big rant incoming <3
being on acotar tiktok comes with dealing with delusional people who are also trying to gaslight you.
the fact that people still believe gwyn is gonna have a book is crazy to me, especially before elain. the fact that people believe sjm is gonna have a man choose is crazy.
let’s address all their arguments one by one, shall we?
1. “elriel is too obvious/cliché”. this makes me laugh because do you even know what you’re reading? romantasy is always cliché. and also, everyone finding their mate and living happily ever after wouldn’t be too obvious or cliché? what stakes would they have? they have no obstacles, that book would be finished in 100 pages unless she made the romance a subplot, which we know won’t happen.
2. “lulu deserves happiness”. okay i’m gonna be real biased here. i don’t care about lucien’s happiness. i don’t care. the only thing i want is for elain to get the man she actually likes, which happens to be azriel. also, if lucien has been through so much so has azriel yet i don’t see all that coddling for him. lucien fans sound like boy obsessed moms and i’m tired of it. you 36! i would loveeee to know what lucien has done to have so many fans.
also, if i entertain the possibility of elucien happening, i will not forgive sjm for making elain “come around” after she repeated non-stop how uncomfortable she is around lucien. she’s not a consolation prize for him, sorry.
another thing. every plot point i have read for an elucien book revolves around lucien, not elain. but then they will turn around and tell you we are the ones who don’t care about elain. that we only want azriel smut. lol first of all, if we only wanted azriel smut we would have no reason to ship him with elain, we could have shipped gwynriel. but we don’t because the smut is not the only thing we want. the only thing we have had for years were the cute/sweet moments, and it’s all we talk about still. so point invalid, once again. next.
3. “azriel only feels lust for elain!”. stop lying. i know you can’t be that stupid. i know you have read the whole series just like me. what kind of man stares at ibuprofen every night for over a year if he’s only looking to get laid? what kind of man questions fate if he only wants to get laid? what kind of man risks dying alone just to rescue her if he’s only looking to get laid? what kind of man goes out of his way to pick a necklace that represents her if he’s only looking to get laid? cry all you want but we all know azriel is a good male and you would rather destroy his character in your head than accept it.
also, if azriel is so bad, why would you ship him with gwyn? she won’t fix him. and the poor girl hasn’t even shown interest in him yet here we are.
4. “elain gave truthteller and the necklace back”. she gave back truthteller because it wasn’t hers, and azriel would need it again because he actually makes use of it. she gave the necklace back because she thought azriel didn’t like her, she thought she had read everything wrong, not because she was the one rejecting him. she gave the necklace back just like nesta didn’t even accept cassian’s gift.
5. “azriel’s shadows don’t like elain”. that’s another big fat lie. i know we all have eyes and have read the same words on paper, let’s not act stupid, okay? shadows swarming him means he’s either mad, uncomfortable, or something is troubling him. so if we know that why would the shadows disappearing be a bad thing? he certainly doesn’t seem worried about it. not to mention those same shadows were like snakes preparing to strike when nesta insulted elain.
6. “feysand and nessian didn’t like each other at first either”. LIE. feyre literally called rhys the most beautiful man she had ever seen and nesta and cassian were attracted to each other from the first moment they met, and we know that because it’s in the actual book! elain and lucien are nothing like that, they have no chemistry for the pov to change all of a sudden, they are uncomfortable around each other because the mate bond basically feels like a curse.
that’s it for now.
70 notes
·
View notes
I tend to think of Mike as someone who wants to be good, but only had bad examples to learn from.
46 notes
·
View notes
I LOVE the idea of protective Hotch constantly having an eye out for younger bau!agent who’s literally sunshine personified and the complete opposite of him!! Do u think u could write something along the lines of that—maybe him protecting her from something or just their dynamic?
i also love protective hotch!!! tysm for the request i hope u like it baby :D | 1k of fluff, tw for a small burn!
You’d been surprised when you got a job at the BAU. You didn’t have that much faith in yourself at first. Not to say you don’t believe in your skills, but it’s a widely known part of the bureau. A lot of people wanted the job.
And then, there’s Agent Hotchner, unit chief and intimidating though you’re sure he doesn’t mean to be. You were insanely nervous at the beginning.
That was before you started, before the team welcomed you as the new media liaison after Agent Jareau became a profiler. You met Garcia and her collection of fun high heels, Reid and his never ending supply of facts, and you sort of fit right in.
Hotch became much less intimidating. A kind man who cares so deeply for his team that you couldn’t help but like him the way you do. Not to mention the dynamic that built between the two of you.
The small things he does for you that are impossible to ignore. A hand covering the edge of your desk to protect your head when you were searching underneath it for a dropped paper clip, the way he physically places himself between you and danger if he ever gets the chance.
