend while i help you relax. please." y/n nodded. "if it will make you feel better, yes." regina smiled and pecked y/n's lips. "good. i wasn't taking no for an answer. now, let me walk you to class?" y/n nodded and the two made their way out of the room.
regina stood against her jeep, waiting for y/n. karen and gretchen had hitched rides from shane so that way regina could take her girl straight home.the front doors to the school opened to reveal an exhausted looking y/n. regina's heart broke at the sight of the girl, she looked more exhausted than she did when the blonde saw her at lunch.
y/n shuffled to the jeep, regina grabbing her backpacks and throwing them in the backseat (carefully of course) before helping y/n into the passenger seat. regina walked around and got in, holding y/n's hand and kissing it. the girl sent her a sleepy smile and leaned her head against the window.
regina made it to her house in record time. she left the girl's bags in her car, making a mental note to ask her dad to grab them later. she helped y/n in the house and to her room, gently laying her on her huge bed. "stay right here baby. i'm gonna go run us a bath." y/n sleepily nodded, nuzzling into regina's pillow.
five minutes later, regina came out in a fluffy, pink robe, gently shaking y/n awake. "come on baby. let's get you in the bath." y/n stirred and nodded. the blonde helped her to her feet, gently pulling her into the bathroom. from there, she slowly took y/n's clothes off, head to toe. regina then got into the tub and guided y/n in, holding her to her chest.
the couple stayed in the bath for about half an hour before regina decided to get them out. luckily, y/n had been over to the blonde's house enough that she had her own little section in regina's massive closet. regina grabbed a hoodie and a pink pair of boxers for y/n and a hoodie for herself before getting them both dressed and into the bed.
y/n sunk into the soft mattress as regina gently maneuvered her to lay her head on her chest. y/n kissed regina's jaw and nuzzled into her neck. regina began scratching her nails down y/n's back. "take a nap and then when you wake up, i'll make you some dinner, and then maybe followed by dessert and a massage?"
y/n nodded before fully drifting off.
a few hours later, y/n woke up to the smell of her favorite pasta. she rubbed the sleep out of her eyes and stretched, getting out of bed and heading downstairs. she found regina cooking dinner with her "y/n❤️" playlist playing softly from her speaker. y/n smiled at how soft the queen bee looked before walking up and wrapping her arms around the blonde's waist.
regina smiled at the feel of her girlfriend snuggling into her back, turning the burner off and turning around. "hi baby. sleep good?" y/n nodded, pressing her lips to regina's. "what's for dinner?" regina smiled and pecked y/n's lips before explaining. "i made your favorite, cacio e pepe, some salad and garlic bread, and for dessert i made a lemon tiramisu. and after we are done eating, i am giving you a massage to get the stress of the week and especially today out of that sexy body of yours and we are going to cuddle up on my bed and watch some love is blind and you are going to sleep for more than five hours."
y/n smiled at her girlfriend, already feeling the stress of the week melt away. regina always took care of her when she needed it and she couldn't be more grateful to have her as her girlfriend. "god, i love you." regina blushed and kissed y/n's cheek. "i love you too. now, let's eat."
after they ate dinner and dessert, regina ordered y/n to take off her shirt and lay face down on the bed while she slipped in the bathroom. y/n did as told and winced a little before tossing the shirt off to the side and laying down. regina came out and lit a few candles before dropping the oil and bruise cream on the bed. she straddled y/n's lower back and gently ran her hands down the girl's back.
she leaned down and kissed y/n's shoulder gently. y/n sighed at the feel of the blonde's lips and whispered, "i love you gina." regina smiled, grabbing the bruise cream and started applying it to the newly forming bruises on y/n's back. "i love you too baby."
after a very, very, relaxing massage, y/n laid in between regina's legs as they watched "love is blind". regina had her fingers running through y/n's hair, scratching her scalp with her acrylics. y/n was drawing shapes on regina's stomach, the blonde girl shivering every once in a while. after a few episodes, regina asked y/n if she wanted anything to drink before realizing y/n was asleep. smiling, she carefully reached over to the nightstand to grab her phone, taking a picture of y/n.
she took to instagram to post the picture, smiling at the amount of cute comments their friends were leaving. she put her phone back and gently guided her and y/n into a more comfortable position. once comfy, she placed a gentle kiss on y/n's forehead, slowly drifting off.
1K notes
·
View notes
Text
So does anyone remember that post that was like "Robin and Eddie meet when she does that thing that's like 'hello, please pretend you know me so I can get away from this person' then Steddie happens?" Because I do. I cannot for the life of me find it. If anyone knows the post I'm talking about please let me know so I can link it, this is very much not my idea, it's that persons idea but the brain worms got me so here we are. 🤷♀️
We found it! It's this post by @wynnyfryd Thank you Anon! Obviously I went in a different direction with it but this post was 100% my inspiration so thank you for helping me find it!
AO3 link for those asking! 🖤
Robin should be royally pissed off with herself right now. She would be if she wasn’t so damn scared.
That guy was still trailing behind her, no matter the twists and turns she’d taken down different streets trying to lose him and the only thing she’d gained from it was to get totally and completely lost. It could be something completely innocent, the guy might be coincidentally going in the same direction as her but she wasn’t willing to give him the benefit of the doubt if it meant keeping herself alive.
The distance between the two of them was slowly closing as she was followed through the dark and empty streets of the city, hoping, praying for some kind of shop or restaurant or something to make an appearance so she could hide inside but apparently Robin was able to find the one street in this city where everything was either closed for the night or boarded up.
Her heart was pounding in her ears and the beginnings of tears were starting to sting her eyes and all she could think of was how sick with worry Steve was going to be in the morning when he woke up to no missed calls, no missed texts and no Robin. She’d scoffed at him hours earlier when he’d offered to go to the ‘work thing’ with her but she'd told him she was a big girl and she could look after herself and not to be such a worrywart mom.
And now she had no idea where her phone had gone, if she'd left it behind or dropped it somewhere, no idea where she was and no idea of what she was going to do.
If she’d been a bit more present in her head she probably would have noticed the loud, braying, male laughter coming from just ahead of her and crossed the street to avoid them before it was obvious she was avoiding them. But as it was she could barely see straight through her tears and panicked tunnel vision while simultaneously trying to keep an eye on the slowly encroaching guy behind her. She was practically already in the group’s space and one of them had definitely already seen her though he didn’t pay her any attention.
But even through her blurred vision and panic, she finally registered what exactly she was looking at. Four men standing around the entrance to what looked like the diviest of empty dive bars, chain smoking and being as loud as humanly possible, but that’s not what caught her eye.
Long hair, chains, leather, denim, tartan, rings, tattoos, subculture. If Robin had to choose a group of men to approach, any kind of subculture would be the best option. They knew what it was like to be other. There was no guarantee these guys were safe, but they were probably safer than a group of frat boys.
The next thing that caught her eye that nearly made her cry in relief as she got closer were the patches and pins.
A rainbow ‘A’ against a black and white striped background pinned on one guys collar, a yellow-white-purple-black patch on another's arm, a pink-yellow-blue patch over the third guys heart and a progress pride flag pinned to the largest guys pocket.
Her people.
Without a second's hesitation she made a bee-line for them, planting herself firmly next to yellow-white-purple-black patch person who had a mess of thick light brown curls that reminded her of Steve’s hair. They fell painfully silent at her arrival.
The four of them blinked down at her, with her tearfilled eyes and wild aura of panic around her they were probably, understandably freaked out.
“Hi guys!” She called out to them, probably a little too loud, hoping her voice carried back to the fucker following her, tensing as she could actually hear his footsteps approaching now.
The guy with the longest hair and the pink-yellow-blue patch standing directly in front of her glanced quickly over her shoulder before returning his gaze to her. His face split into a wide warm grin, tapping her shoulder lightly.
“Hey girlie. We thought you weren’t coming, we’ve been waiting.”
The footsteps behind her audibly slowed down. Robin laughed, a little maniacally, keeping her frantic gaze on him, not daring to turn around. “Yeah, I uh- g- got sidetracked.”
“Eddie, what-”
Pink-yellow-blue patch guy, Eddie she supposed, slapped ‘A’ patch guy lightly on the stomach with the back of his hand, shutting him up as her pursuer passed them by, giving the group a wide berth.
“Hey, no worries. You’re here now, right?”
Pride patch guy kept his eyes on the guy who’d been following her the whole time, only looking away when he eventually turned the corner, disappearing into the night.
Robin immediately felt her posture slacken now that he was finally gone, the full weight of everything coming down on her. Her tears began to spill over and her whole body shook as hysterical sobs started to pour out of her body.
“I’m sorry. I’m- I’m sorry. I didn’t know what else to do. I think I left my phone behind and I don’t know where I am. We only moved here a couple of weeks ago and I got lost trying to get away and- and-”
“Hey, hey. It’s okay.” Yellow-white-purple-black patch person squeezed her shoulder lightly, keeping their distance. “You’re okay. Don’t worry about it.”
“We can call someone for you, if you want?” Eddie asked, crossing his arms tight like he was trying not to reach out to her, probably worried it would freak her out more. “Boyfriend or girlfriend-”
“Or romantic partner.” The person with their hand on her shoulder interjected lightly.
“Alright Baron from the Baronies.” Eddie snorted. “But fair point, Gareth. Romantic partner or friend or whatever?”
“Um,” Robin’s voice was still shaking. “I don’t… I’ve never been good at memorising numbers…”
“Me too, terrible at them.” Eddie smiled again, pulling his phone from his pocket. Robin’s fear and panic was almost entirely gone now even though she was still hiccuping and sniffling underneath their concerned gazes. They were all firmly keeping their distance, keeping any touches short and fleeting, not moving too suddenly, trying their best to make sure she knew they weren’t a threat and it was really helping her to start feeling safe again. “But we could try to find them online? Instagram or something?”
“Yeah. Yeah we could try that.” She wiped her eyes roughly against her sleeve as she shuffled over to Eddie’s side. “My best friend, Steve, he uh- he’s probably asleep and I don’t think you can call him if you don’t have him added…”
“You can send him a message.” Eddie replied easily, handing his phone over. “And if he doesn’t wake up, we’ll try something else.”
“Don’t worry we’ll get you home.” ‘A’ patch guy smiled down at her while pride patch guy nodded along.
Robin sniffed again. “Thanks.” She was able to conjure up a small watery smile as she opened the app and found Steve’s profile, shooting off a quick message begging him not to freak out and explaining the situation as concisely as she could.
“Here.” She handed Eddie back his phone who glanced down at it for just a second before his eyes widened slightly as he scrolled through Steve’s profile.
“Oh shit. This is your friend?”
Robin nodded. “Mm-hmm.”
“He’s… he’s really pretty.”
That managed to pull a startled laugh from her. “Oh god, don’t tell him that, you’ll give him a big head.”
“Let me see?” Gareth asked, whistling low when Eddie turned his phone around showing a photo of Steve and Robin at their last pride parade cheering with the crowd, Steve with the pink-purple-blue of the bi flag smeared across each cheek and Robin with the pinks, oranges and white of the lesbian flag draped around her shoulders. “He is really pretty.”
Eddie snatched the phone back, cradling it to his chest. “Fuck off, Gare. I saw him first.”
Robin smiled again. “Any response from him?”
“Hm?” Eddie asked distractedly, scrolling through Steve’s photos before pride flag guy punched him in the shoulder. “Ow! Wh- oh, sorry!” Eddie frantically scrolled back up before clicking into his messages again and shaking his head. “Nothing yet.” He held the phone out to show her.
“Okay.”
“What’s your address? If he doesn’t respond, we'll find a way to get you there.”
“Uh…” Robin was drawing a complete blank, only able to remember her parents home address hundreds of miles away.
“Or tell us something nearby.” Eddie added, not missing a beat, clearly picking up on Robin’s lack of an answer. “What’s on your street?”
“Um,” she closed her eyes, trying to picture it in her head, “there’s a couple of Chinese take outs, Asian food store, paint store… there’s… I think it’s a tattoo parlour? There’s designs painted on the window, a tower on either side. I think they’re from Lord of the Rings?”
“Inklings? Is that the place?”
Robin opened her eyes. Eddie was grinning at her conspiratorially. “That’s it. You know it?”
“Would you believe me if I told you I work there?”
“No way.”
“Way.”
Hope was starting to grow feathers inside Robin’s chest. She could go home, she didn’t have to stay out all night waiting for Steve to wake up and never let her out of his sight again, she could hug her best friend and drink coffee out of her favourite mug and curse at their finicky fridge and steal his hair products again. She could go home.
“Is it far?”
“Nah, only a few streets away. Ten minute walk, tops.”
“D’you- I mean… do you think you could-” Could she really ask them to walk her home after they’d already done so much for her? Would she be asking too much? Could she be putting herself in more danger?
“I can take you there if you want? Let you get back to your… Steve.” There was a slight blush dusting over Eddie’s cheeks. Maybe he did have an ulterior motive, but it wasn’t an ulterior motive involving her. If she wasn’t so wrung out and aching to crawl into her own bed she’d be thinking up teasing material to lambaste Steve with. But as it was, she was desperate to get home.
“Would that be okay?”
“Yeah.” Eddie replied, bright and easy. “It would just be me and you though,” he held his hands up in surrender, “and you can totally say no, like if you're uncomfortable or whatever. Gareth is Grant and Jeff’s ride home and you’re still on the clock, right?” He turned to Gareth towards the end of his sentence.
“Yeah, but I get off shift in about an hour so could come in if you wanted, wait around in the back room until then if you wanna go as a group?” They answered.
“I think… I think I just want to get home.”
“Okay, cool. No worries I’ll get you there safe and sound. Here,” Eddie pulled his phone out again, “I’m gonna message Steve to let him know we’re on the way in case he wakes up,” he showed her the short message only sending it off when she gave a nod, “and I’ll get you to navigate just so we don’t get lost.”
He handed his phone to her with the maps app open, directing them towards Inklings tattoo parlour. He was playing it off like an easy joke, instead of another way to assure her she was safe. He was making sure she knew exactly where he was taking her at all times, he was making sure she had the ability to call the police or whatever if he turned on her, he was making sure she knew he didn’t need or want her address if she didn’t want to give it.
This fucking guy.
He definitely wouldn’t be the worst choice Steve had ever made if it did go that way.
“I don’t know how to thank all of you, seriously. I don’t know what I would have done if I hadn’t run into you.”
“Don’t worry about it.” Grant smiled at her before hesitating. “Uh, I just realised we don’t have your name.”
“Oh!” She laughed at herself, feeling lighter. “I’m Robin.”
“Pleasure to meet you, Robin.” Grant held his hand out, shaking hers once she took it.
“Likewise.”
“And don’t worry about thanking us, just pay it forward, yeah?” Jeff said.
“Plus.” Gareth took on a nonchalant tone even though they had a smirk plastered over their face. “We’ll see you again at Steve and Eddie’s wedding.”
“Shut up!” Eddie scowled but didn’t hold onto it for long in the wake of Robin’s giggles.
She sighed once the giggles subsided, a weight lifted off her shoulders. “I look forward to it.” She raised her hand in salute as the three of them headed back inside, turning to Eddie as he held his elbow out.
“Shall we?”
Robin tried to suppress her smile but took Eddie’s arm anyway. They only made it down one street and around one corner, Robin clutching tight to Eddie’s phone before he finally asked.
"So."
"So."
"Best friend Steve." Eddie twirled his rings around his fingers. "Is he…"
“He’s single.” She answered lightly. “But you might be arriving into his life at the wrong time. He’s recently sworn off men.”
“Well we’ve all sworn off men once or twice. Men are terrible.”
“Agreed.”
“Is it because of a bad ex?”
Robin threw her head back with a groan remembering the giant breakdown that had finally finally ended it. “Tommy was the worst. He’s the reason we even moved out here, there’s nowhere to get away from an ex in a small town, you know? They’re everywhere. I’m not going to go into what happened, it’s not my business to say but it was bad.”
Eddie nodded, his eyes down on the ground, running through everything in his head.
Robin could see the tattoo parlour up ahead, the glorious sight of their apartment building just a few buildings away.
“Do you think… with time… he could open himself up to men again?”
Eddie had such a tentative hope in his eyes, it was adorable really. Looking over him, she thought about the type of people Steve would constantly thirst over, blip in the matrix Tommy Hagan notwithstanding.
Lithe bodies with full lips and giant eyes, hair he could run his fingers through and something unusual about them. Something odd.
He’d never explicitly gone for someone so heavily into a subculture before but he’d never turned them down either. And based on Eddie’s job at the tattoo parlour and the way he was dressed, he almost definitely had some ink on him. That alone would be enough to make Steve swoon.
“I think he might. Will you walk me up?” Robin asked, holding the door to the building open, offering Eddie the same kindness under the guise of doing a favour that he had offered her so many times tonight.
“Yeah, sure.”
They’d managed to make it up to the third floor, walking down her hallway before Eddie’s phone started to ping incessantly.
She turned the phone over in her hand, looking at the screen. “He’s awake.”
Robin, where are you?
Are you okay?
I’m on the way.
Please be okay.
Their apartment door was flung open just as they reached it. Steve was standing there panting and terrified, his hair a mess, his glasses askew, his jacket and shoes thrown haphazardly over his pyjamas.
“Robbie.”
Steve slammed into her, holding her tight before immediately letting go to inspect her face and running his hands over her body, checking to see if anything was wrong.
“Are you okay? Are you hurt? What happened? What do you need?”
“Steve.” Robin caught his fluttering hands in hers and squeezed, nearly crying out in relief just to have him with her again. “I’m okay. Eddie and his friends helped me.”
“Eddie-” Steve looked to the side, noticing her saviour for the first time. “You’re Eddie.”
“I’m Eddie.” Eddie gave him a short little wave and a dazzling smile that quickly dropped in shock as Steve pulled him into a crushing hug, his blush returning with full force.
“Thank you, thank you so much. I don’t know what I would’ve-” Steve took a big breath in and loosened his arms from around Eddie’s shoulders. Robin saw his eyes slowly trail over his face before very briefly flicking down to the pink-yellow-blue patch then back up. “Come inside, the two of you. Can I get you anything? Tea? Decaf coffee? A glass of water? Like, literally anything to say thank you.” He asked, ushering the two of them into the apartment.
Steve caught Robin’s eye behind Eddie’s back and mouthed ‘oh my god he’s fucking gorgeous!’
Robin snorted and thought to herself ‘sworn off men, my ass.’
#steddie#steve x eddie#stranger things#fanfic#eddie x steve#penny00dreadful#steddie fic#stranger things fic#modern au#eddie and robin#platonic stobin#robin and steve#finding safety in people through pride flags#I am SUPPOSED to be TAKING A BREAK from WRITING so I don't BURN OUT#But THIS would NOT leave me ALONE#what's the ship name for platonic eddie and robin?#is there one?#THERE IS ONE#platonic edbin#safety fic
5K notes
·
View notes
Text
love to hate you | jjk [vii]
“when obnoxiously rich and spoiled frat boy jeon jungkook comes up to you one day and asks you to fake date him for money, you definitely should have said no. because before you knew it, you were going on insta dates with him and having lunch with his equally obnoxiously rich and spoiled friends.”
— genre: sexual themes, angst, fluff, fratboy! AU, fake dating! AU, college! AU, rich kid! AU, enemies to lovers! AU
— pairing: jungkook x female reader
— word count: 17.966
— warnings: swearing/cursing, alcohol consumption, jealousy, no communication skills whatsoever
— playlist: to be added
— a/n: after almost two years of no update its done. it would be a lie to say that i was always one hundred percent sure this was gonna see the light of day but its finally here, and im so so so happy to just put it out there and give it to you guys. @koocycle has listened to me bitch abt this one so much so thanks to her, also for kinda inspiring me to get back into tumblr.com and writing !! enjoy!! and once again, this is inspired by To All The Boys I’ve Loved Before by Jenny Han!
“You’re really showing your wealth, you know?” you said as Jungkook slid into the driver’s seat, shutting out the cold air. He raised a brow, handing you the bag for you to hold onto, shivering slightly from the cold, his neck exposed to the harsh wind.
“How so?”
The engine sputtered to life as he slotted in the keys, his phone mounted to the dashboard, showing him the way. You pulled out the one-hundred-dollar expensive wine bottle from the bag, scrutinising it. Some of the glitter from the red ribbon the salesman had wrapped around it in an effort to be more festive and fitting today’s occasion peeled off.
“This is too much.”
“Yeah, I know, the bow’s tacky but I couldn’t stop Kangjoon from-”
“No, I mean the hundred bucks you dropped on it. It shows your wealth,” you repeated, scrunching your nose. “Also, didn’t know you were on a first name basis with the salesman.”
You let the bottle slip back into its bag, scared Jungkook was going to make a sharp stop and cause you to drop and waste the bottle. God knows you didn’t have one hundred bucks casually lying around like him—even though you were sure Jungkook wouldn’t make you replace it and would definitely just buy it again himself.
“What? Don’t tell me you didn’t like Kangjoon? He’s a great man, very competent.” And just as you were about to tell him that Kangjoon scammed him, Jungkook continued, “Also isn’t that the whole reason why you’re dating me? My wealth?”
He said it with a grin, turning to you as he let a family of four pass, receiving a thankful hand raise from both of the parents as they ushered their young children across the street. And even though he meant it purely as a joke, his smile and tone indicating as much, his words made you scrunch your face like you’d been stung by a bee.
“It’s so unnecessary. We wouldn’t know the difference between this and supermarket wine, and Chae literally said not to bring anything. She’s gonna scold you, you know?”
If it had gone your way, you’d have gotten the second cheapest bottle of semi-fancy alcohol they had and called it a day but Jungkook swiped his card before you could intervene, ever so easily charmed. Well, actually if it had gone your way at all, you wouldn’t have brought anything to begin with. Chaeyoung hated it if her guests brought anything anyway.
“Gotta impress your friends, don’t I? Can’t have them not like me,” he argued, and you rolled your eyes.
“First of all, no, you don’t-”
“You don’t want your friends to like your boyfriend?” Jungkook gasped, staring at you with his mouth agape and eyes wide as you came to a stop in front of a red light. You shook your head.
“No, can I speak?” you sighed, frowning as Jungkook laughed, clearly getting his kick out of annoying you. “My friends already like you, and you know that. We’re driving to Ji’s and Chae’s place now for a Christmas party. One that you were explicitly invited to. So I don’t believe you for a second when you say that you got this wine to impress them. Also, Chae said not to bring anything. You just like spending money.”
Jungkook pursed his lips, trying and failing to hide a grin. “Do I now?”
“Am I not exhibit A?”
He gave you a look as if to say touché.
“Okay, maybe you’re right,” he admitted. “But just so you know, I gladly spent my money on that wine if it means I’ll impress your friends and make them like me more. And I’m even more than happy to spend it on you, cabbage.”
He looked at you by the end of his words, flashing you a grin. A grin that made him look so pretty and adorable, that would have made your knees buckle if you hadn’t been sitting, that wrapped your heart into his grip even tighter. A grin that made you wonder if a parachute would be enough to stop your fall for him, or if you were simply doomed for this fate, for the bone crushing landing.
You turned your head to the window, glad to see you had made it to Jisoo’s and Chaeyoung’s place.
“I think you’re just happy to have an excuse to spend your money,” you mumble, pretending to busy yourself with the straps of the bag.
“Sure—” There was a shrug, and you should have prepared yourself for the worst, should know better by now that Jungkook couldn’t just agree with you and leave you in peace. “—or you’re just the love of my life, cabbage, and what’s mine is yours.”
The words remained casual on Jungkook’s tongue, easy as ever. And they remained difficult and frown-inducing for you.
“You’re-!”
A laugh bubbled up from Jungkook’s upon your silence, and though you were trying your deepest and most desperate to resist, your heart skipped a beat. It was fatal, cardiologists would say. How deeply you’d fallen, it was fatal. Your heart couldn’t be saved.
And as if he hadn’t said the most impossible thing ever, Jungkook pulled into the parking lot and turned off the engine, a grin plastered on his lips.
“Alright, let’s-”
You yanked the door open, stepping (of course) in a puddle. With a groan and wince, you slammed the door shut. Your breath came out white and cloudy, December coming into its full swing. The weather had been harsher than ever—wind dragging on your skin until it was painful and tense, air cold enough to dry out your throat and mouth, every window coloured a milky white, and clouds hanging far and wide in the sky for every hour of the day. The urge to crawl back into the oh so warm car was strong. The urge to run away from Jungkook however was just that much stronger.
The bottle bumped your hip bone as you rushed towards Jisoo’s and Chaeyoung’s apartment building. You didn’t turn around as Jungkook called after you to wait with a laugh, fumbling to unhook his phone from the dashboard.
You reached the glass front door rather quickly, a handprint smudged across it that hadn’t been there last time. You cringed, but couldn’t think about it too much, worrying a lot more about the diminishing distance between Jungkook and you as you waited for one of your friends to open the stupid door for you. You knew for a fact they were already there, spotting Hoseok’s car parked on the side of the street. If he was there, Jimin was too, always catching a ride with him.
“Do you really think you can outrun me?” Jungkook called out, just a dozen steps behind you.
You pulled on the front door as if it made a difference, pressing the bell repeatedly. He slowed his walk, burying his hands into his pockets. All so very smug. Your features twisted into a frown.
“You’re so slow. You always run from me as if I won’t catch up with you in two-”
For once fate seemed to be on your side, the buzzer cutting through the air. The door almost hit you in the face when you yanked it open. You slammed it back shut again, just right in front of Jungkook’s nose. He pulled on the handle. The lock had clicked in. You watched his features twist as he realised he was too slow. His lips pressed together, curling inwards as he watched the biggest and proudest grin spread on yours.
“What were you saying? About me being too slow?” you said. A smile tucked on the corners of his mouth as he shook his head at you.
“Open up.”
He knocked on the glass, right in front of your nose.
“What? I can’t hear you.”
You put your hand to your ear, tilting your head.
“Just open up.”
“You gotta speak louder. I really can’t hear you with this door between-”
“Cabbage, you better open the door for me now, or I’m gonna make you regret it,” Jungkook said, narrowing his eyes, tongue poking in his cheek. And even though you were certain it was an empty threat—how was he going to make you regret it?—, you contemplated for just a second if maybe you should listen and open the door.
“I’m gonna count to three.”
You scoffed. Were you a kid? And even more so, what was Jungkook going to do to you? Were you going to cave because of an empty threat?
“Please do,” you smiled, eliciting one from Jungkook himself.
“Three.”
He raised a brow.
“Two.”
You folded your arms in front of your chest.
“One.”
A moment passed.
Nothing happened.
“Alright, fine,” Jungkook said before dramatically ringing the bell. And even though you rolled your eyes, you did inch back. He was going to chase you, that one was for sure.
The moment the buzzer rang, you took off. Jungkook let out a laugh.
“Now, you run?” he taunted, pulling the door open, his steps echoing through the hallway. You took two stairs at a time, yelping when you realised that Jungkook was hot on your tail. Maybe you should have run earlier. Or maybe you should have opened the door for him. But who were you, letting a guy threaten you? No less Jungkook of all people, that idiot.
You made it up the flight of stairs faster than you ever had, your lungs lit on fire. The front door already stood ajar for you. You could distantly hear Chaeyoung call out for Jisoo- A hand wrapped around your waist and pulled you back. Jungkook stood right in front of you, chest bumping into you, the biggest grin on his lips.
Shit.
“Gotcha.”
Your face soured.
“Oh, h-how are you?” you coughed with a smile, and he chuckled, never taking his eyes off of you even as he grabbed the bag from your hands and placed it down. You had completely forgotten about it. “Don’t look at me like this. T-that’s not fun.”
“Neither was having the door slammed in my face.”
You backed into the wall. Turns out being tough was a lot more difficult when there wasn’t a door to shield you and Jungkook was actually in front of you, just centimetres from your face and staring at you like you were his favourite thing in this entire world. His hand sneaked around your waist, slipping underneath your sweater, fingers grazing the small of your back. His touch was light and delicate, teasing in all the right ways. It was cold too, making you arch and almost wince. And it was all too much—a tingle spreading across your back, rushing straight to your heart.
“Any last words before I make you regret it?” Jungkook hummed, and you should snort and laugh because he should sound ridiculous. But somehow, his words made you tense, the mere thought making your head spin in rounds and rounds. You bit on your tongue, silencing any sound that might just want to crawl up your throat.
You shouldn’t let Jungkook be this close to you. You needed distance for your sanity. But you couldn’t bring it over your heart to push him away. You didn’t have it in you. Not when there was very much a part of you that wanted to find out what Jungkook exactly meant.
He drank you up with his eyes, gaze dark and full of something hazy. Full of something you couldn’t pinpoint. But you loved it, you did. Maybe a little too much even. You loved the way it made your heart thump and rumble in your chest, made you forget that this was too much and far and dangerous, that Jungkook and you should keep your distance because in just a few weeks all of this would be over and you’d go your merry ways. But right now, with your back against the wall and Jungkook caging you in, thrill and excitement rushing through every single one of your cells, you couldn’t stop. You didn’t think you ever could.
“Got nothing to say now, cabbage?”
And when you still wouldn’t respond, he smiled. His face inched closer to yours, his nose brushing yours. Your fingers itched to hold onto something, onto him, curling and uncurling in the air. Because you shouldn’t, you really shouldn’t. But you did, hands gripping his sweater as if you were lost in the sea and he was all you had to cling to.
You closed your eyes, anticipating and waiting for Jungkook to kiss you, your breath stuck in your chest. Any time now. It was going to happen-
“Oh my God, please don’t do this in my hallway.”
You whipped your head around, your heart dropping to the floor. Jisoo stood in the doorway, face twisted in utter disgust.
“Please, anywhere but my fucking hallway. That's all I’m gonna be able to think about. Seeing the two of you eating each other’s faces.”
There was even clearer disgust in her voice.
Oh God.
“Hello, Ji,” Jungkook smiled, and you expected him to back away from you, but he gave you no distance. He wasn’t even the slightest embarrassed, if anything you sensed the slightest annoyance swinging with his words.
“Please step away from her, Kook,” Jisoo asked, gesturing for him to move backwards. But he wasn’t all too eager to follow, staying cemented right in front of you, hands still around your waist. He paused to think.
“I’ve got a really expensive bottle of wine.” He pointed to the bag. “I’ll give it to you in exchange for five more minutes.”
“Oh, you brought something? Chae’s gonna kill you,” Jisoo laughed before changing her tune, tilting her head to the side. “But how expensive are we talking?”
“Like one hundred bucks.”
You stared holes into Jungkook, mouth agape. You couldn’t believe what you were hearing. Were you not right here too? Did you become air? It was like you were cattle being sold off.
“Oh,” Jisoo gasped before shrugging. “Okay, deal-”
“Yeah, no way,” you laughed before doing what you should have done earlier—you pushed Jungkook away, making him tumble backwards a little. You stepped around him.
“But, Y/N, it’s one hundred-”
“Ji!” you gasped, making her laugh and reach out for you. She wrapped her arms around your neck, giggling as she did.
“I’m kidding. I’m kidding. I would never,” she told you, and you raised a brow at her. “Right, Kook?”
“Yeah, we were just kidding.”
“I don’t- hey! I can see you two exchanging looks!” you gasped, neither of the two even trying to be subtle. “Do you think I’m blind?”
“Ha, funny, I think-” Jisoo cleared her throat. “—I think Chae is calling for me? Oh my God, do you hear that? Yes, I’m on my way, Chae!”
And as if she hadn’t just stabbed you in the back, she slipped inside. But not without grabbing the bag and thanking Jungkook for it. You rolled your eyes, turning to head inside when he cleared his throat.
Jungkook was staring at you with his brows raised, clearly expecting… something.
“What?” you barked. He gave you a smile before stretching out his hand. You groaned. “Seriously? We have to get inside-”
But he waved his hand around, not budging. Rolling your eyes and with a long exhale, you took his hand into yours.
“You’re a child-”
Jungkook pulled you towards him, shutting you up with a kiss. One hand cupped your cheek and the other rested on the small of your back, pushing you into him. The kiss was tender and soft, gentle and light. And still, it was enough to have your heart thumping louder and harder in your chest than ever before. You asked yourself if Jungkook could feel it at all. That heart of yours that was oh so tight in his grip. That heart of yours that was bleeding in your chest. That heart of yours already ached at the thought of this all ending in just a few weeks.
It was a lovely kiss, a devastatingly lovely kiss.
And when Jungkook pulled away, his eyes so full and beautiful, you felt gutted and empty. Because this meant nothing to him. This meant nothing at all. You looked away. Jungkook laughed, pulling you flush to his side, all too unaware.
“Let’s go?”
You nodded slightly.
Jimin was first to greet you, leaping up from the couch and pulling you into a hug. “You made it!”
“Took you long enough,” Taehyung mumbled, sipping on his beer, earning himself a look from Namjoon that he simply ignored. “We could hear you two yelling around in the hallway.”
“Merry Christmas to you too, Tae,” Jungkook laughed, and the older one frowned at him.
“It’s December 10th.”
“In other words, it’s almost-”
“No, it’s not-”
Hoseok greeted you with a hug, ignoring Taehyung’s and Jungkook’s bickering because otherwise he would never get to say hello to you. “Looking good.”
“Thanks.” You stared at his sweater. “That’s one really ugly Christmas sweater.”
He laughed, thanking you. Seokjin and Namjoon were next to give you a quick hug, followed by Jennie and Yoongi, exchanging a few words with each of them. Taehyung and you stared at each other for a few seconds, neither of you saying anything. And though he tried to hide it, a smile formed on his lips. A smile you could only return. You blamed it on the holidays. They made you especially sappy and sentimental.
You were first to reach out. Taehyung reciprocated the hug. It was a little awkward and short and one-armed. It was more than anyone could ask of you. Jungkook nodded in both amazement and approval when you caught his eyes for a split second, and you just scrunched your nose at him.
“So how-”
You tuned out Seokjin, taking a minute to admire the decoration around you instead. Chaeyoung (because Jisoo wasn’t particularly all too fond of Christmas, but did put up with all of it because Chaeyoung very much was) always outdid herself every holiday season: red little fuzzy stockings hanging off shelves and cupboard knobs, cinnamon-scented candles lit up all throughout the place, miniature Santa and reindeer figurines sitting on every surface alongside bowls of chocolates and peppermints with fake snow underneath. There was even a small fake Christmas tree crammed into the corner of their living room with colourful baubles (some of which Jimin had gifted and had pictures of you all printed on them) and equally colourful fairy lights hanging on it. And of course, Michael Bublé was on heavy rotation, his voice carried throughout the home.
“Where’s Chae?” you asked Jisoo when she came up next to you, both of you standing in front of the Christmas tree.
“Oh, you know-”
“Ah, great, you guys finally made it as well,” Chaeyoung exhaled, coming out from the kitchen, and seeing Jungkook and you among the other guests. There was a slight edge accompanying her words, and you doubted for no second that her nerves were running high from having to host tonight and needing all of this to turn out perfect. (Even if she chose this fate upon herself.) Her updo was falling apart, strands sticking out in the wrong places. Still, she looked pretty. Especially with her reindeer apron tied around her waist. She had had it since middle school, and seeing it brought back all kinds of memories. You couldn’t help but grin, Jisoo and you exchanging looks. And when your gaze met Chaeoyung’s, she knew. She rolled her eyes, shaking her head.
“Yeah, I know,” she mumbled, speaking to you too only and confusing the others in the process. Jisoo and you snickered.
“Anyway—” Chaeyoyung waved her hand around, “—I’ve got some unfortunate news. Dinner isn’t ready. I’ll need at least another thirty minutes. Hope you guys didn’t come too hungry.”
“Do you need help with anything?” Jungkook asked, already getting up from the couch. Yoongi raised his hand, silently extending the offer as well. Jennie nodded, clearly willing to get her hands dirty too.
“Yeah, anything we can do to help you?” Taehyung asked, making an effort to get up too, but Chaeyoung was quick to shake her head.
“No, I don’t need help,” she mumbled, clearing her throat. “I just wanted to inform you guys. You all would help if you guys just busied yourself and didn’t come into the kitchen.”
And before anyone could insist on their help, Chaeyoung disappeared back inside the kitchen.
“Shouldn’t we-?”
“If you wanna stay on her good side, don’t take a single step into the kitchen. Don’t even breathe in that direction, or think about helping her,” Jisoo explained, and Jungkook looked at you as if to ask if this was exaggerated at all.
“Yeah, Chae’s… very peculiar with that kind of stuff.”