He’s always there, protecting you in ways both big and little, and you enjoy it more than you should.
It’s even brighter on nights like tonight. Drinks and snacks at Penelope’s after a tough case. Nights when you get to call him Aaron instead of Hotch, when he smiles and laughs freely without restraint.
The beep of the oven cuts off yours and Garcia’s conversation, and when she shifts to take care of it, you stop her, “I got it! You’re already hosting, just relax a little.”
“Thank you,” she smiles, squeezing your arm as you walk by.
The smell of food in the oven hits your nose as you walk into the kitchen, humming along to whatever song spills through the speakers.
You pull the oven open, reaching in without thinking and touching the pan with your bare hand. You drop it quickly, metal clanking as it falls back onto the rack in the oven.
“Shit!” You say it loudly, and then, even louder, addressing the team in the next room, “I’m okay!”
They all laugh a little at your reassurance, and then, like they know he wouldn’t let anyone else check on you before him, pretty much every set of eyes in the room lands on Hotch.
He shakes his head and heads to the kitchen, because he would’ve gone either way.
“You okay?” He asks, finding you with an oven mitt on your non-burnt hand, reaching into the oven, and your burnt hand shaking by your side.
“Oh!” You set the pan of nachos on top of the stove and slip off the mitt, turning off the oven and looking at Hotch. “I forgot oven mitts were a thing for a second there. Burnt my hand, I think.”
He’s on you in a second, his hands gently grasping your injured arm, pushing back your sleeve and guiding you over to the sink. His hold is light, never bruising even though you know he has the strength to do so.
It’s the kiss of sunlight on skin.
Aaron turns on the sink, places his fingers under the water to make sure the temperature’s okay before guiding your hand under the stream.
“You still took out the nachos first?” He asks, even when he knows that’s what you’d do, because of course you’re worrying about everyone else before yourself.
“I didn’t want them to burn.”
You’re trying to be brave, though your hand hurts so much there are tears misting your eyes. You’re bouncing on your feet a little to try and deal with the pain.
“How bad does it hurt?” Hotch checks.
Aaron’s felt this sort of protectiveness over you ever since you started. A little younger than him, this ball of light that’s come bursting into his life. You’re always the positive one, even in the darkest situations and he can’t help but want to shield you to keep it that way.
There’s this thing in his chest that tugs and tugs when you’re around, that makes him stand next to you in any room, in front of you in darkness.
“It’s okay,” you say, though your voice cracks a little. “I’m sure you’ve seen much worse, Hotch.”
“Aaron,” he reminds you gently, “and you don’t have to pretend. It’s alright if it hurts, I just wanna help.”
The sink running mingles with the music coming from the next room, the background noise to your moment with him.
“You could bring the nachos out? I told Garcia I would, but we see how that turned out.”
“Okay, I'll bring them out.”
“Don’t forget oven mitts!”
He huffs with a smile, somehow always surprised with how easily you can turn something around. A smile on your face even with tears shining in your eyes and a hand that’s surely stinging.
Aaron carries the tray of nachos and drops them off, then turns to Penelope, “you have a first aid kit?”
“Oh my gosh! Yeah, bathroom cabinet, I can grab it.”
“It’s alright, Garcia. I’ll get it.”
“Is everything okay?”
“Don’t worry. Nothing major, I’m taking care of it.”
He grabs the first aid kit and heads back to the kitchen where you’re still holding your hand under the stream of water.
“Okay,” Aaron sets the kit down on the counter, opening it and then turning off the tap. “Let me see, honey.”
The word melts into you, sticky sweet, and you hold your hand towards him, palm up.
He starts by drying your hand with a piece of paper towel, pressing your skin lightly. His other hand is under yours, his palm against the back of your hand a painkiller in itself.
You hiss when he hits a sensitive spot, and he’s quick to apologize, his voice low and quiet. “Sorry. I’m sorry. Almost done.”
“It’s okay, Aaron. It's not your fault I thought I was heat-proof.”
“You’re cute.”
A smile spreads over your face, your head tilted down to stare and his hands around yours. You watch him spread some Polysporin over your burn, his fingertips featherlight over your skin, soft apologies leaving him every time you flinch a little.
By the time he’s done, the first aid kit shut on the counter, you’ve both forgotten about the rest of the team in the next room. Aaron’s happy to bask in your sunshine.
5K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
James Potter x muggle fem!reader
Summary: Three weeks after his devastating break up with Lily, James wanted Remus and Sirius to bring him to a muggle bar in central London.
Genre: Fluff / prequel to my fic Timeless / pt.2 Sweeter Than Fiction
Warnings: swearing, mentions of injury, intoxication
Remus has warned him him has always had a flair for the dramatics.