“But there are so many of us. Is she really gonna do all of it on her own?” Jennie asked, but Hoseok waved her off.
“Trust me, she is and she will. Chae gets super stressed, but she also loves to host. If you don’t let her, she’ll be in a bad mood for ages. It’s better to just let her do her own thing.”
“And if it actually gets too much, she’ll come out and ask for help at one point. Trust me,” Jimin added.
“You think? I’m not so sure about that one,” Jisoo snorted and moved over to grab a handful of chocolates. Almost instinctively, she placed a hand on Jennie’s shoulder, and for a moment, you wondered if Jungkook and you ever looked this natural and comfortable with each other. If you looked as much as a couple as Jisoo and Jennie did. “When has she ever asked for help?”
“There’s no way she can do all of this on her own,” Taehyung said, frowning.
“You don’t know Chae.”
“Maybe. But it seems humanly impossible to pull off this entire thing without asking for at least some help.”
Jisoo raised her brow at Taehyung, pausing a moment. “Oh, do you wanna bet?” Her mouth pulled into a grin at the mere prospect of making some easy money. “Ten bucks?”
Hoseok and you exchanged glances over their heads. This was very much typical of Jisoo.
“Don’t bet with her, Tae. She’s a scammer,” Jimin said, pushing Jisoo’s hand away as she waited for him to shake it.
“I won’t,” Taehyung laughed, taking a sip from his beer. “You know I don’t do-”
The ear-shattering sound of a pan clashing with the kitchen tiles emerged from the kitchen, followed up with a few loud curses and an “It’s fine!”. You cringed when something else you couldn’t identify fell to the floor a second later, eliciting even more curses. Almost instinctively, you turned to Jisoo, nudging her. Because as much as she was right that it was a bad idea to go help Chaeyoung, it would actually be worse not to go in right now when everything seemed to go off the rails.
“Yeah, yeah, I know. My cue to jump in,” she grumbled, begrudgingly making her way to the kitchen, knowing already she would have to endure Chaeyoung’s snappy attitude. She squeezed Jennie’s hand in goodbye.
“See, she’s getting help,” Taehyung said to no one in particular and righteously took a sip from his beer. Jungkook applauded him sarcastically, and you were about to say something when-
“Oh, this is cute!” Seokjin gasped, coming up to you. You followed his gaze to the bauble he was admiring. It had an old picture of you and your friends on it, faces curving around the porcelain. “How old are you guys there?”
You pursed your lips. “That’s probably senior year? So like seventeen maybe? Eighteen?”
“What are you guys doing- oh my God, you guys look so young.” Namjoon hooked an arm around Seokijn’s shoulder, marvelling at your younger selves. “Look at that one!”
He pointed out one with just Jisoo, Chaeyoung and you on it. It was one of the first pictures you three had taken together. All three of you still stuck in middle school. You couldn’t decide whether to be embarrassed or nostalgic.
“Is that Ji? Her hair, oh my God!” Seokjin laughed, pointing out the blunt bob Jisoo used to rock.
“Don’t be mean!” And yet, Namjoon laughed too.
“You’re lucky Ji can’t hear you right now because she’d kill you,” you said. “But actually, you should see some of Seok’s old pictures. He looks so different-”
A hand snaked around your waist. You tensed. But you relaxed a second later when you realised who it was. You peeked over your shoulder just to check and smiled when you turned out to be right. He placed his chin on your shoulder.
“Hello,” Jungkook whispered, and you squirmed, his breath tickling your ear. He was so close to you, too close. You could practically feel his heart beating behind yours.
“Hey,” you returned, a bit breathless and pitchy. You cleared your throat.
“What are you guys doing?”
“Oh, uh, nothing really,” you mumbled, waving your hand around.
Jungkook frowned, but didn’t ask any further. “Okay, well, I wanted to get you something to drink. You think I can go into the kitchen without getting murdered?”
“Yeah, you’re fine. Ji’s there too,” you said, glancing over your shoulder to meet his gaze. He was already looking at you, eyes big and so full and a smile on his lips.
“Okay, then do you want anything in particular?”
You shook your head. “Uh, no, whatever is fine.”
“Whatever it is.”
But rather than just leave to get you said drink, Jungkook lingered, not moving away from you just yet. You raised a brow at him, making him smile. As if he could read your mind, he loosened his grip around your waist, but not before pressing a kiss to your neck.
“Getting you that drink,” he smiled, backing away.
You touched a hand to where he had kissed you, gripping, feeling hot all of a sudden. It was stupid, you were stupid.
“Jesus.”
And albeit, it was quiet and muttered under his breath, you heard it very clearly. You looked at Seokjin, eyes big as he stared back at you with a grin on his lips. There was a fondness in his eyes, a look you always saw on Jimin’s face. Namjoon wore it too.
“What?” you asked when the expression wouldn’t disappear.
“It’s just-”
He sighed and shook his head.
“What?” you repeated, but Seokjin wouldn’t continue.
“You guys are just cute,” Namjoon supplied.
“Oh, please,” you scoffed, shaking your head.
“You guys are exactly like Jin and Mina used to be,” Yoongi said, coming up next to you, having witnessed the entire exchange from his spot on the couch.
“What?” you laughed, shaking your head over and over again. “I have no idea what-”
“Don’t deny it, Y/N,” Namjoon laughed and looked at you.
“It’s gross really,” Yoongi scoffed, taking a sip from his beer. “How smitten he is for you. How happy and—” He shuddered for the drama of it all but wore a smile on his lips. “—stupidly in love you two are.”
Wait, what?
“It’s cute,” Seokjin corrected, and you stared at him with stunned silence.
“Is it though?”
“Don’t be like that, Yoongs. When have you ever seen Kook this happy before?”
The question, though not directed at you at all, made you freeze. And when you looked at Yoongi and he made no effort to disagree, you froze.
“You make him really happy,” Namjoon said with a smile and tilted his head when you didn’t speak or react at all, giving your shoulder a light squeeze. “You know that, right?”
His words hit you like a ton of bricks, crashing down on you and compressing your lungs. Because, no, you didn’t. You didn’t think about it ever, and why would you? It never seemed possible to you because it simply wasn’t possible you made Jungkook happy. You didn’t have that power over him.
Was this really how you looked like to others—two people who were in love and happy? It sounded ridiculous to you, impossible. So much so, you just had to shake your head and wave your hand around as if the words loomed in front of you and had to be physically dismissed. Your heart banged in your ribcage, loud and far too heavy.
“You guys are exaggerating!” you chuckled, voice wavering the slightest bit. “This has nothing to do with me- Finals are over and it’s Christmas, so obviously-”
A single look from them was all it took to silence you. They didn’t have to say a word for you to know what they were collectively thinking.
“Y/N, don’t be ridiculous,” Seokjin said.
“For god’s sake, just look at that boy,” Yoongi laughed, pointing behind you, and your gaze followed his hand. Right then Jungkook came back with two drinks, one for you and one for him.
He seemed surprised, stilling as he saw that you were all looking at him. But he recovered, mouth pulling into a big smile. Your eyes met his. You would have missed it if you hadn’t looked so close and paid attention to every little thing he did. But you saw it, the tiny smile he offered you, and only you. It was like a little secret. Just for you and him to know and share and see.
Did you really make him happy?
“Why are you guys staring at me like that?” Jungkook laughed, coming to a stop in front of you and handing you your drink. You took it passively, and purely from the warmth, you knew it was your favourite, green tea. “Are you guys talking shit about me?”
“Oh, yeah, you know just the usual shit talking we do about you,” Namjoon snorted.
“Mhm, the usual stuff. How you always-”
Seokjin’s voice faded away when Jungkook moved closer to you, his arm already lifting to sneak around your middle. But you couldn’t do this. Not now.
“Sorry, I gotta pee,” you mumbled, wringing out of Jungkook’s grasp, his fingers just barely brushing your skin. You didn’t know who you interrupted, but you offered them all an apologetic look but you never quite looked at Jungkook. Your exit seemed natural enough though, you thought. No one made an effort to stop you.
Some of your drink spilt over when you put it down on the coffee table too quickly, and you even almost bumped into Hoseok, but rather than apologise properly and clean up your mess, you hurried into the bathroom.
The moment the lock clicked shut behind you, you let yourself crumble, knees giving in. If only just a little.
Oh God.
It wasn’t very environmentally friendly, not very Save the Turtles! kind of behaviour of you at all as you just let the water run and run into the sink and down the drain. You didn’t even wash your hands or face, just needing something to fill the silence as you sat on the edge of the bathtub and let yourself calm down.
You felt ridiculous. You truly did. Insane and crazy even. The behaviour you were exhibiting was probably therapist worthy. The panic. For what? And why? It was behaviour you never imagined yourself exhibiting. No less because of Jeon Jungkook. But here you were, playing his pretend girlfriend for money so he could win a bet. And you got all of your friends involved even! You should have really thought this through-
“Cabbage?”
And somehow, both dread and warmth crept up with his voice. You closed your eyes, thinking for a second to shut off the tap. It seemed just a little too exhausting to do that.
“Yeah?”
“Are you good?”
“Yeah.”
It was quiet for a few seconds.
“Can I come in?”
“I’m peeing, Jeon.”
A lie. He knew. You knew.
“Fine, come in.”
When you wouldn’t move, Jungkook gave the door handle a try, surprised to see you hadn’t locked it. You had forgotten, and so he did it for you instead. The moment he saw you sitting on the edge of the bathtub with the tap carelessly running, he stopped, features folding into something nice, pleasant, empathetic.
“Stop,” you groaned, rolling your eyes and turning away from him, shutting off the tap as if that minimised how sad you had to look right now.
Jungkook chuckled, burying his hands into his pants, carefully walking towards you. He sat down next to you, knee pressed against yours. Neither of you pulled away. There was a part of you that should tell him to give you space, but you couldn’t. If anything, you turned a little to him.
“How are you always running off into the bathroom when you feel bad? It’s so obvious,” he mumbled, pinching your nose.
“Ow, stop!” you hissed, swatting his hand aside.
He gave you a look, shaking his head, and you pouted like a child would. It made him chuckle, and you tensed when Jungkook put his head on yours, too tall to lean against your shoulder comfortably, his eyes falling shut.
“What did they say?” Jungkook asked, breaking the silence after a while.
“What?”
“Joon and the others. What did they say to make you run off like that?”
You pressed your lips together, disliking that you were so easy to read.
“Who sent you?” you snorted, wanting to figure out which of your friends just earned themselves a plus point.
“No one.”
“What?” you blinked, and looked at him, but he kept his eyes closed. “So you-”
“No one sent me. I just… wanted to make sure you were fine myself.”
And hearing that was somehow utterly awful. Because it meant Jungkook cared. At least to some degree, at least enough to want to check on you. It meant that he was able to read you so easily, that he really knew you.
“Now, what did they say? You can tell me. I’ll talk to them for you. Or I won’t if you don’t want me-”
You shook your head, sighing. “Nothing. They said nothing.”
It was true. Because none of what Namjoon, Seokjin, and Yoongi said was worth running off. It wasn’t insulting, or hurtful.
“Are you sure? Seriously, you can just tell me. I’d talk to-”
“I’m serious,” you interrupted, not even wanting to hear how far Jungkook would go for you. “They said nothing. I just had to pee.” You shrugged. “And I just needed a moment to breathe. It’s nothing. I promise.”
Jungkook sat up, glancing at you with his mouth pursed and eyes narrowed. “So just a moment to breathe?”
Your hand almost came up to cup his cheek, the urge to brush over the little scar on his cheekbone tempting you. It was difficult to resist when he was looking at you like that. There was this need, to plant your lips against his. Kiss him and assure him. But you didn’t let yourself. You turned your head to the other side, curling your hand around the cool porcelain of the bathtub until the skin stretched thin over your knuckles and almost hurt. Just anything but Jungkook and his stupidly pretty face.
“Just a moment to breathe,” you mumbled.
Jungkook hummed, straightening up. He let his head hang for a few seconds before lifting it up again and turning to you.
“Is it fine if I stay with you then?”
It was a delicate question, an honest question, a devastating heartbreaking question. Because of course, he could. Of course! He could do anything, as long as he remained by your side. And that realisation, albeit not entirely new to you (you were aware of it to some degree all along), was mortifying.
You closed your eyes, a knot forming in your throat. There was nothing for you to say, a silence stretching between you. A silence Jungkook took as a “yes”, and when his hand gripped yours, it was sealed for you. You didn’t pull away, put your head on his shoulder. What would be the use of resisting? What good would it do? What would it change? Nothing.
So you enjoyed it instead, the moment between him and you. For as long as you could. For now.
“We should probably get back out,” you mumbled when you heard the laughter get louder in the living room.
“Probably.”
And yet, neither of you moved. A few more moments passed. It was the next bound of laughter that ripped you out.
“We should-”
“I think it’s time-”
You both stopped, nodding, knowing. Jungkook was first to get up, groaning like an old man before turning to you and offering you his hand. With one loud sigh, you took it, allowing him to pull you up. You shared a look and a smile.
It felt like you were walking into another world when you stepped outside, still holding hands. Before it was just Jungkook and you. Now it was everyone else too. And almost as if you had said that exact thought out loud, everyone looked at you as you walked back in. You stopped, the same way Jungkook had when he had returned and found you all staring at him. You frowned, the grin spreading on Jimin’s and Jisoo’s (When had she made it back?) faces worrying you. Jungkook seemed as clueless as you.
“What?”
No one said anything for a second.
“Can I?” Jisoo asked, pleading with everyone else, and you narrowed your eyes. She was giddy, and her being giddy was never a good sign, especially for you. Most times it meant you’d be miserable.
“Do the honours,” Jimin said, gesturing for her to ahead.
Jisoo leaned back, grinning from ear to ear. She seemed to stretch the moment thin, take her sweet time to reveal to you what exactly entertained her so much. Jennie shook her head next to her, but she wore a smile on her lips, amused.
You kept close to Jungkook, almost instinctively. As if he could protect you. His hand brushed the small of your back, soothing. Taehyung’s irritating snicker grabbed your attention for a second, but before you could frown at him for it, Jisoo spoke,
“Look up.”
Fuck. You should have figured.
“Ah,” Jungkook laughed upon seeing the mistletoe above your heads.
“You guys are funny,” you scoffed, shaking your head. “And very cute for thinking that we are gonna do-”
“You have to!” Jimin interjected, leaning forward and pointing at the two of you. “It’s the law. The rules of the game.”
You frowned, and the lines deepened even more when you saw everyone from Namjoon, Seokjin and Jennie to Taehyung, Hoseok, Yoongi and Jisoo nodding along. Of course, they found pleasure in your misery.
“It’s bad luck if you don’t,” Hoseok reminded you of the stupid rules, and you could have thrown something at him. How was no one on your side?
“That’s… made up.”
“Well, if you wanna risk the bad luck, be my guest,” Hoseok chuckled, shrugging, and you rolled your eyes.
“Oh, please, no one believes that!”
But you were met with no ounce of support from anyone. You turned to Jungkook, expecting that he was equally as ticked off as you. But he seemed perfectly fine, his features not even slightly twisted into anything resembling irritation. If anything, he was smiling a little when you met his eyes.
“I don’t know, I’m never one to tempt fate,” he said, and you couldn’t quite decide how to react. Jungkook reached for your hand again, playing with your fingers. “Why risk the bad luck? Also, it’s not like we have never kissed in front of them.” He grinned. “Remember how you jumped me and-”
“Oh my God, I didn’t jump you!” Your voice leapt up a few pitches too high and remained there when your friends began to laugh.
“Now that’s a lie. You practically threw yourself at-”
“Jeon!”
Jungkook cackled, and you could have strangled him right then and there. Your friends laughed too, and you would have snapped at them if your cheeks didn’t warm to an uncomfortable degree. To the point the blood boiled in your ears, so much so you didn’t even hear Namjoon’s holler about how it was just a kiss!
It wasn’t completely lost on you that it was stupid to be embarrassed, considering how boldly you had claimed Jungkook as yours in front of a room of strangers just a few weeks ago. Especially considering that all of your friends had a slight alcohol level going on anyway already and were most definitely moving on the second the kiss happened. But it was different. At the Halloween party, you were positively buzzed, your vision blurry and fuzzy. But more importantly, you were jealous to the point of turning green. It seemed so much more intimate to kiss Jungkook in front of everyone now. And so very vulnerable because you wanted to so much. Kiss him. You always did these days, yearned to. That desire scared you, was mortifying in more ways than you could describe, particularly in this moment because what if they could all sense it? What if Jungkook realised it all of a sudden? That you really wanted this? That your entire heart ached for him?
And as if you had the fear written all over your face, Jungkook reached for you, tugging on your elbow and turning you back to him. He gave you a smile, his head tilted to the side. A few strands slipped out of his perfectly messy hair, and a soft shadow covered half his face. Right then, he seemed all so delicate to you, so good, so precious. It was instant, your heartbeat dwindled into something calmer and wilder at the same time. Somehow, it seemed almost easy and much more difficult to kiss him and pretend it didn’t dig daggers into your heart. None of it made sense, the effect he had on you, but you supposed a lot of things hadn’t made sense in your life since Jungkook’s first appearance.
“It’s just a kiss, cabbage,” he mumbled, shrugging.
It was. It was just a kiss, to your friends, to him. It was nothing, a small price you had to pay to entertain your friends. It was fun and simple. It was just unfortunate that it was so much more to you.
You held your breath when Jungkook placed a hand on your cheek, thumb brushing over your cheekbone, gentle and soothing. He was doing everything right, and yet, you could have thrown up right then and there. Jimin gasped and squeaked as Jungkook inched closer to you, Jisoo grasping onto his arm because oh my God, they were going to kiss! All while you were desperately, almost frantically, fisting Jungkook’s shirt, as if you would float away otherwise and it was the only thing keeping you on the ground.
And Jungkook kissed you all too delicately.
To the point, you could have believed him. That you meant something to him, that he might just be in love with you. It was horrible, to be kissed like that. You weren’t sure if this was how it felt like, to be in love and to be loved. You hoped it wasn’t.
You pulled him closer to you, deepened the kiss, allowed him in. For just a while, you told yourself. Just until you found the strength in you to resist him, until you deemed your own well-being more important than these fleeting highs with Jungkook.
“Alright, dinner’s- oh.”
Chaeyoung stopped right before she could bump into you, and you quickly pulled away. But Jungkook kept holding you, not letting go of you. Chaeyoung placed her hands on her hips and shot Jimin and Jisoo a long look.
“Ah, who of you idiots did this?”
“Why do you assume it was-”
“So it was you,” Chaeyoung said, interrupting Jimin and shaking her head. “Take it off. Dinner’s ready.”
Jisoo slapped his shoulder, laughing, clearly enjoying seeing him getting reprimanded by Chaeyoung. Jimin rolled his eyes, mumbling something about how Chaeyoung was no fun but he followed her orders, getting up and reaching for the bundle above your heads. You backed away-actually you jumped. It made Jimin pause and narrow his eyes, his mouth lifting into a smile when he saw the opportunity.
“Oh, what if I hold it over you-”
“No, don’t even!” you hissed, pushing Jimin away from you and seeking refuge behind Chaeyoung.
“Oh, it’s just one more kiss, Y/N!” Jimin taunted, following you. You shrieked, moving further from him, irritated by the constant laughter spilling from his throat. He was enjoying this too much. Too much!
“Fuck off!”
“Don’t be like-”
“I’m serious, stop!”
“It’s fun-”
“Okay, no, enough,” Jungkook said, stepping in and swiftly taking the mistletoe from Jimin. He slapped him with it lightly, eliciting a gasp from Jimin. “No more chasing my girlfriend with mistletoe, okay? Or you can do your physics assignments on your own.”
Rubbing his cheek, almost convinced he was allergic to mistletoe now, Jimin gasped as if Jungkook had just declared an end to their friendship. “Kook! How could you say that?”
“Stop chasing my girlfriend then.”
“Oh my God, fine, I won’t,” Jimin groaned, pouting. “You’re so lame.”
When he reached for the mistletoe, Jungkook hesitated, looking over to you and even though you preferred him not to hold it in his hands again, you knew Jimin would get even more offended if Jungkook withheld the bundle from him. So you gave him a nod.
“Okay, alright, dinner’s getting cold,” Chaeyoung said, clapping her hands together when Jimin was back in possession of his mistletoe. “So how about we take this party into the kitchen, yeah?”
Like you had said he would, Jungkook got an earful from Chaeyoung when she noticed the expensive bottle of wine suddenly appear on the dinner table because how dare you bring something when I clearly said not to? And on top of that such an expensive bottle too. Do you shit money? Somebody needs to teach you how to manage your finances. Rather than come to his help, you left Jungkook to fend for himself which earned you puppy eyes from him, but hadn’t you told him better? Surprisingly however he managed to convince her to open the bottle anyway. You were sure she’d get him to return it, or at least take it home again. Jungkook could be very compelling. But you knew that already.
“If the teaching thing doesn’t work out—” Namjoon had his mouth stuffed as he spoke, and you caught Yoongi cringing next to him. “—I think you should become a cook, Chae.”
She smiled sheepishly, waving him off. “Oh, please. My mom’s cooking is so much better.”
“I don’t know if I believe you,” he laughed. “This is seriously so good.”
Hoseok shoved a big bite into his mouth, a drop of sauce splashing onto the table. Chaeyoung smiled and wiped it off for him. He thanked her.
“It’s the best food on Earth. I’d die for it,” Jimin sighed, a little too loud and dramatic, his mouth full with food, giving you all a glimpse into what his stomach must look like. His cheeks were tinted a slight pink, the red wine slowly flushing him through. “Like that one Gordon Ramsey meme? Where you know—” He sat up, changing his voice in a failed attempt to mimic the British celebrity chef. “—he’s like ‘Finally some good fucking food.’ or whatever. That’s how I always feel when I eat Chae.”
For a second, there was silence. Jungkook and you looked at each other with big eyes, a hint of a smile on your lips because it was obvious that Jimin hadn’t realised what he had said, blabbering on and on without a second thought.
“Maybe you should calm it on the alcohol,” Seokjin mumbled, pushing Jimin’s glass away from him. But it had the opposite effect, making him reach for it instead and down the entire contents of his glass in one quick go.
“Never!”
“You mean… her food. When you eat her food, you could cry, right?” Taehyung clarified, and Jimin looked at him with big eyes.
“Oh, yes of course! What else would I mean?” he laughed, loud and boisterous. “Chae’s all yours, Seok. Don’t worry. I’m not your competition.”
Chaeyoung almost choked on the wine, and Hoseok turned a few shades redder.
“Someone get this idiot some water,” Yoongi snorted, and Namjoon already got up.
You turned your gaze to Jisoo when she leaned into you, taking the chaos as a chance to just talk to you, her hand grabbing yours.
“How’s the scarf going by the way? Are your loops now clean?” she whispered, careful to keep her voice low. You glanced towards Jungkook, but he was busy trying to convince Jimin to drink a few sips from the water at least. And though he hadn’t heard a word, you glared at Jisoo, shaking your head.
“Not with him around,” you hissed, and she rolled her eyes.
“Oh, look at him. He’s not paying us attention. I wanna know. I’m invested now, especially because you always called me a grandma for knitting. How’s it going?” she asked, and you knew it was best to just quickly answer her because she wasn’t dropping this.
“Yeah, yeah, I got it now. It’s almost done-”
“What are you guys whispering about?” Jennie asked, leaning in, eyes wandering between Jisoo and you.
“Y/N’s knitting a scarf for her boyfriend for Christmas.”
“Ji!”
Your features couldn’t decide whether or not to contort in embarrassment or fear Jungkook had overheard this time. It’d ruin your surprise. You were in luck though because he wasn’t paying your conversation any mind.
“Oh, that’s cute!” Jennie squealed. “I only thought Ji knits. I didn’t know you knit too, Y/N.”
“I-”
“She doesn’t. She just sews a little,” Jisoo said, beating you to it. She leaned towards Jennie as if she was telling her a secret and didn’t want you to hear, but she deliberately kept eye contact with you and didn’t even lower her voice, her lips curling up. “She learned how to knit for her stupid little boyfriend. She asked me so many questions and bought so much yarn too. It was so annoying-”
You kicked Jisoo in the shin, shutting her up. She sharply sucked in her breath, hands flying to her leg, mouth agape in a silent screech.
“You’re talking too much,” you hissed, not remorseful at all even as she rubbed her shin. Jennie laughed.
“That’s really cute of you though, Y/N,” she said, smiling at you. “I like the idea. He’s gonna love it.”
“It’s just a scarf,” Jisoo mumbled, rolling her eyes, words dipping into an astonishing amount of immaturity. “It’s not that cute. I could knit you a better scarf-”
“Stop bragging. It’s different. You’ve always knit. Y/N made an effort to learn how to for Kook.”
“I’d learn how to do something new for you.”
“So do.”
“What? Like I won’t?”
You took that as your cue to exit the conversation, glancing over to Jungkook instead. He hadn’t noticed your conversation at all. In fact, he was stuffing his mouth full. Some extra sauce decorated the corner of his mouth in his haste. Without missing a beat, you wiped it off with your thumb before cleaning it on his napkin. He turned to you, eyes as big as a reindeer caught in headlights. It hit you only then as he stared at you and you stared at him, what you had done. How intimate the nature of the gesture had been. You might as well have ripped out your heart and told him to keep it. It would have been the same.
“Did… you just-”
“Oh, the wine is actually so good!” Jisoo sighed, putting down her glass, and right now you were very glad she sat next to you. “I think that’s the best wine I’ve ever had.”
Jungkook’s eyes darted between her and you. He was thinking, contemplating if he’d engage with Jisoo in a conversation, or tease you until you were just about ready to be swallowed by a hole. Maybe it was the way you wouldn’t even look in his direction and kept your gaze trained on Jisoo, or maybe because he was planning on bringing it up another time, but in the end, he decided to spare you.
“I’m happy to hear you like it,” he grinned before jabbing you in the side. You flinched, grabbing his hand before he could do it again. “See, and you said they wouldn’t taste the difference.”
“She doesn’t,” you grumbled, brows creased together.
“She’s just saying that because she knows how expensive it is,” Taehyung said, and for once you agreed. Jisoo rolled her eyes at him, mumbling something about not wanting to argue with an idiot and picking a piece of lint off of Jennie’s shoulder instead.
Jungkook shrugged. “Whatever. She likes it, so worth every penny.”
You were about to let go of his hand, feeling any kind of contact was a step too much, a step into a very wrong and dangerous direction. But Junkook interlaced his fingers with yours, holding it firm, thumb brushing over the back of your hand. For a second, you contemplated pulling away because this was too much, too close. You didn’t, not finding the strength in you to do it.
“Actually, I haven’t learned half of my mom’s cooking. She always makes this amazing pork belly stew for every Christmas. If you love this, you’ll love that,” Chaeyoung said, pulling you into their conversation that seemed to have circled back to her cooking.
“Are you gonna go back home for Christmas? Because I’ll go with you if so. That stew sounds amazing,” Yoongi said.
“Oh my God, if you are, please take me with you too because this is so good,” Jennie sighed dreamily, making Chaeyoung laugh.
“Excuse me, what about our Christmas plans?” Jisoo gasped with faux upset, and immediately Hoseok, Chaeyoung, Jimin and you exchanged glances.
Moving fast, Hoseok mouthed and you nodded. You had no idea. At the same time, it seemed to work for them.
“Oh, can’t we just drop by for dinner really quickly for some food?” Jennie tried, pursing her lips into a pout, but Jisoo just clicked her tongue and shook her head.
“Good food is all it takes, huh?”
Jennie laughed.
“Is everyone going home for Christmas?” Namjoon asked, wiping his mouth before grabbing his glass of wine, holding it up to his lips, speaking into it. “I know Kook is for sure.”
Jungkook nodded. “Got me there.”
And even without looking at him, you knew he was smiling and more than excited to go back home. He squeezed your hand, and you could tell he did so unconsciously. You squeezed back, happy for him that he was happy.
“Oh, right, I’ve been meaning to ask!” Jimin gasped, turning rather dramatically towards you. You blinked, unsure of what was about to spill from his lips.
“Is it true that you’re going back home with Kook, Y/N?”
What?
Everyone turned to you, Chaeyoung raising her brow at you because were you? You stared back at her, mouth opened and closing because no, right? You weren’t, or were you? Your eyes lifted to Jungkook, and he had that same look on his face. Neither of you knew what to say or do. This wasn’t something you had discussed. And why would you have? It’d be ridiculous to assume that you’d be going back home with Jungkook to meet his parents for Christmas.
“Uh-?”
“I’m just asking because Kook’s parents have been asking me if I knew if he’s actually gonna bring you,” Jimin continued, shrugging. And maybe you would have focused on how much you wanted to strangle him right now and needed him to shut up if your mind wasn’t reeling from the fact that Jungkook seemed to have not only told his parents about your existence but also that you would be spending Christmas with them.
What?
“Okay, yeah, no, wait,” Jungkook interjected, a clear panic in his voice, turning fully to you. “I can explain.”
You blankly stared at him, unable to even make a single sound. He dug a hand through his hair, looking even more panicked the longer you said nothing.
“So, uh, my brother saw my posts and stories online and might have told my parents… that I’m dating you. And so they’ve been really curious and asking about you a lot, and it was a little annoying, so I just told them that I might bring you around for Christmas to shut them up. But—” He held out his hand as if to get ahead of you saying anything. “—I didn’t promise them anything. I just said it to get them off my back, you know?”
You continued staring at him, unsure of how to react or what to say because well, you hadn’t thought that either of your parents were ever going to get involved in any shape or form. You hadn’t even played with the idea of telling your parents. And why would you? All of this was fake! A ruse, so Jungkook could win his stupid bet!
“It wasn’t planned, or anything, okay? I wasn’t going to tell them about you-”
“You weren’t?” Jimin blurted out, brows pinching together. He seemed to have lost all ability to read the room, just a glass or two of wine enough to dull his brain. “Ow-!”
He glared at Taehyung, rubbing his arm. It still wasn’t enough to shut him up however.
“What was that for? I’m just saying I’m a little surprised that Jungkook, the definition of a mama’s and papa’s boy, was planning on keeping his girlfriend a secret when he hasn’t shut up about Y/N for months-”
“No, wait it’s not like that,” Jungkook quickly scrambled, gesturing wildly. “It’s just that my parents, you know, can get a little much. And, I don’t know-”
His sentence didn’t find an end, and Jimin seemed to just take that as a sign to go on,
“Didn’t Narae meet-”
“Okay, how about you finish your food, huh?” Taehyung interrupted, taking Jimin’s fork and picking up a big piece of meat before shoving it into his mouth. Namjoon and Seokjin exchanged glances, cringing. Yoongi lowered his head, and Jennie slid down on her seat. Chaeyoung looked at you with big empathetic eyes and Jisoo even gave your hand a squeeze.
If there was anything genuine between you, this would have been devastating. Luckily, there wasn’t. So it couldn’t hurt. And yet, your heart felt like it was bleeding in your chest, a dagger shoved in, a dagger with Jungkook’s name. He was staring holes into you, but you couldn’t look at him, settling on the edge of the table instead. You weren’t hurt. You weren’t hurt that Narae with her perfect smile and manicured nails and beautiful hair and glossy lips got to meet his parents and you didn’t. It didn’t bother you at all! That was what you told yourself at least. Because you couldn’t possibly be hurt. Not when your relationship was transactional and just an act. And yet, to your misery, you were hurt, deeply. You hated it, how you weren’t all that unbothered as you wanted and more importantly, should be.
You were pulled out of your thoughts though when you saw the glare Hoseok was looking at Jungkook with. It dawned on you how awful all of it had to sound to your friends then. Narae, who never even was Jungkook’s official girlfriend, got to meet his parents, but you, who was officially (at least to them) his girlfriend, he not only didn’t want to introduce to them but also planned on keeping a secret?
“Oh my God, you guys!” you laughed, loud and light, like it was all so very dumb and stupid. With a big swoop, you grabbed Jungkook’s hand on the table, hoping no one saw the shake in your fingers. Everyone looked at you.
“You’re misunderstanding. We had agreed from the beginning that we should take it a little slower, and not tell everyone immediately. I knew he wasn’t going to tell his parents. I told him not to.” You put on your most convincing smile, swallowing the knot in your throat, hoping desperately it was enough. Everyone was looking at you, and you looked right back at them, at everyone except for Jungkook. Your vision almost blurred, hazy at the edges, feeling your composure threaten to slip.
“It’s nothing.”
There was a slight shake in your voice, the tiniest of a waver. You couldn’t tell if your friends noticed, their faces unreadable to you. A moment of silence stretched across the room, the food long forgotten about. In the end, it was slightly tipsy Jimin, the one who started it all, to break the awkwardness.
“Okay, well, do I text them… yes or-?”
You wondered if Jimin was this stupid, or trying to put you through hell on purpose. His question made Taehyung next to him sigh and shake his head, lips pressed together as he stared daggers into the older one.
“What?” Jimin whispered, offended. Maybe you should have taken the wine from him sooner.
You looked at Jungkook finally. He didn’t seem to have an answer at all, his eyes big and wide like a child’s. There was something in them that you couldn’t quite pinpoint. It almost seemed like he wanted you to agree, say yes, of course, you’d meet his parents. You had to be imagining it. As quickly as it had come, you squashed the thought.
It was up to you. The decision was in your hands. Everyone was waiting for your answer. Jungkook would have to go with whatever you were saying, whether or not he liked it.
A lot of it was probably spite, spite that Narae met them already and you hadn’t. And how would it look if you weren’t there when Jungkook inevitably made a post about being back home with his family and you weren’t there in the pictures? What would Narae think? You could already see a backhanded Instagram story in front of your eyes, how there was trouble in paradise. It was something you wouldn’t put past her at all, seeing as she had done so before, posting just an hour after Jungkook celebrated your one month anniversary about how cringe some couples could be. Anyone doubting your relationship might just lead to Taehyung doubting your relationship and then to Jungkook losing his bet and all of this would have been for nothing. That couldn’t happen, right? You had to do something against it!
“They probably won’t stop bothering you until you tell them yes, right?”
You tried your hardest to sound casual, nonchalant, chill as some might say. This was no big deal, you told yourself.
It wasn’t what Jungkook had expected. He thought you’d give some roundabout answer that in the end summarised that you needed to keep things slow and easy. But you agreed. You were going to meet his parents. He searched for something in your features, anything to tell him how you genuinely felt about it. He was trying to read you, but it was like he had the wrong dictionary.
“If that’s alright with you-” Maybe it was to hit the nail on the head, finish it off, you couldn’t say. But the urge was strong right then, just once to say it. “—babe?”
You turned to him and looked at him almost confidently. It was both your face and the pet name, but Jungkook couldn’t help but laugh. Of course, now you were going to call him babe. A grin spread across his lips.
“Okay, yeah.” He held your hand firmer and tighter. “I’d be more than happy for you to meet my parents. They’d be thrilled.”
He was a great liar. It sounded oh so very genuine.
You squeezed his hand and turned to Jimin. “I guess you can text them I’m going.”
“I think that was it,” Jungkook said, handing you the last few dirty plates.
“Alright,” you hummed, moving around some of the dishes to make some more space in the dishwasher.
“Oh,” Chaeyoung exclaimed in surprise upon seeing Jungkook standing there with you, “you can head out first. I’ll help Y/N.”
She wore a smile on her lips, but you knew better.
“It’s fine. I’ll just help-”
“No, really, get out,” Chaeyoung interrupted, slipping just the slightest bit and you gave Jungkook a look, almost reaching out for his hand and giving it a squeeze. She was curt, too curt. It surprised him, clearly. “I’m the host. I’ll clean up. Join the others in the living room.”
You offered him a nod, and with that Jungkook slipped out, receiving a more genuine smile and a quiet thank you from Chaeyoung on the way out because she knew he was more than confused by her just now. Before he even had the chance to turn to ask whether or not he should close the door, she did herself. You knew to prepare yourself, putting the stack of dishes aside. She folded her arms in front of her stomach.
This was an interrogation.
In another world (read: in a detective TV show), there’d be a metal table between you and you’d be handcuffed to it. A clock would decorate the blank walls, ticking away in the background, and the air would be chilly and humid, stifling almost. Chaeyoung would dramatically slide pictures across to you, and they would be incriminating ones, blurry but clearly depicting you in the middle of whatever crime you were accused of. She would point at them and tell you how you had one chance to tell her the truth.
“How are you?”