"I mean, why did I even like her?" James slurs loudly as he slams his whiskey glass onto the counter, white foam spilling over his hand, and he curses.
Remus rests his hand on James's arm to shush him and he glances over at Sirius with a concerned expression for their friend. "Prongs, you promised you were okay," his eyebrows quirk and, crossing his arms, he looks at James with a saddened expression.
James's eyes just narrow and he nods his head furiously, "I am okay," He insists, "I just don't understand why – "
When James flings out his arms in exasperation, his hand accidentally collides with your hip as you pass by. All the wine glasses you had been balancing on your tray suddenly shatter to the ground with a loud crash. Sirius and Remus hurry to stand as the spilled alcohol barely misses their trousers.
"Oh my, I'm so sorry," You say, clearly embarrassed as you kneel down and frantically pick up the shards of glass as everyone turns to stare.
"Woah," James cries as he jumps up. Just as he starts to warn you not to hurt yourself, you cut your palm and hiss in pain. James is immediately kneeling next to you and, with a movement unusually delicate for someone so drunk, moves to hold your wrist in his hand, "Shit, that looks nasty." He mutters.
You look at him, "Yeah, it hurts like a bitch," you say plainly and stand. James drops your wrist. Sirius hands you a napkin and you press it to the wound.
James stands next to you now and you look at all three of them. "I'm sorry again, I hope I didn't spill any on you. Shit, I'm gonna lose my job for this," you look away, your hair falling in front of your eyes as you groan.
"No. Don't worry. We aren't hurt or anything, right guys?" James exclaims, again a little too aware for someone so drunk and slaps Sirius on his back.
Sirius frowns and sends him a knowing look but smiles at you reassuringly as Remus nods. "So, you really shouldn't get in trouble and," James adds, "Hey, I don't think you're okay…" His train of thought seems interrupted by the amount of blood on the napkin.
You glance down, eyes widening, "Oh, shit yeah," you tilt your head up, feeling heat rise in your cheeks, and look at them bashfully, "Fuck, ah—sorry I keep cursing. This just hurts a lot. I think I have to clean go it."
James eyebrows crease for a moment as he watches you turn around and quickly walk away, the bloody napkin still pressed to your hand.
"Oh," his eyes light up like a child when you turn around and address them over the loud bar, "Thank you," you say with a smile and while he's unsure why you're thanking him, his stomach fills with a thousand butterflies.
"You're doing it again," Sirius mutters, sipping his drink as he stares at his friend.
"Hmm?" James doesn't tear his eyes away from you until you disappear behind some curtains into a back room.
"You have that look on your face, the one you wear right before you do something stupid," Remus finishes sternly.
James's eyes roll, acting less drunk than he seemed earlier. Almost as if you sobered him up a little.
"Oh please," he lies, "When have I ever done anything stupid?"
* * *
James leans against the brick of the building, a cigarette in his mouth. His cheeks are flushed from the cold air as he looks around. The street is dimly lit and barely anyone is around at this time of night.
He smiles as he pulls the cigarette from his mouth. He had convinced Remus and Sirius to let him have a smoke outside. Something told him you would be out here. James has always been lucky with that sort of thing.
Tonight proves him right because he sees you leave out the backdoor. Your hand seems to be bandaged as you delicately shut the door. You're bundled up in a scarf and a coat that looks a little oversized. James wonders if that means you have a partner. He moves away from the wall and walks over.
"Hi," he clears his throat, making you jump.
You turn around and he can tell you're trying to recognize him in the darkness but then your eyes widen. "Oh, hi!" you exclaim, your voice coming out a little squeaky as you push down your scarf a little. "Can I help you?" you ask him.
James smiles and shakes his head. "I just wanted to apologize," he pauses when he sees your expression shift into confusion, "I'm the one that caused you to slip and hurt yourself. Here?" he adds and holds out his hand to sit on the curb.
He can tell you hesitate to follow him. Understandably. You don't take his hand but you walk with him further away from the building. You sit down and James leans his hands on his knees as he looks at you. "M'name is James. Potter, James Potter."
You laugh, smoothing a hand down your jeans, "You say that like James Bond," you smile but your smile drops when James doesn't look like he understands the reference. You don't mention it. "My name is Y/n Y/l/n, it's nice to meet you, James Potter."
"I hope you don't mind me asking this but you aren't fired are you?"
You shake your head, "Oh, no, thankfully." You look up at him a little bashfully, "I was just more worried than I should have been. I'm not the best at this job."
"Mmm, don't say that. You wouldn't have dropped the tray if I hadn't bumped you," James says reassuringly.
"I'm just clumsy," you chuckle. James smirks a little and tilts his head.