Just the question almost made you laugh. It was heartwarming. You knew exactly what she was trying to get out of you—if it hurt you at all that Narae had met Jungkook’s parents and he had seemingly wanted to keep you a secret. You dried your hands on the kitchen towel.
“I’m fine, thanks. How are you-”
“Are you lying?”
She took this very seriously, her face not even holding a hint of a smile. Again, in another world she’d stare you down, gaze cold and unwavering, and ask if you wanted to try again.
“Do I look like I am lying?”
You were lying about all of it, about most things concerning Jungkook and you these days. But you couldn’t say that. You couldn’t admit that the entire conversation during dinner hurt you to the degree it did, to a degree you would rather not admit, that it hurt at all to begin with. Because being hurt implied you had some sort of right to be, implied Jungkook owed you… something. And that was just not true.
Chaeyoung paused, sizing you up. It was hard to figure out what conclusion she came to, her eyes narrowed and sharp. She opened her mouth, but right then, someone announced themselves with a knock on the door. Without waiting, they poked their head in, and it could realistically only be one person.
“What did she say?” Jisoo asked.
Were you air today?
“Says she’s fine,” Chaeyoung said, wrinkling her nose.
“You don’t believe her?” Jisoo slipped inside and slowly closed the door, making sure beforehand though that no one was in earshot. Chaeyoung scrutinised you for another moment before coming to her conclusion with a long sigh.
“No, I do.” She paused before looking at you. “You know I’d- we’d rip him into pieces for you, right?”
You had no doubt for a second they would. Actually, all of your friends would, but Chaeyoung and Jisoo would be the first ones to throw a punch.
“I do, and I love you guys for it,” you say, smiling genuinely because God, you did love your friends so much. “But you don’t have to because I’m fine. And like I said, we had talked about it. You know how I am. Parents aren’t my thing.”
“Well, for that you just agreed to go meet them,” Jisoo mumbled, scrunching her nose, and you swallowed. Maybe it was hearing it from someone else, or maybe it was because you were no longer sitting around the dinner table with everyone expectedly staring at you and awaiting for an explanation, but it finally hit you. What exactly you had agreed to. Once your mind wasn’t clouded with the thought of Narae, you realised that oh my God, you were meeting Jungkook’s parents.
It was funny how quickly things could change. How just a few minutes ago, you didn’t worry about it at all, only thinking of Narae and her stupid perfect grin and the fact she had met them, and now you were worried because what would they say about you? Would they like you? What if they were like Jaehwa’s parents and-
“Now, don’t make that face,” Chaeyoung interrupted, putting a hand on your shoulder, noticing your spiral. “They’re gonna like you.”
“Yeah, you don’t have anything to worry about at all, Y/N,” Jisoo reassured. “If anything, they should be on their best behaviour. Because if not…”
And like the amazing friend she was, Jisoo started punching the air, showing you her swift moves that she would put on Jungkook’s parents.
“Can’t you see? They say one wrong thing, and it’d be over for them. Ji would do these weird punches and knock them right out,” Chaeyoung said. “It’s gonna be fine. Has to.”
“Also, with the way Jungkook acts with you, let’s be honest he’s head over heels for you,” Jisoo argued, putting an arm around you. “I can see him standing up for you.”
“Yeah, I hate to give a man any credit, but he would.”
“And again, if he doesn’t…” Jisoo didn’t finish her sentence, instead showing you her oh so brilliant and not wobbly but actually super fatal kick.
They both turned to you, and you slowly nodded. Maybe they were right. You didn’t necessarily think Jungkook would stand up for you, not because you didn’t believe he would but because you didn’t even let yourself go there. If you did, if you assumed he would do something like that for you, you’d be having expectations for him and you had no right to. But you knew that Chaeyoung and Jisoo would be there for you, and it was a comforting thought. That was enough. Your friends were enough. And maybe, you just liked to believe them too—that it would all somehow turn out just fine.
“Yeah, I guess,” you mumbled.
“It’s gonna be fine!” Chaeyoung repeated, squeezing your shoulder.
Before you could dwell on it any further, a knock on the kitchen door interrupted you.
“Yeah?” Jisoo said, and a moment later, Hoseok stuck his head in, offering an apologetic smile because he obviously knew what was going on in here.
“Sorry to interrupt, but Jimin asked for you, Chae,” he said, sounding unsure. He clearly hadn’t gotten a reason as to why he was supposed to call for Chaeyoung. She frowned and seemed less than willing to go, but you saw this as a great opportunity to put an end to this conversation and move on. Ignoring the fact you were going to meet Jungkook’s parents wasn’t going to solve the issue, but right now your brain felt mushy and drained. Too much of today’s focus had been on you, you couldn’t do it any longer.
“Let’s just all go,” you said. “We’ve been here for too long anyway.”
Jisoo agreed, mumbling something about how she couldn’t leave Jennie alone with all of the guys outside any longer, not in good conscience at least. She helped you put the last few plates into the dishwasher, and hooked her arm with yours as you made your way back into the living room, her head resting on your shoulder.
“Did he say what he wanted?” Chaeyoung asked Hoseok, the two walking behind you.
“Probably something stupid.”
And indeed it was.
Because the moment Jisoo and you had made it past the doorstep, Jimin jumped up and pointed at Chaeyoung and Hoseok. The two froze, all eyes on them, and when you turned to look, you found them in the same fate as Jungkook and you had been in earlier.
“Oh, Jimin,” you chuckled, shaking your head. He beamed with pride, chest out and a grin bigger than his entire face.
“We aren’t-” Chaeyoung couldn’t even finish her sentence, sputtering for words. “No! This is… stupid!”
“You have to. Otherwise, it’s bad luck,” Jungkook grinned. “That’s what you said, right, Seok?”
Hoseok looked positively ready to strangle him, but you couldn’t have been prouder of him right now. Even though Jimin was the one to orchestrate this, it felt like sweet revenge to get back at Hoseok. And really, you were helping him and Chaeyoung. Maybe today was the day finally something would happen.
“Seok and I aren’t- we aren’t-”
“It’s just a kiss!” Seokjin said, and you nodded. Because as much as you felt for them, having been in their position, you knew Chaeyoung wouldn’t have come to your rescue. She might have disapproved, but she would have definitely enjoyed the show and let it go on until you kissed.
“Just do a quick peck,” Taehyung suggested, pressing a kiss to Yoongi’s cheek to demonstrate. The older one wiped his cheek and shook his head, but there was clear amusement tugging on the corners of his mouth too. You laughed at the absurdity of it all, especially when you caught the embarrassed looks on Chaeyoung’s and Hoseok’s faces.
“Also if you hadn’t walked in together like I had predicted you obviously would, you wouldn’t be in this situation,” Jimin said, and Hoseok let out a noise that could only be described as a weak and mangled attempt at faux upset. “You guys are so clearly in love with each other anyway, just kiss!”
“Oh my God,” Chaeyoung let out a scoff, but it sounded pitchy and panicked, “seriously? H-how many times do we have to tell you guys that we are just really good friends? Just like Jimin and Y/N!”
“Don’t be ridiculous here, Chae,” you laughed. “Jimin and I are just friends, but you two? Oh, please.”
“There was an attempt, huh?”
Chaeyoung glared at Jisoo, her cheeks gaining a deeper shade of red with every passing second. In a last ditch attempt, she turned to Hoseok, hoping for some backup from him.
“Tell them-”
This time when her sentence got lodged in her throat, it was for a very different reason. Because Hoseok was looking at her like he was ready to risk it all in front of everybody. Like he was ready to just say it, do something. And Chaeyoung knew, freezing to a statue.
Jisoo and you looked at each other, gasping. Her nails dug into your arm and you held onto her just as strongly. Your breath hitched in your throat as Hoseok placed a hand on Chaeyoung’s cheek, pausing and hesitating for a moment, as if he waited for her to reject him before ultimately kissing her. And instantly, she pulled him closer.
It was like a scene out of every 2000s romantic comedy, the finale of the third act, what you had all been waiting up to. It was a scene to swoon and die for.
A sense of joy you had rarely felt overtook you, a rush. You began shaking Jisoo, mouth split into a grin. As much as you had wanted and actually still wanted to strangle Jimin tonight for bringing that stupid mistletoe, you were just about ready to kiss him (platonically and only figuratively of course).
“See!” Jimin laughed, pointing at Hoseok and Chaeyoung, both of them flushed red to the tips of their ears. But they were smiling too. This had been good.
“I can’t believe that this is how you guys get together,” Jisoo laughed, Chaeyoung and Hoseok looking at each other, his arm wrapped around her middle. They laughed, shrugging.
Jimin proudly pointed at himself, beaming brighter than a Christmas tree. “All my doing.”
“Shut up,” Yoongi laughed, trying and failing to kick him in the knee. And though his attempt wasn’t successful, it earned him a thank you! from Chaeyoung. Jimin looked over to Namjoon for some kind of help, but he simply shrugged. He scoffed when he saw Seokjin squeeze Yoongi’s shoulder, mumbling something about how he was just jealous.
“I mean… neither did I,” Hoseok chuckled, seeming still completely out of it, unbelieving.
“Thought about it a lot, huh?” Taehyung asked, grinning, and for a moment, you could see Hoseok struggling to answer, decide whether or not he wanted to admit the blatant truth, confess that he’d been imagining this more times than he should have. In the end, he cared less about saving face and looking cool, and much more about who he had his arm wrapped around, finally.
“Yeah, always.”
And just like that, Chaeyoung pulled him down for another kiss. The sight warmed Jisoo’s heart because she turned to Jennie, reaching out for her. With a slight tug, she was at Jennie’s side. You laughed, shaking your head, just to catch Jungkook looking at you. For a moment, you didn’t quite know what to do even though you weren’t the one caught staring. The same couldn’t be said about Jungkook. He didn’t seem to care at all, eyes not holding an ounce of uncertainty. It was obvious that he was much more confident and comfortable with being seen by you. Something you still weren’t at this point, not entirely at least, not right in this very moment, or… actually ever.
Jungkook didn’t say anything as he stretched his hand out. You hesitated, if just for a second. Because maybe you shouldn’t. Not when your heart was beating the way it was. And yet, you did take it, did let him pull you close and hold you and press his lips to the top of your head.
“You don’t have to meet them if you don’t want to.”
He whispered it, spoke in a soft and warm voice. His words floated to your ears, and you knew. You didn’t have to do anything ever actually. Not for him at least. He expected nothing from you. You closed your eyes, and listened to his heartbeat in his chest. Strong and firm. It was the opposite of yours. Yours was a mess, thumping and skipping beats.
“I will.”
Jungkook smiled as bright as the sun, pressing another kiss to your head. You could feel the excitement rushing through his fingertips, his arm tightening around you. You didn’t know the reason for it, his excitement. It didn’t make sense why he would be, you weren’t his girlfriend after all. You refused to think about it, preferring the bliss of ignorance.
God, you loved him so much. You did. You loved Jungkook to an indescribable amount. And God, was it time to stop all of this.
The video had been playing for less than twenty seconds when the call came in, your phone lighting up beside you. You paused your laptop, his name taking up your entire phone screen. And though Jungkook and you had begun calling each other more frequently now, spending at least once a week on the phone together, you were confused when you glanced at the time. But you accepted the call, sliding your thumb over the glass. Some ruffling met your ears before finally, he came through.
“Hi.”
For some reason, there was a smile on your lips.
“What do you want?” you laughed, glancing at the time in the upper left corner of your phone. 01:24. “It’s late. Why aren’t you sleeping?”
“Could say the same about you,” Jungkook argued, and you rolled your eyes, scoffing slightly, already sensing where this was going. You leaned back into your couch, looking at the ceiling with renewed interest.
“I’m not tired.”
“Neither am I.”
“I don’t believe you.”
“Then neither do I.”
“Well, you had a full day of classes today, so you must be at least a little tired,” you shot back, and a beat of silence passed. For a moment, it seemed like you came out victorious.
“You know my schedule?”
The question hung in front of you, and you were glad that this was just a call. Because you could see it, his stupid face. The proud smile on his lips, the grin that adorned it. He would inch closer to you, push you to answer, and you would cave and crumble terribly.
“... no.”
And Jungkook began laughing almost immediately, his voice booming through your phone. You cringed, biting your tongue.
“I’m going to hang up.”
“No, no, no, don’t,” he said, still laughing however. “I’m sorry.”
His apology didn’t sound an ounce sincere, but you were never going to actually hang up. A comfortable silence passed, and you could have stayed on the phone forever.
“Oh, have you watched the newest video I sent you yet?”
“You mean the two hour long video essay about the phenomenal music scoring of Avatar?” you hummed, glancing over to your laptop to see the screen dark already. “Yeah, I was about to watch it when you called.”
Somehow, you could hear his smile forming on his lips. “You should watch it.”
“Yeah, I will,” you said, sighing and rolling your eyes.
There was silence for another few seconds.
“What are you doing?” Jungkook asked, and you could tell he was genuinely curious. You blinked, having completely forgotten what you had been up to until he called. You looked at the ball of yarn sitting in your lap, your attempt at a scarf hanging between the two knitting needles. But you couldn’t tell him, it would ruin the surprise.
And so, you returned the question instead. “What are you doing?”
“I asked you first.”
“I asked you second.”
Jungkook sighed. “You’re very fun to talk to sometimes, you know?”
You laughed, not missing the irony in his voice. “Thanks. You are too.”
“Just tell me,” he said, and you frowned at his poor attempt to get you to talk.
“Why don’t you tell me first?”
He let out a small scoff, and you could picture his face perfectly. The way his tongue would be digging into his cheek and his eyes rolling back because God, you were frustrating sometimes! But there would be an undeniable smile on his lips. There always was.
“Alright,” Jungkook said, and you raised your brows. “I’m outside.”
You frowned. “Where are you going? At this hour?”
“Why don’t you guess?”
“Just tell me.”
He paused, hesitated. Somehow, you could hear his grin turn bigger.
“How about you look outside and see for yourself instead?”
Your heart sank in your chest, something strange taking hold of you. You moved without a thought, almost knocking over one of your pothos sitting on your window sill when you pulled the curtain aside. The glass was cool to touch, but you pressed your entire hand against it, just to feel something steady. Because right now, you felt the opposite of it, heart jumping to your throat and beating there like it was bound to fall out. Because there was no way that he was here right now! This wasn’t a cheesy romcom! But you also knew that he wouldn’t lie to you.
And he didn’t.
There he was, standing on the sidewalk, in front of your building, phone pressed to his ear, head in his neck, mouth in a grin and waving up to you.
You opened and closed your mouth several times, scoffing in the end and shaking your head.
“You’re so… stupid, Jeon.”
Jungkook laughed, “Well, that’s been established before.”
“You’re such a ridiculous stupid little man, Jeon!” you went on, pressing a hand to your forehead and squeezing your eyes closed for a moment. “What are you doing here?”
“Oh, is it a crime now to drop by your girlfriend’s home when you miss her?”
The words rolled off his tongue with a certain confidence and ease. Two things you rarely ever had, even less around Jungkook. It always seemed so very fragile and dangerous, to be so open and vulnerable. You couldn’t snap back, tell him how ridiculous he was because you had just seen each other two days ago at the Christmas party. Hell, you had been spending almost every day with each other—either on the phone or in person driving to Seo’s bakery to pick up your needed batch of cookies or watching Avatar until you both could recite every line. And yet here he was, telling you that he missed you, so much so that he needed to see you in the middle of the night, at 1:42.
Right then, it became blatantly obvious to you—that Jungkook and you had crudely blown the lines you had established beforehand, agreed to contractually, into absolute smithereens, that you two had made new ones, dangerous ones, ones that resembled an actual relationship, and that, even worse, you had not only never talked about it but gotten used to the new rules, comfortable.
And even with that realisation lingering in your mind with big glaring bright red flags hissed high above and every possible alarm blaring in the air, you couldn’t bring yourself to tell Jungkook that this was wrong, that he should go home. You should, it would spare your sanity. But your heart had only grown bigger and fonder of him. And it was horrible because you knew even more time with him, alone, in your own four walls, was the worst thing you could do. There would be nowhere for you to go, run off to. But you couldn’t send him home. Because really, you didn’t want to. Because it did excite you. That he was here. That he had gotten up, changed, and made his way to you. That the cold hadn’t even been enough to stop him.
“Now, open up. It’s freezing. My hands and feet are already blue,” he told you, adding a dramatic shiver to his words.
You paused, frowned, searched and didn’t see it anywhere. It clicked with you. You hadn’t heard the engine or turn signal during the entirety of your call.
“Did you- did you walk here? Why didn’t you take your car?”
“Felt like it.”
“You’re so stupid, oh my God,” you groaned, rolling your eyes as you repeatedly pressed the buzzer to open the front door for him. “Never ever do that again. It’s freezing outside!”
Jungkook responded with a laugh. It echoed on the walls of your empty lobby, reverberating through the phone. “Alright, I won’t. I promise.”
“Also, shouldn’t you be writing that stupid paper about Newton or Einstein or whatever?”
“It’s not about either of them, but I still have a bit of time until the deadline,” he explained, and you heard him walk up the stairs. “Thanks for remembering though.”
You pressed your lips together. “What if I was sleeping?”
“But you aren’t.” He sounded so incredibly smug and proud. You could have punched him. “Also, I know you, cabbage. You’d rather die than go to bed at a reasonable time.”
And somehow, that admission embarrassed you. It did. Terribly. Because he did, he did know you oh so well.
You left the front door ajar for him, waiting there with your hands folded in front of you, fingers picking on each other, as you listened to his steps grow closer and louder. His hand was the first thing you saw, reaching and touching the doorknob, and then it was suddenly just all of him. In front of you. He smiled at your sight, and you knew you looked more embarrassed and unsure than ever before. You were relieved you still hadn’t changed the lightbulb that had burned through all those months ago, allowing the dark to obscure you from him, a soft shadow across your face.
Jungkook shrugged off his coat, hanging it on the hook behind the front door and revealing his maroon knit sweater and black pants to you. When he looked at you again, his gaze softened.
“Hi, cabbage.” His cheeks and nose were brutally red from the wind, but he seemed as happy as ever. “I made you something.”
You noticed the metal lunchbox in his hands only when he pushed it towards you, and when you took it, it was still warm. Like whatever he had prepared, he had packed up the minute it was done and came straight to you.
“What did you make?” you asked, and you knew he wouldn’t tell you, waiting for you to open the lunchbox instead and discover for yourself. You peeled open the lid just a little, revealing a small corner when the smell hit you. Your eyes shot to Jungkook, and he looked both sheepish and proud.