"Do you want to go out tomorrow? I know a good restaurant." He says it so bluntly you can't help but stare at him like he's grown two heads.
"What?"
"I wanna take you out," James pauses, backtracking as his cheeks burn pink, "If you'd like."
Your mind seems to be racing uncontrollably and James feels a little guilty. He doesn't want to pressure you. Could he have misread something? Or maybe he'd just imagined it all.
He stands up and dusts his pants. Usually, James wouldn't be one to up so easily but if he'd learned anything from Lily — persistence isn't the way into someone's heart.
"Wait," you stand up with him, looking into his eyes, "I would love to go out with you." You smile so wide your eyes squint and something in James's chest stirs as he can't help but smile at yours.
You laugh and it's contagious. Then, you walk up to James and rummage through your bag. Once you find your pen you scribble your number onto his palm with difficulty. "This looks much easier in the movies," you mumble with the cap in your mouth. James chuckles, looking at his palm to make sure he can read every number clearly.
"Call me?" you whisper, tucking your pen back into your bag as you look up at James.
"I will," he says, and one day later (he only waited that long because he couldn't figure out how to work the muggle phone) he does.
1K notes
·
View notes
⎯ ⊱ 𝐃𝐄𝐀𝐍 𝐃𝐑𝐀𝐁𝐁𝐋𝐄𝐒!
Part 1 of Satiated Desire.
adult content | minors do NOT interact.
Pairing. Dean Winchester x Female Reader.
Outline. Where you accidentally give Dean a hard on during a hunt.
Warning(s). Sexual tension, Strong Language, Sex innuendos, & Implied Smut.
Word Count. 207
Authors Note. He's been running on my mind all day and I needed to let my thoughts run wild. So enjoy — you'll definitely thank me later! 😉
The hunt had taken an unexpected turn, leaving you and Dean pressed up against each other, your back flush against his chest. You shifted slightly, trying to get a better vantage point, when you felt Dean's grip tighten on your hips, holding you in place.
"Dean, what—" you began to ask, but the words died on your lips as you felt something hard pressing against you from behind. Your eyes widened in realization, heat creeping up your face.
"Shit, Y/N, I'm so sorry," Dean murmured, his voice strained. "I-I didn't mean for that to happen."
You whisper to Dean in his ear, "We'll deal with this after the hunt, okay?"
He nodded mutely, your heart racing, already imagining ways to help him with his...situation. A small smile played on your lips as he replied, "You're the best, Y/N," he murmurs, hearing the mix of relief and anticipation in his voice.
"Of course, Dean. I've got you."
Dean let out a shaky breath, his grip on your hips tightening ever so slightly.
With that, the two of you turned your focus back to the hunt, both eagerly awaiting the chance to properly address the growing tension between you.
1K notes
·
View notes
Babe congrats on quitting!!!
I live coworker!James sm he is so lovely and i cant heló bit asking for more
R having a bad day and James doent know until he teeases her and she just like opens up to James a bit more?
thank you!!
You can’t escape Remus’ sweet questions of concern, though he’s tactful. “Are you sure you’re okay?” Remus asks, James a haunting somewhere near the customer complaints desk.
“I’m fine.”
“You really don’t wanna come to dinner with me?”
It’s a nice offer, but Remus is part of a package deal, and he’s the only one of the three who isn’t exhausting; Remus’ boyfriend Sirius is well meaning but so beautiful and so alarmingly aware of it, while James is all those things too, but much less subtle about it. “I’m too tired for the walking, thank you. I’m just gonna stay here and eat my sandwich in slow bites.”
Remus laughs, wrapping his scarf tight around his neck. He doesn’t tuck it under his coat. Sirius will do that for him. It’s heartbreaking to see every day, a reminder of real love in the world that will seemingly never touch you, but it’s cute too.
James rockets back to his desk. He’s always in a hurry. Half-frantic, he pulls his rucksack from under his desk and unzips the main body. To your horror, he unveils a large Tupperware of white rice, asparagus, and what looks to be chicken thighs. Next comes his portable knife fork.
He notices your watching. “It’s just rice and chicken,” he says defensively.
“No, I’m not–” You shake your head. “Not about what you’re eating. Eat what you want, James.”
“Don’t I always?” he asks. “Not about what I’m eating. Your general look of disgust and disdain is to do with something else, then. Did you accidentally look in the ladies bathroom mirror again?”
“It’s nothing.”
James tucks his chair in, face paused, hands hesitating at the sides of his dinner and then flat to the desk. “Hey, is something wrong?”
Maybe his comment before struck a nerve. Maybe you’re having a terrible day, and everything’s piling up, and you can’t be expected to keep in your feelings forever. Or maybe you’re dumb. “Guess I did look too long in the mirror,” you say.
“You’re upset?” he asks, startled.
You shake your head vehemently. Slow. “I’m just having a bad day.”
“What happened?”
You stare at him for a moment, take in the concerned twitch of his brows as they pull down and in, the set of his nice mouth, remarking to yourself on how the snarky sarcasm erases itself from his expression so quickly, leaving behind a boy with a very sweet face.
His hand curls into a loose fist. “You don’t have to tell me.”
“I don’t know if you ever get this, but sometimes I,” —your face goes white hot suddenly, an acknowledgment of the powers over you you’re giving him in needing reassurance— “look at myself and I feel a bit off. And I thought if I had lunch by myself I’d have time to not be looked at? Um. Which is why I was unhappy. Not because of you.” You frown at him. “You do make me unhappy, though.”
He pretends to laugh at your weak insult, which is generous. “So you actually did get upset looking in the mirror? Shortcake, I was kidding about that, it's not like it makes any sense.”
You frown at one another. “Why not?”
“Because you’re nothing worth being upset over?” James suggests. “You’re pretty. You know you’re pretty.” He points at you with his fork. “You do know?”
“No,” you mumble.
“I’m not telling you again,” he says, looking strangely as though he’d quite like to tell you again.
“I’m consistently below average.”
“Where? Do you have an address? I must go to this place where you’re the standard.”
Something weird and queasy summons to life in your chest, before levelling into a surprising pleasure. That was definitely a compliment, and from James, though annoying he might be, it means a lot. He’s outrageously good looking, after all, and especially when he smiles, which is nearly constant. He’s smiling now with the fondness of someone who knows you better than he actually does.
He ruins it rolling his eyes. “You’re ridiculous. Which I’ve come to expect!” he says, sliding a thumb under the clasp of his Tupperware. “Why would you think you’re not lovely? To look at, that is. You’re a huge pain otherwise.”
“That’s uncharacteristically mean, even for you.”
“I’m balancing it out. Want some asparagus?”
You excuse yourself for a quick trip to the bathroom, where you mouth questions at your reflection of the puzzled variety. Has James been replaced by a body snatcher? Or are you finally seeing the version of him everybody else in the office seems to know?
When you get back to your desk, your figurines have been upended by a ‘freak earthquake’. He’s back to normal.
611 notes
·
View notes
I'm not 100% sure how to articulate this, but something that has been bothering me about I/P discourse (especially in the last month, it's gotten so much worse) that I haven't seen talked about in a productive way is the "yoking" effect that the extremist ugly takes create for the good-faith people just trying to talk about their issues. And I see it on both sides, and have felt compelled to act this way myself.
Essentially, when I talk about antisemitism (especially the significant spike in the last month), my goal is focused on educating people about the antisemitism and urging them to do something about their own behavior, help groups that are working on it, and/or become part of the people working on advocacy to that effect. I just want to talk about the antisemitism, and have that stand as a topic on its own terms. But the problem is, I'm a Jew and extremists on both sides have made it so that anything I post about this requires disclaimers that I also support the rights, freedoms, and care about the lives of Palestinians also. And I do! But that's not the point. The point is that Jews facing antisemitism should be able to talk about this without bringing in a whole separate topic to prove we're worth listening to. And I saw this with Israelis trying to talk about the grief they were feeling after the Hamas pogrom; they couldn't do it without either including some kind of statement about wanting peace, separating Hamas from Palestinians as a whole, etc. or face relentless antisemitic abuse.
And this effect comes both from outside people [supposedly] supporting Palestine being awful unless the Jew in question attaches sufficient disclaimers, as well as [supposedly] pro-Israel people who couldn't help themselves from spouting off dumb racist shit in their posts on otherwise valid topics.
But as I've watched things play out, and Western outsiders become more and more antisemitic in their [supposed] support of Palestine, I've noticed Palestinians and their not-antisemitic allies having to couch their [valid] criticisms of Israel with caveats about how antisemitism is not okay, or else face harassment when talking about their legitimate issues - even ones that aren't about Israel at all.
That's what I mean by "yoking" - this inability to talk about ourselves and our own issues without bad faith actors coercing us to address the other and "prove" that we're worth listening to. It's dehumanizing, because it means that our legitimate issues are always and only ever able to be discussed in the shadow of the other. They aren't allowed to stand on their own without risking harassment.