“You didn’t.”
A gasp, your features melting. He wrinkled his nose, turned his head to the side.
“I was gonna go get some from Seo’s Bakery, but they- did you know they’re on Christmas break?”
You nodded, eyes unable to take off of him, blabbering, “Yeah, of course. They always are. Every Christmas. Have always been.”
Jungkook made a gesture towards you, shrugging. “Well, so I thought- I don’t know. I’d make you some instead. You gotta fuel your addiction somehow, right?”
There was no denying how many sweet gestures Jungkook had made ever since you’d been doing this (whatever one might classify this as). The amount of flowers and cookies he’d showered you with. The amount of smiles and laughs he’d pulled from you. The amount of love he’d shown you, even if it wasn’t real.
You put the lunchbox aside, needing to return the gesture at least once. Leaning over your couch, you grabbed the half-finished scarf you’d made for him. You wanted to show him, reciprocate some of the affection and love. But in your haste, you forgot the ball of yarn the scarf was connected to.
“Oh, fuck.”
Like a roll of paper, it unfurled, and though it would be annoying to roll it all up again, you shoved the scarf into Jungkook’s face, uncaring.
“It’s not finished- or particularly well done. But- I made that… for you,” you hesitated, a lump lodged in your throat. “I also just chose a random colour- if you don’t like red, I could definitely change it, you know. It’s not even done-”
He took it from your hands, silencing you. Your brows knit together as you watched him admire the intricate and detailed rows of red yarn. And then, he wrapped it around his neck even though the scarf was still attached to the ball of yarn and the knitting needles were poking into his neck.
“Wait, no,” you laughed, already reaching to take it off. “You don’t have to wear it or anything- Like I said, it’s not even done. I still have to-”
Jungkook took hold of your hands. Your eyes met his. He smiled at you.
“You’re so cute, cabbage,” he told you, his gaze so full and soft. And you melted right then and there, your face lit up like a fire. Melted even more so when Jungkook kissed you and pressed his forehead against yours. “I love it, cabbage. Thank you so much.”
“Really?” you said it softly, delicately, anxiously.
As if it was a proper way of responding, Jungkook took your hand and placed it on his chest. You could feel it then, under your palm and fingertips, through the fabric of his sweater, his heart.
“Really.”
And you let yourself believe him a little.
You don’t know how. It was blurry to you, all of it, but somehow, his head ended up in your lap with your fingers threading through his hair and your back pressed to the side of your bed. You both shared the batch of cookies while you finished a few more rows for the scarf before ultimately calling it, putting it to the side, promising him you’d finish it as soon as possible. Instead, a bottle of supermarket wine found its way into your hands, the glasses always filled with the red liquid. Neither of you said much. And really, there simply wasn’t a need to, the minutes ticking by as the night went on and on. An intimacy lay between you, an intimacy most would never know, an intimacy that could only come from the strange nature of your relationship.
“What?” you said, almost laughing, sure you had to have misheard him.
“I’m serious. I really like it here,” Jungkook repeated. “I like your home, a lot.”
Your mouth opened and closed before you shook your head and laughed. “But why?”
To you, there wasn’t much to like about your home here. If anything there was more to dislike than like. It was too cramped, too small. The furniture was old and shabby and the lights didn’t even work properly. On bad days, it would get either unbearably freezing or hot in here. And on particularly bad days where your luck had run out, the water would run cold and the electricity cut out. There wasn’t much to love here, except for your big bed and pothos you had on your window sill.
“I feel like I get to see another side of you,” Jungkook told you, shrugging and wrinkling his nose. “You seem much more relaxed at home.”
You frowned. “Where else should I be relaxed if not at home?”
He rolled his eyes at your comment, shaking his head. “No, I just mean… you don’t seem on guard at home.”
“I’m on guard?”
There was a pause. He looked at you for a long time, eyes wandering across your entire face.
“Yeah, sometimes.” He wrinkled his forehead a little. “I think you used to be more on guard, or at least you were around me.” There was another pause, another beat, another moment of suspense. “Wouldn’t you say you’ve opened up to me more since you let me in here for the first time?”
The question stumped you. Because did everything really change then? You couldn’t say. To a certain degree, Jungkook was right. Things had drastically shifted between him and you. Before you would have never been in this position—on the floor together, in your home, his head in your lap and your hands combing through his hair as you shared cookies and wine. But before you would have talked about it, established rules and laws and all kinds of conditions, and gone through every possibility. Now though, the two of you had gotten awfully comfortable with just simply not.
“Why? Because I slept with you?” you quipped, knowing already even in your slightly tipsy state that it wasn’t that.
“You know that’s not what I mean,” he said, sighing. You wrinkled your nose and looked to the ceiling for a few moments, leaning your head back.
“Should I be on guard?”
“Around me?” Jungkook said, shaking his head. “No, never. I’m an honest boy.”
You laughed, even more so when you looked at him and he was grinning proudly into your face, standing by his cheesy words. “You make me want to kick you out.”
“Please don’t,” he said, offering you puppy eyes and snuggling even closer to you. “I wouldn’t know what to do if you did.”
He winced when you tugged on his hair, slightly away from you. “You’re annoying.”
Jungkook laughed, and you went back to silence for a while.
“Are you ever going to tell me what Joon and the others said to you that made you run into the bathroom the other day?”
It was probably the alcohol, all the time you had spent together, sitting there on the cold floor. Your mind wasn’t the clearest anymore, and neither was his.
“They just told me how whipped you are for me. How deeply and madly you’re in love with me,” you snorted, teasingly inching closer to his face with each word before pulling away.
He smiled a little, clearly expecting worse. “Really? They said that?”
“I know.” You took two big sips, downing more than half of what was in the glass, not wanting to lose that fuzzy feeling in your veins. “It’s funny, right?”
You snorted, knowing exactly what he was thinking—That was ridiculous!
“But true.”
Jungkook didn’t hesitate. But he said it softly. So softly in fact you looked at him to check that you hadn’t made it up. When his mouth widened into a grin, you scoffed.
“Oh, shut up.”
“It’s true. I do. I am.”
It sounded so very ironic to your ears. You shook your head and scoffed. “Is that what you told Narae too?”
Her mention from your lips surprised Jungkook, his eyes growing a little wider. You were equally as taken aback. But it was true. Because you did think about it sometimes if he did and said the same things to Narae. If everything you experienced with him had been experienced before, just with someone else, someone with a perfect smile and perfect parents.
“You don’t know me at all, Y/N,” Jungkook mumbled, and it sounded accusatory.
Your heart dropped in your chest. It felt like you were shot, the hurt instant. You looked away, teeth sinking into your tongue. But he wasn’t off. You didn’t know Jungkook very well. Why should you though? Not like he and you were anything meaningful, like you shared anything truthful. And it was so very embarrassing, so very embarrassing that you felt hurt at all.
Jungkook seemed to surprise himself with his words, seemed not to mean it like that because he was scrambling the very next second, lifting up from your lap and pleading for you to look his way.
“No, no, no, I-I don’t mean it like that,” he said, voice a little higher than usual, reaching for your hand, squeezing. There’s a desperation in his voice, a panic swinging with it that he might have just ruined a perfectly fine conversation.
“You just seem to,” he hesitated, “have this very weird and funny idea of me in your head. I-I never told Narae anything like that. You’re the first one.”
You looked at him. There was a deep crease between his brows, and he went on when you wouldn’t say anything.
“You’re the only one who’s ever made me do these weird things, you know?” He added a chuckle, but there wasn’t much humour to it at all. You tried to smile for him, feeling this conversation was taking a rather serious turn. It was in dire need of some lightness.
“I make you do weird things?” you mumbled, slightly shaking your head, looking away. “I don’t think I’m capable of that.”
“Do you really think I’d try to bake cookies for anyone else in the middle of the night? Or walk to their home at night, not knowing if they’re even actually home because I wanted to surprise them? Or send every Avatar video essay I come across? Do you really think I’d want to dress up with anyone else in a couple’s costume than you?”
You couldn’t find the right response then, your lips pressing together. It was difficult for you to say whether or not you believed him. Because you didn’t think you did, not genuinely at least, not deep down. You never really did with Jungkook, believe him. Because you never let yourself go there, not fully. In the back of your mind, you knew that this was ending, only started because of a stupid little meaningless bet, that your relationship whichever form it had morphed to had no real genuine basis.
“Do you really think I’d tell anyone else I-”
You shoved a cookie into his mouth, silencing him. Your gaze turned sideways, it was easier to speak for you then. If you looked at Jungkook, you wouldn’t be able to say anything.
“Alright, I got it, Jeon. Now, eat your cookie and shut up,” you chuckled, and your words were accompanied with a lightness, a lightness you forced out of yourself and hoped was enough to quiet Jungkook. He stared at you, eyes big, before ultimately letting out a chuckle himself when he saw you smile at him. He held onto your hand, squeezing it.
“If I wasn’t too lazy to reach for my phone, I’d take a picture of you right now,” he told you with his mouth stuffed, matching your tone, keeping it light and fun. It was amazing, how both of you simply moved on. He broke off a piece and held it to your mouth. You took it from his fingertips, letting him feed you. The sugar melted on your tongue. “Really thought you had learned your lesson, you know? That you were less judgemental now.”
“Shut up,” you mumbled, still chewing. He laughed when you rolled your eyes.
For a few minutes, neither of you said anything. It seemed like the moment had resolved as easily as it had come up. You took a few sips from your glass, filling it back up when you emptied it, and Jungkook shared the last bite of the cookie with you, holding the piece in front of your lips and allowing you to pull it from his fingertips. And when he kept his fingers in front of your mouth, you pressed a quick kiss to them. He smiled and took your hand into his again, fingers interlacing.
“You’re so weird,” you said, the corners of your eyes creasing when you smiled.
Jungkook returned it, opened his mouth to retort something clever and funny, but it was like the fire died in him, as if he simply couldn’t let the moment from before slide as easily as you both had hoped and tried for it to. He reached for it again, pulling it back on shore. His face changed, morphed into something else. You couldn’t pinpoint his exact expression, but your stomach churned. For a second, you felt this brief need to cry.
“You—” He hesitated, afraid to ask because he knew you didn’t want him to and he shouldn’t but he needed to ask. “—believe me, right?”
And somehow that question carried the entire weight of the earth because you suffocated underneath it in an instant. There seemed to be so much. It didn’t make sense, there shouldn’t be any deeper meaning behind his question. After all, he and you weren’t anything! And yet, he looked at you as if you were. When you wouldn’t respond, looked away instead, Jungkook let out a chuckle. But it sounded empty and dry, and you knew you had hurt him.
“I’m sorry.”
There was a sadness to your words, and he noticed. It was the same kind of sadness he heard colouring your words when you had told him about Jaehwa and the heartbreak that had come with him. And he knew then not to take it to heart, your inability to believe him.
“I’m sorry. I want to- It’s just-”
There was desperation, hurt, frustration. You buried your face into your hands, eyes closing. It’s just hard sometimes! I don’t really believe anyone really, you wanted to say. But you didn’t. The admission felt too much, too hard to bring over your lips, too honest. You couldn’t do it.
Jungkook didn’t say anything, and you waited for him to take all of his things and go. The front door would click shut and with that, you would have ruined it, all of it, the past few months. But it didn’t happen. You didn’t hear his steps moving away from you, or the front door opening. Instead, Jungkook cupped your face with both of his hands, a smile on his lips when you finally looked at him.
“It’s fine.”
And you wished it felt like that to you. Fine. But you hadn’t felt quite fine for a while now. Not since your heart began filling up every time you looked at him.
“Is it?”
His gaze softened, melted like the first layer of snow in the early morning hours. His thumb brushed over your cheekbones, and his touch was so very warm and comforting. You closed your eyes, and he pressed his lips to yours. It did feel fine right then when he kissed you. He held you firmly and strongly, he wasn’t going to let go. Even if you might not believe him and had your doubts. Your hands curled around his shirt, and you were the one to pull it off of him. Because you needed that right now, something simple.
“Are you sure-”
You silenced him, removing your shirt. He looked at you for another second before kissing you again. You moved up from the floor to your bed. His lips pressed to every inch of your skin, slow and delicately. Your breathing flattened, soft whimpers emerging from your throat when his hands wandered, brushed the inside of your thighs. Jungkook was everywhere, holding and gripping and squeezing and kissing. It made your chest swell, and for a second, you thought you needed a second heart. Another one to hold it all in. All the feelings brewing inside you, all of your feelings for him. It was too much to bear for your one singular heart.
He held you, stayed close. He never allowed any space between him and you, never allowed you to think he’d get up and leave. And you never let him slip away from you, not tonight, caging him in. One day he would, you were certain of it, convinced. The contract was running up with each day, but right now, he was here, closer than ever.
And in the high of it all, your breaths mixed with his, the air smelling of sweat and lust, your faces flushed and bodies sticky, there were words lying between him and you. In fact, there was so much, it felt heavy. You hoped, in vain, he would let it slide, quietly.
“Y/N, I-”
Jungkook stopped when you shook your head, pleading. You knew the ending of his sentence, he had told you it many times before. And right now, the thought of hearing it, hurt you more than it ever had before.
“I-”
But he stopped again when you closed your eyes and pressed your lips to his in response, hands cupping his face. He hesitated at first before kissing you back, hoping you’d understand either way. That he wanted this. That he wanted you. You didn’t say it, but Jungkook knew not to cross that line, not right now. As if him not saying it would prevent the inevitable heartbreak you’d be going through in just a few weeks, would change anything. As if you didn’t already love him more than you could comprehend. As if loving him didn’t hurt you.
→ thanks for reading !! if you have any thoughts, id love to hear it!
#jungkook angst#jungkook fluff#jungkook x reader#jungkook scenarios#jungkook fanfic#bts scenarios#bts angst#bts fluff#jungkook implied smut#bts x reader
2K notes
·
View notes
Text
Revolutionary Army Punk AU
Ft: Luffy (not punk)
Steampunk is cool but i think just straight up punk would be cooler. I just think what they stand for lines up a lot better
Design notes:
I did some research and talked to a punk friend of mine for these as i am not a punk, myself, and I dont want to look like a poser. I think i did a really good job translating them and i want to explain my thoughts!
Sabo was first, of course.
I not only wanted to make the characters punk, but i also wanted to crank their designs up about 20 notches, so i gave Sabo’s scar one hell of an upgrade. In this version I tried to make it very clear that that cannon ball hit him head-on. I think it works really well with his punk vibes because under-cuts and shaved parts of the head in general are very popular in punk culture.
I largely tried to keep the silhouettes the same with this au, and It was really easy to keep it with Sabo because of the fact that he already has a lot of design elements that translate well to punk. His big pants into tall boots were perfect to translate, crust pants and steel toed boots fits him well. Trench coats arent a staple in Punk, but i couldnt take the coats away from him… him or Belo. They deserve it…
I threw away his cravat for a choker, i replaced his vest with a red tank top and his undershirt for fishnets, Patches up the wazoo, he looks very cool.
Belo Betty was next, she was super easy to translate. She’s already in the punk spirit with her tits out, we love to see it. Her hat was really difficult to translate, along with all the other hats, but a red knitted hat that has those two points cuz it’s essentially a scarf sewed together looks nice on her.
My punk friend suggested i give her a bunch of nets and harnesses and i really agreed that was her style, so i gave her red tie to Morley, slapped some harnesses on her and just overall just turned her sexy up like 50 notches. I think i was clever how i adapted her striped stockings here with how they have runs in them.
Karasu is almost the exact same. I just threw out his dinky little cravat and gave him a bandana and harness. I also gave him piercings. That’s the only difference. In the words of my Punk friend “hes naked and wearing a spiked mask, He can hang”
Speaking of what my punk friend said, he said that Lindbergh would get “demolished” in the pit, and that he looks like he’s scared of bees. The consensus was that he couldn’t hang. But also i still had to make him punk, so then he suggested CBGB punks:
Redneck, bluegrass, southern american punks. I was really in a rut with his design, I didn’t know what to do to keep the silhouette of his backpack. But everything changed when I chance got the idea of a guitar. And then everything flowed from there
Morley was really really fun. Punk friend suggested i make him Pop Punk, inspired by this pic
Mainly Lindsey way with this plaid skirt and tie
He was so so fun to draw, i love his fucked up eyes.
For dragon, i didnt change much at all, even though it’s only his bust that’s shown. Imagine everything is the same, except now he has piercings. Dragon isnt concerned with the punk fashion, but the punk cause.
For Luffy, I wasnt trying to make him punk, but he felt a bit plain looking like base Luffy next to punk Sabo, so i just did the “turn design up 20 notches”, and just gave him a more visibly tattered hat, bangles and waist beads.
That’s about it! Ive been getting a lot of comments and asks lately saying that you guys like when i go on my design explanations, and i realized that i didnt do that for the last few AU’s, so i thought id type this up :)
Thank you for reading!
#my art#one piece#sabo#monkey d. luffy#asl brothers#sabo the revolutionary#revolutionary army#belo betty#op Morley#lindbergh op#monkey d dragon#op dragon#punk au#asl au#op karasu
806 notes
·
View notes
Text
Dad!Simon "Ghost" Riley w/ a sick baby Headcanons and Imagines list
Am I back with the Dad!Ghost content? You know damn well I am, also yes the render I used is courtesy of our beloved @ave661 who's most definitely annoyed by my existence by now for constantly tagging her.
Will I ever stop writing Dad!Ghost? Fuck no, why? Daddy issues and baby fever, if you want anyone to blame, it's those two. And yes, I will be upset if this doesn't do well. (AHEM, MY SOAP POST)
Taglist of who I this would enjoy this and requested: @puff0o0, @blingblong55, @cutenote, @wise-owl and @connorsui. This last creator by far has given me the best fucking commentary on my work and I have more works on and coming about Dad!Ghost, genuinely thank you so freaking much, you made me cry 😭.
I'M BACK! Let's start, shall we?
❥ Dad!Simon who's a very nervous first time father, well there's a first for everything and so is the first time your guys' baby got sick.
❥ Dad!Simon who immediately got them a check up, it was a common flu. Naturally medication and antibiotics were prescripted.
❥ Dad!Simon whose heart melts once he hears the soft whimpers of discomfort of the little on as they stir in the crib. The soft raspy cries and flushed chubby cheeks and warm, almost burning temperature.