Anyway, I think the reasons we got here are complicated, but I lay most of the blame at the feet of uninvolved westerners using this conflict as a proxy for their own problems. I don't know that there's a way to fix this at this point, either, because the discourse has become so unbelievably toxic. I think the closest thing I've got is just the suggestion that if you see a Palestinian (or ally) talking about Palestinian issues and not being antisemitic about it, don't derail what they're saying even if they don't specifically denounce Hamas outright and/or antisemitism in their post. And if Jews (including and especially Israelis) are talking about antisemitism and/or legitimate issues and aren't being racist or Islamophobic about it, don't derail what we're saying even if we don't offer caveats denouncing the Israeli government and/or Islamophobia/anti-Arab racism in that specific post.
We can support each other in the face of danger and want peace without having to constantly be forced to talk about other issues and divert focus from our own issues.
1K notes
·
View notes
feelings on fire (joel miller x f!reader) 18+ PART EIGHT
previous chapters | yall are absolutely fucking incredible. truly. i never could have ever expected the response to the last chapter and i'm so so SO grateful to everyone who's been contributing their thoughts and theories over the past week. your engagement and passion for this story means the world to me. so many people wanted so many different things for this chapter and i know i can't please everybody, but i hope this satisfies most of you. thank you so much for being here and for loving this story. here's my kofi if you'd like to leave a tip 💕
chapter summary: you don't know what to think after catching joel at the bar. tasha wants to help in the best she knows how - getting fucked up.
rating: 18+ explicit
warnings: age difference (joel is in his 50s, reader is in her early 20s), innocent/inexperienced reader, praise kink, dirty talk, pet names, mentions of religion, catholic guilt, sexual assault (nothing to do w joel), alcohol, almost penetration
word count: 13.6k
ao3
You've never felt like this before.
Tasha practically has to drag you into a cab, gripping tight to your hand with an arm around your back as she gives the driver the address of where you're both staying. He barely bats an eye to the fact that you're practically inconsolable, tears streaming steadily down your face as you gasp and sob and stare at the floor with wide eyes. He's probably picked up countless passengers in similar situations and it's not like you can bring yourself to feel any sort of embarrassment over it.
"Shh," she soothes you, still rubbing your back and peering down at you with empathy in her eyes, an expression that somehow makes you feel even worse - she'd told you this might happen. She'd known all along, but you hadn't wanted to believe anything she said about the lack of definition in your relationship with Joel. You'd chosen to believe differently, believe that he was different than the guys your friends have encountered.
How could you have been so stupid?
It's your own fault you're even in this position now, crying in the back of a cab while Joel makes out with some woman in a bar you don't belong in. Your own fault for putting any ounce of faith in someone else for once, for choosing to be blind to the obvious - of course he doesn't want you. Of course you're not his priority. You're not his girlfriend. You're his fuck buddy. You're a warm body and nothing more.
You don't speak for the entire drive, just cry and try desperately to control your breathing. By the time you reach the Airbnb your throat hurts from the sobs, although throwing up on the sidewalk could also have something to do with it. You're just a mess, lightheaded and distant as Tasha guides you into the house and helps you settle on the couch.
"Stay here," she says softly, grabbing a throw blanket and carefully covering your loose and exhausted form, "I'm gonna go get some necessities, okay? This place doesn't have shit."
You nod slowly, just to let her know you acknowledge her words, though you're unsure exactly what necessities she's talking about. She reaches her hand down and strokes your cheek, still looking at you with that sad expression.
"I'm so sorry, honey," she repeats to you for probably the fortieth time in the past hour.
You close your eyes; you can't stand to see the pity on her face.
--
Tasha returns shortly after with her "necessities", which mainly consist of junk food and alcohol. You haven't moved an inch from where she'd left you, still laying on the couch with bloodshot eyes and a quivering mouth. You listen as she busies herself in the kitchen, putting together some sort of snack platter for the both of you that you already know you won't eat. You're not hungry. You've never been less hungry in your life.
"You were right," you finally manage to croak out as she seats herself beside you on the couch, placing the food on the coffee table and turning to you with that familiar look of pity, "He's just like the rest of them."
She shakes her head, "No, that's not true, I never said that," she rips open a bag of chips and starts munching, seemingly lost in thought.
"Oh, we're gaslighting now, are we?"
She raises an eyebrow, "Girlie, tell me when I said what you just said."
"Boys are mean," you quote hastily, turning a bit on the couch to stare up at the ceiling.
"Yes, it's true. Boys are mean. And so are men," she sighs then, dropping the chips back on the table, "Look, I'm not defending him, I promise, but-"
"Tasha," you state coldly, still staring at the ceiling, "Do not continue that sentence."
"You don't even know what I'm gonna say."
"Yes, I do," you shut your eyes and bring your hands to cover your face, feeling the tears starting up again, "You're gonna tell me we never defined what we had, that he was never my boyfriend, that this can't constitute as cheating because there was no relationship to begin with."