❥ Dad!Simon who is trying his hardest not to look back the car seat when you were on your way to the clinic, to check on the baby whose little cheeks are bouncing a bit while being entertained by their pacifier, the little cooling patch on their head making their forehead crinkle a bit.
❥ Dad!Simon who was amused by how talkative the little one still is despite being so drowsy and in pain. Babbling their little heart out while sniffling.
"Dada!" the little on calls for Simon, almost in a screaming manner if it wasn't for the poor little thing's scratchy and sore throat.
They let out incoherent babbles to Simon as if trying to tell him something, as if they're chatting like they used to, the only adjustments being the constant sniffles and coughs. Them being reduced to their clogged nose while trying so hard to communicate. (Here's your visual)
Simon took the warm baby bottle from your hands to feed the little one.
"Bee, slow down.." A new nickname picked up by Simon to give to your little one, bumblebee, trying to tell them to slow down from chugging.
❥ Dad!Simon who never thought the baby wouldn't get any more clingy, at least not until they got sick. Constantly asking for "dada" and "mama" while he goes on about his day trying to help his wife, you, to keep up with the chores around the house.
❥ Dad!Simon who feels a bit guilty because he loves the comfort he's able to provide the baby, especially that they're not comfortable and less than happy with the sickness. Having the baby on his chest, patting their fragile back gently with a hand that's almost bigger than their body as their dad's heartbeat lulls them to sleep despite being irritable the whole day.
❥ Dad!Simon who slightly chuckles when the baby's breathing starts picking up, their lips trembling into a pout, little doe eyes starting to get glassy from the tears forming with a pitched whimper, only to be silenced by a kiss from both you and Simon. The toll of the sickness only ever being reduced with yours and his affection.
❥ Dad!Simon who joins in when the baby entertains themselves while playing with the various rattles and teething toys.
Bumblebee shaking the tiny rattle, a bit in frustration, knocking their self back. Luckily Simon had intense reflexes and managed to slip his hand in time between the cushioned but still quite hard floor and the baby's tiny head.
Simon let out a breath of relief, "You sure know how to scare me, don't you bee?"
The baby let out a strained giggle as their dad guided them to sit back up by their head and back.
❥ Dad!Simon who tries his best to make the baby take the prescripted medicine, that baby did NOT like the taste of it and he had to resort to sneaking it in their food to hide the taste of the bitter syrup.
"Come on pumpkin, copy dada okay?" Simon whispers while exhaling loudly out his nose, careful with the baby's sensitive ears.
❥ Dad!Simon who makes the little one blow their tiny nose.
The sleepy eyes of the little one trailing on him, trying to observe and copy, blowing their nose on the soft wipes Simon held against their nose.
After wiping it, Simon noticed how their nose now unclogged helped they sleep far more easier and with less frustration from them.
Shout out to a very consistent person who has been liking all the things I post despite them not being actual content @poohkie90 <3
Also I had no idea @simp4konig and I were mutuals, I'M FANGIRLING SO HARD WHEN I SAW THE LIKED POST NOTIF.
Sidenote: I'm sick rn y'all, like it just kept on coming. First was my period, then next thing I knew my nose is clogged and I'm sniffling, then the next I'm coughing and sneezing. There's so much blood rn I can't even. I don't feel good at all but I'm pushing through. Apologies if this was shorter than most if you expected from me, I wanted to elaborate on this prompt however I don't have much ideas so I'm sorry to disappoint.
#cod x reader#aethelwyne lia writes#ghost x reader#simon riley x reader#cod headcanons#simon ghost riley x reader#dad!ghost#dad!simon#simon riley#simon ghost x reader#simon ghost riley#simon riley x you#ghost x plus size reader#ghost x female reader#ghost x you#ghost x y/n
1K notes
·
View notes
Note
Hi I’m kinda shy about this one. So the reader has been traveling with dead city cowboy Negan for awhile and she’s liked him for a long time but she’s a virgin and she wants him to take it.
Don't be shy bb, I am a slutttt for dead city Negan. Basically, think of this as if you were in Ginny's shoes, but you're 18.
Our Little Cabin
Dead City!Negan x Reader
Warnings: smut, 18+, NSFW, virgin reader, vaginal sex, fingering, family death (reader's mom), reader seduces the hell out of negan, extreme age-gap (reader is 18, negan is 50ish), masturbating (both), masturbating in front of Negan while he refuses to touch you, daddy-kink, breeding kink, cuddling, pure filth
A/n: If you like slow burn, sexual tension and a "hard to get" daddy Negan, this one is for you. I promise one day I'll finally write a fic without daddy-kink, but today is not that day.
"Can we go home now, Negan? My legs hurt." I complain, dragging my feet lazily through the leaves.
He stops and sighs, resting his hands on his hips. I stop too and stare at him. That damn cowboy hat.. I swear he wears it just to tease me.. and it's working.
"Yeah, doll. Sun'll be going down soon anyway."
"Ugh thank god." My head falls back dramatically and he chuckles as we start our way back.
Negan took me under his wing a few months ago when some assholes attacked Oceanside, killing my family and everyone I know. I was lucky - if you wanna call it that - enough to escape. I ran into Negan in the woods and it's just been me and him ever since. I'm thankful for him, considering I never had a dad or father figure growing up. My mom was my best friend.. and now she's gone. But at least I have him.
I've grown attached to Negan over the recent months.. But something feels.. different lately. I'm not sure what suddenly changed over the last few weeks, but I've caught myself imagining things about him that I shouldn't. Even touching myself to the thought of him. I feel so guilty afterwards, but I can't stop. I've never been with anyone.. never kissed anyone.. never touched anyone. And my body is screaming at me for it. I can't even look at him anymore without imagining what he looks like under his clothes.
"Why're you so quiet, kid?" He glances at me as we walk.
Ugh, I hate it when he calls me kid.
I shrug. "Just thinkin'."
"About?"
"Doesn't matter." And I've convinced myself it doesn't. I'll never be with someone romantically, because for one.. it's the apocalypse. It's not like I have a school full of hot boys lined up ready to ask me to prom. Not that I'd give them a chance anyway. I'd probably be more into the teachers. And second, the man I want would never think of me that way.
"That's not true."
"You don't even know what I'm thinking, so how can you say that?"
"Anything you think about - worry about - matters to me, y/n. So, spill."
We finally make it back to our little cabin. We've been staying in it for awhile, stocking it with food and supplies. No one has found us yet.. It's kinda nice. But I won't get used to it. Because nothing good lasts forever.
I throw myself on the couch dramatically, as if our walk that we've done a hundred times now could've killed me.
"I don't know... I just, I feel like most kids - people - my age have already experienced more in life that I have."
"Like?"
"Sex." I blurt before I can stop myself. I look to Negan to see his reaction, but he's surprisingly not that alarmed. His eyebrows are raised as he studies me, probably more shocked that I actually had the balls to say that in front of him.
"Listen, I don't really feel comfortable doing the whole birds and bees talk with you."
My cheeks turn pink with embarrassment and I nod disappointedly.
"Sorry, it's just.. I - no one's really talked to me about it before. My mom said she would when I was ready.. but then she.. she.." I fight back the tears. I hate crying. You can't come across weak in the times we live in and I've been forced to be strong my entire life.
He looks at me finally and sighs, holding his arm out for me to come snuggle next to him. It's not the first time he's held me as I've cried over my mom. Won't be the last.
I bury my head in his chest, sniffling, as his hand rubs my back.
"Alright, kid. What do you wanna know?" He gives in, feeling sorry for me.
"Well, I know how it works, but I guess I just wanna know what it feels like." I feel him tense underneath me as he adjusts himself awkwardly.
"No boyfriends at Oceanside?"
"There were boys.. but none that I was interested in."
"You'll find someone when the time is right. You're still young."
"Well you don't have anyone, and you're.. not young."
"Jeez, kid. Thanks." He chuckles. "I did have someone. A few someone's actually. Lost them all to this cruel world." He admits and my heart hurts for him.
"Well, you have me now." I get more comfortable, laying my head in his lap and looking up at him. He shifts uncomfortably but eventually relaxes and even strokes my hair lightly.
"Yeah, I do. And nothing is going to happen to you. You're safe with me, doll." Butterflies swirl around in stomach, but I know he doesn't mean that in the way I wish he did. He sees me as a kid.. hell, as his kid. For a moment my heart sinks from jealously at the "someones" he mentioned. Lucky bitches.
"...Negan.. does it.. feel good?" I blush a little.
"Sex? .....Yeah, doll. It fucking feels good."
"Will you.. show me?" I stare up at him innocently and his hand abruptly stops stroking my hair.
He bends over, planting a kiss on my forehead. "Time for bed, darlin'." He pushes me gently up and off his lap before standing and heading to his room. The cabin is small but we each have our own rooms. His is the smaller one, right across from mine. He wanted me to have the bigger one.
I sit on the couch, feeling defeated and stupid. What was I thinking. I relax on the couch for a little longer, choosing to read a book to take my mind off what just happened. After an hour of barely keeping my eyes open, I close the book and head down the hall towards my room. I stop in front of Negan's door, peaking through the crack. He always leaves his door a few inches open just so he can hear if anything happens. My eyes widen when I notice the sheets are barely covering the lower half of his legs, revealing the rest of his body. His tan torso is exposed, showing his peppery chest hair, and his black boxers are low on his waist. I restrain myself from not jumping him right then.
I eventually make my way back to my room and change out of my clothes, throwing on some shorts and a tank top to sleep in. I can't get the image of Negan's body out of my head and find my hand slowly making its way towards my aching center once I'm finally in bed. I close my eyes, imaging Negan between my legs as I touch myself. I don't bother suppressing my moans, confident that Negan is fully asleep. "Mmm, Negan!" The sound of his name rolling off my tongue as I'm pleasuring myself brings me closer to the edge.
"Oh, Negan. Right there!" My door suddenly swings open and I snap my eyes open to see a worried Negan standing in my doorway.. still in his boxers. My hand flies out of my shorts and I throw the sheets over me.
"Oh my god, can you knock?!"
"I - you yelled for me." He says flustered. I notice the way his face reddens when he realizes what I was doing.
I gently pull the covers off me again and spread my legs a little.
"What are you doing, y/n?" He stands in front of me at the doorway, refusing to look at anything other than my eyes. That's okay.. I bet I can make him look at me down there. I like the challenge.
"What's it look like?" My bite the tip of my finger seductively at him before sliding my shorts to the side, completely revealing my pussy to him.
He glances down with a serious look across his face, like he can't believe I'm doing this. And neither can I. This is so unlike me, but I'm so desperate for him I don't even know how to control myself anymore.
The fact that he's still watching encourages me to continue. I use one hand to pull my shorts to the side and the other to slowly slide a finger through my wet slit. "I just wanna know what it feels like, daddy."
I study him closely, noticing the way his jaw ticks at the nickname. My eyes travel lower and I see his bulge through his boxers. It looks so big, but I'd be determined to make it fit no matter what.
My finger dips inside of me and I arch my back a little and moan, putting on a show for him. He stands with his back against the wall, refusing to move.
I start rubbing my clit slowly and get frustrated when he still isn't reacting. "Negan, please touch me."
He rubs a hand down his face with frustration. "Goddamn it, y/n."
"I just.. I need you. Please." I cringe at my desperate attempt to have him touch me. I need this man so bad it's embarrassing.
"I can't, baby."
"But you like watching me, don't you?"
I take it as a yes when he doesn't say anything and that's all I need before pushing myself over the edge. "Negan!" I cry out as my orgasm rushes through me. Even in the dark, I can see the lust burning through his eyes.
"Go to bed, y/n." He demands but I'm unable to read his tone. Is he mad, proud, annoyed?
I fall asleep at the thought of him giving in and touching me. Maybe if I think hard enough, I'll manifest it.. I heard that shit really works.
Negan's POV:
That girl is gonna be the fucking death of me.
She's been so flirty with me lately and I've been trying to ignore it. But fuck if she's not making it hard. Literally.. I'm hard as a fucking rock right now.
I refuse to touch my dick while thinking about her. She's thirty-fucking-three years younger than me for fuck's sake.
She's confused. She doesn't want me, and she damn sure isn't getting me. Apocalypse or not, it's still fucking wrong.
I drag a hand down my face and sigh. I shouldn't have watched her, but I couldn't look away. She flashed her fucking pussy right in my face and I just stood there.. watching her. Fuck me.
My dick is throbbing and I know I won't be able to sleep until I get some relief. "Fuck it."
I pull myself out of my boxers and immediately start stroking my dick. I think about anything but.. her. Fuck.. y/n. That pretty little wet pussy dripping right in front of me. The way she said my name when she came.
"Ahh, fuuuck. Y/n, fuck." I cum hard and fast and immediately regret it afterwards. Fuck is wrong with me.
I can't - and I won't let myself think about her like that again.
Y/n's POV:
I wake up before Negan and decide to read my book some more in the living room. It's a romance novel that I found one day in an abandoned car. I've read it four times already, but it seems to be the only romance I'll ever get in life, so why the fuck not.
"Morning, sunshine." Negan says sleepily as he walks towards the kitchen next to the living room. He grabs a handful of berries we picked yesterday and tosses them in his mouth before making me a cup full and putting them down next to me.
"Morning. Thanks." I say without looking at him.
He sits on the couch next to me. "You wanna talk about last night?"
My cheeks redden. "Nope."
"Okay, then I will." Great, here comes the lecture. "Y/n, I shouldn't have watched you. We both know that. But, I think you're just confused. It's just been the two of us for months now and you're all young and.. fucking horny and shit. But, us? It can't happen."
I stay silent, pretending to read my book.
"Seriously? The silent treatment? You sure did have a lot to say last night."
I remain stubbornly quiet, popping a handful of berries in my mouth.
"Y/n, I don't understand why you're upset right now. Talk to me."
"I'm not upset." I snap. "I'm embarrassed.. humiliated. I was stupid to think you'd ever be into me."
He sighs and I see his head drop out of the corner of my eye. "Darlin', if I was your age, I'd be all fucking over you. Trust me. Please don't be embarrassed, okay? You are hot as shit and any man your age would be lucky to have you. We can forget it happened if that's what you want." He holds his arm out again, and like always, I snuggle into him.
"I don't want to forget." My hand rests against his white t-shirt and I want so badly to slide underneath it and run my fingers through is tummy hair.
A moment of silence goes by before he finally whispers. "Me neither, doll."
I look up at him, my face dangerously close to his. "I love you, Negan."
His hand reaches up to caress my face as if he's scared to hurt me. "I love you too, baby... Just not like that."
He wipes the tear that falls from my cheek and my heart shatters in my chest.
One month later...
My feelings for Negan haven't faded; I'm just better at not showing them. We've been more touchier than usual... cuddling on the couch, holding hands when we walk, but nothing "inappropriate." We also haven't mentioned that night. It's like it never happened, which still hurts when I think about it.
I get done bathing myself off after dinner and slip into my usual sleepwear before crashing to the bed and pulling my book from the nightstand. I could quote every line in it by now.
I start to drift off right before a loud boom hits right outside my window, following a bright flash of lightning. I try to fall asleep, but every time I doze off, another loud boom jolts me awake. I toss and turn for an hour before deciding to do something I know I shouldn't.
I crack Negan's door open slowly, trying not to wake him and gently slip into bed next to him. I also may or may not have taken my sleep shorts off, leaving me in just my pink panties and black tank top. I ease underneath the covers and lay facing him. He's usually a light sleeper, so between the thunder and me sneaking into his bed, I'm surprised he's not awake.
I'm completely still for a good ten minutes, making sure he's still sound asleep before I make any movements. When he lets out a little snore, I slowly slide the blanket down off of him. I imagine myself reaching over and running my fingers through his thick chest hair. I keep sliding the covers down further and further, careful not to wake him, until I get to just below the waistband of his boxers. My eyes trail from the deep v in his abdomen to the black hairs peaking above his underwear and I let myself imagine what it would be like to touch him right now.. to slide my hand down his boxers and feel him. I've wondered how big he is for so long.. trying to steal glimpses of him through his pants when he walks, or catch him with the covers down while he's sleeping.
I decide to pull the covers slightly further down and my mouth gapes open at the sight. He's hard.. so hard that I can see the outline of him through his boxers as it threatens to poke through his underwear. My mouth waters at his size and I know if he ever put it in me, it would definitely hurt like hell.
After I've stared at it long enough to feel like a total creep, my eyes travel back up his body and I almost yelp when I see his head is slightly turned and his eyes are watching me curiously, as if he's been waiting for me to make a move.
"I - uh.. The thunder.. I got scared." I explain.
"Nice try, kid. Go back to bed."
"Negan, please. Just let me sleep here. Nothing weird, I just.. don't wanna be alone."
He sighs and that alone tells me he's going to let me. I hide my excitement as I turn over, facing away from him and snuggling into the covers. They smell like him.. musk and leather.. and the scent makes me practically feral. He's still on his back, but my ass is barely touching his side. It's hardly anything, and it's not like we haven't cuddled before, but the thought of my ass so close to him sets my insides on fire.
Another lightning strike hits outside his window this time and I flinch a little, not purposely meaning for my ass to press into him even more. He doesn't react and I wonder if he's already asleep.
"Negan...?" I say softly.
"Hm?"
"Will you hold me?"
"Y/n, you are seriously pushing it. Go to sleep."
a few minutes go by before another boom echoes in the distance and I jump a little again.
He sighs heavily and turns over, draping his arm over my waist and pressing his body firmly against mine. His dick is pressed against my ass, but it's not as hard anymore... and that hurts a little.
"Go to fucking sleep."
I hold his hand tightly against my lower stomach and embrace this moment with him. I want him so bad that I can literally feel my vagina throbbing. If it could speak, it would be meowing like a cat in heat right now. I close my eyes and imagine him sliding in me from behind. I get a little too lost in the thought and accidentally arch a little, grinding my ass further into him. I feel him grow to full length against me and the feeling is enough for me to squeeze my legs together, desperate for some pressure down there.
"Where the fuck are your shorts?" He says in a deep and sleepy voice.
I giggle as he breathes heavily into my neck before whispering again.
"What the hell am I gonna do with you, baby?"
"Touch me?"
"I'm already touching you, y/n. My fucking dick is basically between your ass cheeks."
"Not yet.. my panties are in the way." I slip my panties off my legs smoothly and discard them on the floor.
"Y/n." He warns but before he can tell me no, I'm bare from the waist down and pressing my ass back against him.
"Trying to give this old man a heart attack?" He chuckles deeply.
"I can try harder than that if you want me to." I tease.
"Fuck, baby. Go to sleep before I do something we'll both regret."
"Like what?"
"...Like pound that pussy so fucking good you'll never think about another man's cock but mine."
"If you love me, wouldn't you want to be the one to give that to me for the first time? Wouldn't you rather it be you than some asshole who doesn't care about me."
He doesn't answer, so I keep pressing him. I place my hand back on top of his resting against my stomach and slowly slide it lower towards my aching center.
"Don't start something you can't finish, darlin'."
"Oh, I'm very determined to finish." I spread my legs apart slightly to guide his hand over my wet center. His middle finger easily slides between my slippery folds and we both moan at the feeling.
"Goddamn. Fucking dripping for daddy. He growls in my ear before leaning up a little and pressing his lips to my neck from behind. I move my hand from his, letting him take control - finally.
His finger moves back and forth between my wet slit, gliding over my clit every few seconds and making me moan each time. His other hand slips under me and up to my neck, gently squeezing my throat.
"This what you wanted, baby?" He breathes in my ear and chills spread over every inch of my skin.
I nod quickly as I feel my orgasm build from just his light touch. He hasn't even put a finger in me and I'm already on the verge of tears.
As soon as his finger rubs tiny circles over my clit, I lose it.. moaning out for him.
"Thaaat's it, cum for daddy, babygirl."
"Negan!" I scream out as his hand goes from my neck to my mouth, muffling the sound.
"Don't need the dead hearing us, doll."
He kisses my neck once I've soaked his fingers and then brings them to his mouth.
"Mmm, fuck, this pussy tastes so good I might have to eat it everyday."
I turn around in his arms to face him. My hand goes up to hold his face and my fingers play with his gray hair. He kisses my forehead before meeting my gaze.
"This is so wrong, baby." He strokes my cheek gently.
"Can't be wrong if it feels this good."
He tilts my chin up to press his lips against mine. It's so much better than I ever imagined. He knows exactly what he's doing, and even though I've never kissed anyone, he takes the lead and I'm thankful for it. I moan into his mouth when he deepens the kiss, his hand gripping the back of my neck now. The feeling of is tongue in my mouth makes me clench my legs again, and I think he notices because his hand on my neck travels lower until it reaches the back of my thigh. He lifts my leg over his and his hand slides to my ass, squeezing lightly before his long fingers tease my entrance from behind.
His dick is pressed into me painfully and I can't wait any longer. I need to touch him. Feel him inside me.
I reach my hand inside his boxers and pull out his big, hard cock. I try looking at it under the covers between us.
"You've never seen a dick before, doll?"
I shake my head no and admire him. It's so perfect.
He closes his eyes as I stroke it. "Fuck. So innocent, baby."
He kisses my neck while I pull on him even more. "You sure you want this, baby?"
I nod. "Yes, please. I've been wanting this for so long, Negan."
He lines himself up at my opening, my leg still draped over his so that he's in between my legs.
"Once we do this, you're mine darlin'."
"I'm already yours."
That's all he needs to hear to finally push the tip past my opening. I've never had anything inside of me other than a finger, and the feeling of his thick head pushing through me and stretching my walls has my mouth falling open.
"Tell me to stop, baby."
"No, keep going. Please." I beg.
He slides deeper and deeper until he's buried inside me completely. He stays still, letting me adjust. and kisses me through the pain. A pain that feels so good. I kiss him back hard, scratching his back while grinding my waist pathetically against him repeatedly. I moan in his ear and give him the go ahead to start moving. He fucks me deep and slow at first, letting me get used to him.
"So fucking tight baby."
He growls in my ear and vibration of his deep voice sends chills through me again until my pussy flutters around him.
"Holy fuck, doll. Do that again."
I squeeze my cunt around him again and he lets out the hottest moan I've ever heard. Not that I've heard a man moan before, but I just know that his are the hottest.
"I won't last if you keep doing that, baby." He warns and the thought of him shooting his load inside me has my head spinning.
After a few more thrusts that have my eyes rolling to the back of my head, I feel myself reaching my orgasm again and hold him against me so I can grind against him and ride it out.
"Negan, Negan, oh my god.” I breathe out as I push myself so hard against him that my clit rubs against his pubic bone creating the friction I need to send me over the edge.
"Goddamn." He thrusts into me faster and harder. "Gonna make me fucking cum already, baby." He tries to pull out but you tighten your leg around him so he can't pull away.
"Cum in me, Negan. Please." I cry desperately. "I love you. I want all of you."
He kisses me hard before his hips come to a halt. He practically yells out when he shoots his load deep inside me. "Ah, fuck! Babyyy."
The sound of Negan cumming is even hotter than his moaning from earlier - I didn't think it could get any better but holy shit. We're both a tangled, sweaty mess while our hearts beat out of our chest.
We eventually fall asleep with our lips still touching and his softening dick still inside me.
I don't even worry about the possibility of what could happen in the future.. I know I'm safe with Negan.. Here in our little cabin. He gently strokes my hair as we drift back off to sleep.
BOOM. The thunder crashes outside again, but this time I don't even flinch.
"You're not scared of thunder, are you, doll?"
I smile against his chest. "...No."
The End.
Brb, going to take an ice bath.
#jeffrey dean morgan#negan#jdmorgan#jdm x reader#jdmfanfiction#negan fanfiction#twd negan#jdm fanfiction#jeffrey dean morgan smut#jeffrey dean morgan x reader#jdm imagine#jdm smut#jdm fanfic#negan smith#negan smith x you#negan smith x reader#negan x reader#the walking dead negan#negan twd#twd fanfic#twd smut#daddy negan#negan x you#dead city negan
2K notes
·
View notes
Text
dress - SV5
pairings: sebastian vettel x famous!reader (fc: taylor swift)
summary: its known that seb has been married for a few years now despite the public never seeing is wife, its also known that yn is in a committed relationship and has been since she disappeared from public eye. maybe they are more connected than people realise
authors note: i have had this idea on my mind for SO LONG so im very pleased to finally be writing it. essentially in this, yn is taylor and seb is joe but no one has ever seen him nor know his name, if that makes sense? honestly i have no clue how this will turn out but i needed to write it
authors note 2: this is set in the midnights era however i switched the songs a bit so ‘dress’ is on midnights instead of ‘sweet nothing’ and vice versa!! also ‘dress’ is going to be a single. i also apologize for how all over the place this is, especially the tweets
authors note 3: just pretend whatever says taylor swift says your name and the photos with her hands have a wedding ring!! i also got so confused when trying to screenshot the twitter stuff so the timeline ones are backwards
authors note 4??: haha didnt realise there was a 30 pic limit... pt 2 here :)
masterlist
ynupdates
liked by user3, user18 and 10,628 others
yn on her story today, possibly posting song lyrics! thoughts?
view comments
user3: NEW ERA INCOMING
user18: OH I AM SO READY FOR THIS
user13: NEW MUSIC NEW MUSIC
user66: is this hinting at her reputation era?
user13: i was just thinking this, more specifically the time just before reputation
user72: MUSIC ABOUT LOVER?? OH I AM SO HERE FOR IT
user55: if it is about lover and the time before reputation this will BREAK ME like,, HE SAW THE BEST IN HER EVEN IN HER WORST TIMES😭😭
yourusername
liked by gracieabrams, ynupdates, olliebearman and 7,277,739 others
everyone thinks that they know us, but they know nothing about…
this album has been such a rewarding piece to create and im so glad that soon enough you will all be able to listen and enjoy it with me! one thing i love in particular about this album is the song ‘dress’
dress was originally a piece i started to write when making reputation however i felt it was right to keep it to myself, to keep it between my partner and i for a little while longer. however recently our lives have been changing for the better, and while that lid of privacy will still be on, i want to share more with you guys
you have all been on this journey with me and you have treated my partner and i with the upmost respect and for that i thank you. for me dress is a letter, its statement, its a declaration of my love for him and im very grateful to be able to give this to you all
this song is one im very proud of, i really enjoyed writing this the first time, and getting to revist and polish it up felt very special to do.
dress out now on all platforms🖤
comments on this post have been limited
sebupdates
liked by user34, user5, user88 and 23,683 others
seb in suzuka with the grid at his turn 2 bee (insect) hotels,, we've missed seeing him at the track :(
view comments
user3: of course the grid come together for him :’)
user5: im not crying!! just hay fever!!
user5: oh i have missed him SO MUCH
user7: NO BECAUSE YOU DONT GET IT HES BACK
user88: DID YOU GUYS SEE THE VIDEO OF HIM HUGGING CHARLES😭😭
user34: the way he was like a teacher throughout the whole thing😭
user18: does anyone know if hes staying the whole weekend or is it like monaco??
sebupdates: we believe hes staying the whole weekend but unsure if hes with a team or not!
user18: ok thank you :)
user77: the way the first thing lewis asked him was if his wife was okay, oh what if i cry😭😭
user66: im kind of new here, have the grid met sebs wife?
user77: i know they all at least know about her and know who she is, i dont think everyone has met her but i know lewis has met her quite a bit!!
part 2!
#f1 x reader#f1 instagram au#f1 smau#f1 social media au#social media au#formula 1 insta au#formula 1 social media au#sebastian vettel x reader#sebastian vettel fanfic#sebastian vettel#famous!swift!yn
1K notes
·
View notes
Text
Honestly, GeekSquad! Ellie
GeekSquad! Ellie who’s really got nothing going on for her other than updating her LinkedIn picture here and there, alternating between her college ID photo and a the default flower.
GeekSquad! Ellie who spends her days sitting in uncomfortable swivel chairs, and having to tiredly explain over and over again to elderly women that the promotional sign outside does NOT mean ‘hand in your old phones and get free smart ones!’
‘No ma’am, we don’t take Nokias.’
‘But the sign said give one, get one free!’
GeekSquad! Ellie who’s eyes squint in confusion when she sees you enter from the slide doors, arms crossed as you curiously look around for any standby employees. She doesn’t really ever see hot girls at her location.
GeekSquad! Ellie who practically knocks over some USB stand in her pursuit of getting to you first, which is uncommon since she’s all the way in the back.
GeekSquad! Ellie who notices your pursed lips and teary eyes as you show her your broken laptop.
GeekSquad! Ellie who takes you over to the little stand-by bar, setting your device down, which, let’s be honest, was a lost cause from the start.
‘W-will you be able to fix it? I have my senior thesis on there!’ You practically choke up, the mere thought of months of hard work going down the drain making you tremble.
GeekSquad! Ellie who’s suppose to give you the generic capitalistic answering of, ‘Well, you can always make a membership with us and get 20% off a future purch—
“I’ll fix it.”
GeekSquad! Ellie who’s now being held in a warm embrace by you, your tears now soaking her blue polo workshirt. It’s bad enough you’re pretty, but a pretty crier?
“Thank you so much! God, you don’t even know how much trouble you’ve saved me!” You stumble over words, disoriented as you begin to let go of the lanky girl.
GeekSquad! Ellie who waves a hand in dismissal, scoffing as she leans on the counter, “That thing? Pfft, i’ve done harder things.”
GeekSquad! Ellie who’s lied, and has likely lied to also get this job—but that’s beyond things!
“I just,” You say breathlessly, looking around, “I went to the other branch? Downtown? They said it was over!” You whisper to her, all doe eyed, “you really are amazing.”
GeekSquad! Ellie who blankly stares down at you, she’s always had a thing for frazzled girls such as yourself; the ones who just say the very shit Ellie only watches in cheesy movies.
‘Right..guess you’re in-luck you came here?” She probes, typing your name and number into the system to get you all checked in for an appointment.
‘So lucky.’
GeekSquad! Ellie who after her shift, goes home and makes a bee-line for her room, slamming it shut and shedding her clothes, needing to fuck herself to you while the interaction is still fresh, and the night is still young.
‘S-she said she’s—mm, lucky! f-for me..’ She whimpers, pumping 2 fingers in her drenched pussy, and her other hand busying her perky tits. Her eyes are furrowed, and her teeth threaten to break the skin of her lips from the way she’s biting them; Her messy cunt squelches from the speed she’s going at, cum trailing down her thighs in a sluggish matter.
GeekSquad! Ellie who switches on over to her tummy, raising her ass up as she relentlessly slaps at her swollen pearl through her plethora of orgasms— she thinks you’d do it like this, giving yourself something to cry about. It makes sense to her. She wants to practice on herself to perfect it for you.
GeekSquad! Ellie who, once tired out, realizes how fucked up this just is. I mean, she’s so..perverse. So nasty.. so..so..
so GeekSquad! Ellie
568 notes
·
View notes
Text
Prematch
Hardersson x Child!Reader
Jessie Fleming x Child!Reader
Part of The Big Adventures Universe
Summary: The prematch routine
One day, before a match at home, Morsa gets up early to go to the market. She takes you with her because she woke up to you staring at her from your spot in the middle of the Big Bed.
Magda's not even sure how you snuck in without her noticing but it's enough to get you dressed and out the door before you can wake Pernille.
The market only really happens once a month so Magda always makes time to visit as she picks up various items that she can hoard until the next time it comes around.
You get a bit distracted by the crochet bees at one of the stalls and she has to hold your hand tightly to pull you away to the stall with all the flowers.
"Good morning, Magda," The old woman behind the table says, dipping her head in greeting.
"Morning." Magda pokes around at a few of bouquets.
It's a little embarrassing, she thinks, that she's here so often that the woman running the stall knows her name.
"And who is this delightful little lady?"
Magda rests a hand on your shoulder proudly. "My daughter, y/n."
"Oh, she's beautiful," The lady says with a coo and your cheeks go a little red and you duck to hide behind Magda's legs. "What were you thinking of today?"
"Roses," Magda replies," Pernille's still in bed so we're going to surprise her."
"Wonderful choice."
The woman picks up several deep red roses and spins them together as you watch.
"Morsa," You say," Why are we getting flowers for Momma?"
"Well," Morsa replies," When we really like someone, we give them flowers to show our affection. I really love your Momma so I want to get her some flowers to remind her."
That makes you think for a moment, brow furrowed as you ponder. "Morsa," You say eventually," Do only girlfriends give each other flowers? Or do friends do it too?"
"You can give flowers to friends. We got sent a lot of flowers when you were born."
You don't remember that because you were very little then but you believe Morsa. You tug at her shirt.
"Can I give Jessie flowers? Because she's one of my bestest friends and I want her to know."
"Well, princesse-"
"Here you are, Magda."
Morsa has to stop talking to grab the flowers and pay.
You huff a little, scuffing your shoes in the dirt at the non-response.
"And for the little lady to give to her friend."
You look up to see the woman smiling down at you, holding a second bouquet of flowers to you.
"Thank you," You say as you take them.
"Now," The woman says," These flowers here are yellow roses and they mean friendship and happiness. The pink ones a tulips. Now pink tulips are for affection and good wishes. Perfect for a friend."
"Thank you," You say again, adjusting your grip so you're holding them more carefully.
"No need to pay for those ones," The woman waves off Morsa's attempts," You just make sure the little lady gives them to her friend."
You make Morsa walk carefully back to the house to make sure that Jessie's flowers don't get crumpled. You think that annoys her a little bit but she's very nice about it even if it means Momma's already awake when you get back.
She takes the flowers from Morsa and accepts the soft kisses she's given.
"These ones are for Jessie," You say when she asks," We have to be careful with them, okay? Because they're special flowers just for her."
"Okay, princesse," Momma laughs," We'll be careful."
You remind Morsa how careful she has to be in the car when she goes a bit faster than you'd like and then when she holds the flowers a bit too tight when Momma's helping you out.
The silly social media man is waiting outside for you.
You give him a weird look as he holds something out for you. You take it, turning it over in your hand.
"It's a camera," He says.
"Why?"
"Well, we thought it would be fun if the fans got to see everything from your view."
You lift the camera up to your eye for a moment before smooshing it towards the flowers. "I'm giving flowers to Jessie," You say," Because she's my friend." You look at the social media man. "Like that?"
He nods with a laugh. "The others are out on the pitch if you want to join them."
You look at Momma and Morsa.
"Go on," Momma says.
You scamper off with your flowers and the camera.
"Niamh!" You exclaim when you fast walk down the tunnel and spot the older girl.
She's walking with Zećira and they both turn to look at you. You're not quite running because you don't want to ruin the flowers but you're moving quickly.
"What's that you've got there?" Niamh asks.
"A camera," You say, turning it so it can capture Niamh and Zećira.
Zećira laughs. "I think she means the flowers."
"Oh! They're for Jessie! Morsa got Momma flowers at the market this morning so I got some for Jessie."
Niamh's laughing now too and she leans down to look into the camera.
"Well, as you can all see, love is in the air at Chelsea."
That makes you frown. "What does that mean? Momma and Morsa are still inside."
"Don't worry about it. Here, I'll take the camera and then everyone can see Jessie getting her flowers."
"Okay!"
You move a bit quicker now that you can use both hands to hold your gift safely. Jessie's a little bit up ahead with her headphones in and you reach to tug her hand.
She smiles down at you and gives you a hug.
"Those are pretty flowers. Did Magda and Pernille get them for you?"
You shake your head. "I got them for you." You puff out your chest. "The market lady said they're for friendship and affection. We're friends and we hug. Hugging is affection, Momma says so."
You lift the flowers up to her.
Jessie looks a little caught of guard and you can hear snickering from Niamh and Zećira behind you. You don't pay them any attention though as Jessie takes the flowers and gives you a little kiss on the cheek.
You take one of her hands and receive the camera back in your other one.
Instantly, you're back to talking to it.
"You have to walk the pitch to make sure it's good," You say," But Niamh is always very silly. My Morsa says she only comes out here to socialise and so she can avoid being told what to do."
"Hey!"
#woso x reader#hardersson x reader#pernille harder x reader#pernille harder#magdalena eriksson x reader#magdalena eriksson#jessie fleming x reader#jessie fleming#woso community#woso fanfics#woso imagine#woso#The Big Adventures Universe
612 notes
·
View notes
Last Seen Blogs
sweet-food-sweet-mood
Sweet Food Sweet Mood
wayward-priests
For Ink, For Ink
akanemnon
TWIN RUNES
spaceexe
Ok but, Aliens
haveyoueatenthis
have you eaten this?