She's quiet but you can still feel her looking at you with that sadness, that sympathy, the look of someone who's been here before and knows how it feels. And it makes you so angry. Because-
"Joel wasn't supposed to do this," you continue, softer now, voice shaky as the tears flow down your temples and into your hair, "He's not a boy, he's not like the guys you date. He- he was different, I-" you choke, throat tightening at the thought of him, the image of him with her at the front of your mind again, "I thought he- I thought that we-"
You can't continue, words turning into cries and sniffles turning into sobs. You feel Tasha's hand on your calf, stroking your skin gently despite the fact that you just criticized both her own judgement and her taste in men in the same breath.
"I'm not trying to hurt your feelings," she says soothingly, "That's the last thing I wanna do. If anything I'm trying to tell you that this doesn't necessarily make him an asshole."
You scoff at that, "Right. Makes sense," you finally pull your hands down to look at her through your tears, brow furrowing, "Tasha he was kissing her. That- that woman, he was- he touched her face."
"I know he did," she murmurs with a frown, eyes casting downward, "And I know it hurts, but-"
"But nothing," you find yourself tossing the blanket to the floor and standing up shakily, not bothering to even look at Tasha as you stomp toward the bedroom. "I don't need this right now," is the last thing you say before slamming the door behind you.
She doesn't follow you. This is the first time you've ever yelled at her, the first time you've ever felt truly mad at her, and even though you know deep down that this isn't her fault... you still feel betrayed. Betrayed by Tasha's nonchalance, betrayed by Joel's actions, but worst of all - betrayed by yourself.
Because how did you manage to get into this mess in the first place?
You practically rip the too-tight and too-short pink dress off your body and stagger to the bed, not even bothering to pull back the covers. You still feel sick, lightheaded and woozy as you press your face to the cool pillow and try to collect yourself. You can't get the image of the woman out of your head; you hadn't even seen her face and yet it's like she's somehow consuming every fiber of your being. All you can see behind your closed lids are those long, perfectly styled braids hitting her bare waist, skin a deep and rich brown that almost sparkled under the bar lights, the way her bare ankle traveled up and down his leg, the soft curve of her cheek as he'd cupped it in his hand-
A sob wracks through you and you pull the other pillow toward yourself, wrapping your legs and arms around it like a koala, remembering how less than twenty four hours ago you'd been in a bed just like this one - except it hadn't been a pillow you were cuddling. And now, what? Who's in that bed now? Another woman? That gorgeous woman who you don't stand a chance against?
You're sure Tasha can hear you crying but she doesn't come, staying in the living room and giving you the space you need. You already feel awful for snapping at her like that - you know she means well, that she's just trying to alleviate the situation in her own way, but you barely even know how you feel about it.
And how do you feel? Hurt? Sad? Angry? Of course you feel all of those things, to a degree you've never felt them before, but underlying all of those emotions is something else entirely, something you can't quite put your finger on - or would rather not put your finger on, because doing so would mean finally admitting something you're not sure you're ready to admit yet.
You try to think about your relationship with Joel up to this point, try and pinpoint the exact moment it went from being something frivolous to being something real, but you find that it's impossible to do so. For you, you could say the moment you walked past his threshold was when it became official. Or when he touched you for the first time. Or when he kissed you. When he made you come. When he called you his babygirl. When you touched his cock. When he put his mouth on your pussy. When you woke up this morning completely naked in his bed.
Any of those moments could have been the moment. But a gnawing voice in the back of your mind reminds you that any of those moments could have equally not been the moment as well. Maybe there was no moment. Maybe this really has just been a whole lot of nothing.
But then you think about the way he looks at you. The way he treats you.
The way he'd comforted and reassured you last night, held you, made you feel safe and secure - "If you just wanna lay here with me, that's okay too."
The way he'd shared his insecurities with you over the phone, been vulnerable, honest and open - "I don't want you to look at me differently".
The way he'd dressed up just in case your mother took you to your lesson, looking like he was ready to attend a church service, purposely putting himself in uncomfortable clothing to make sure things went smoothly - "I wanted to make a good impression."
The way he'd told you about his past on his back deck, related his own childhood to yours, tried to calm your own fears and tell you things would be okay - "You gotta focus on what's right for you, on livin' the life you want, not worryin' about what they'll think".
What did any of it mean? What does any of it mean? Has it just been sex this whole time or does he actually care about you? And if he does, why would he kiss someone else?
And what if he's been kissing someone else... fucking someone else... this entire time? What if it's not just you he's been seeing? The thought makes you want to throw up all over again.
You hear a peal of laughter from the other room, a sound that feels odd in the silence and sadness of the bedroom where you lie. Tasha must have put on a movie or something. You feel bitterness rise in your throat, a sudden urge to run out to the living room and grab the remote and toss it out the window, scream at her for finding something to laugh at when you're literally falling apart at the seams.
But the bitterness fades when you hear her laugh again; you love that laugh, have missed it ever since you came home. Tasha has always had such a free and fun way about her, a natural joy that you've always envied. You'd watched her go out night after night over the past three years, come home with the most bizarre stories that you were never able to fully relate to, and yet she always tried to include you in some way, ask you questions, make you laugh.
You remember the looks of shock you'd received from the other girls when you'd first shared that you were a virgin, that you'd never done anything except kiss. She'd sensed your discomfort immediately, seen your embarrassment, and had quickly flipped the conversation to something else more shocking, more embarrassing - at her own expense. Easier than flipping a light switch. And any time it was mentioned after that, she'd always emphasize how lucky you were, how she wished she'd taken her time, how all you were missing out on was bonehead losers who didn't know how to please a woman.
She's always reassured you, always listened, and has always been your number one fan, even when you had nothing to give. You'd told her all about your upbringing, about the way you'd begun to question everything, and she'd given you her own two cents and made you feel better for the first time in a long time. And when you'd told her you were coming home for the summer she'd said, "Are you sure that's gonna be okay for you?"
You trust her. So why are you in this room avoiding her? Why aren't you listening to what she has to say?
With heavy limbs you manage to climb off the bed and tug on your pajamas, wiping your eyes and letting the sadness and humility settle for just a moment. Yes, this is a fucked up situation. But Tasha wants to help you. Let her.
A few moments later you find yourself back on the couch, this time with Tasha's arm around you as she pours you a glass of wine and shakes away your apology. "You have nothing to be sorry for," she tells you softly, "You're upset, I get it."
You sigh deeply and take a sip, wincing at the bitterness but making no move to put it back on the table. "So," you murmur hoarsely, "Why is he not necessarily an asshole?"
--
You stay up late talking for hours about the situation and listening to Tasha's theories, most of which center around a lack of communication - based on her own personal experiences. She also has to factor in the fact that Joel is a lot older, a detail she's still beyond surprised over.
"I just can't believe he's fifty six," she faux whispers the number with wide eyes, shaking her head. "Like... this man knows things. How to take care of you, ya know? You're luckier than you realize."
"Lucky," you scoff, "Yeah, that's one way to describe how it feels."
She slaps your hand playfully, "I'm serious. This is yet another reason I think you just got your signals crossed here. I refuse to believe he's trying to hurt you, especially after how considerate he's been with you up until this point. If this was just about sex he would have dropped you ages ago, honey. I mean, no offense but you're not exactly making it easy for him, are you?"
She's certainly blunt. But she's also right. Joel has been nothing but patient with you this entire time, never expecting anything more than what you've been willing to give. If it was just about sex, this thing between the two of you wouldn't have gone beyond that first day in his house when you'd told him you were a virgin.
You slowly begin to come to the conclusion that you should give him the benefit of the doubt. As much as what you saw hurts, as much as it makes you want to crawl in bed and never get up, you were never Joel's girlfriend. There was never an establishing conversation, never a moment where you laid your heart on the line and told him exactly what you wanted, mainly because you haven't been sure what you wanted up until this point. But now you do.
"Communication," Tasha repeats for maybe the fifth time, "Communication is key. He doesn't know what you want, so you need to tell him. You need to stand up for yourself. And if he doesn't take you seriously, you move on. Simple."
"Simple," you echo, your third glass of wine already getting to you as you peer at her hazily with an upturned brow, "Communication."
"Communication," she repeats, "Simple."
Communication. Simple.
It's what echoes in your head over and over after your head hits the pillow that night, and continues to repeat the following morning as Tasha rouses you from sleep to get you ready for your "lesson". You don't feel as hungover as you'd expected - "That's because we didn't get totally fucked up like we were supposed to," Tasha says to you with a roll of her eyes - but your face is puffy from all the crying.
You're splashing your face with cold water when you hear Tasha call out, "Hey, I think you have a text."
Heart pounding in your chest you run back to the bedroom and grab your phone from the nightstand, the first time you've checked it since you got back from the bar. Your eyes go wide when you see not just one but two texts from Joel. One from last night, around midnight:
Hope you're having a good night, babygirl. You deserve to have some fun. I'll see you tomorrow. Be safe.❤️
And one from this morning, around seven:
You get home ok? Let me know x
"Don't text him back," Tasha advises over your shoulder, "Keep him sweating a bit, you're leaving soon anyway."
You nod slowly, still staring at the messages, especially the one from last night. When had he sent that? Had he still been at the bar? Still with her? Did he take her home? That familiar sadness and betrayal from last night bubbles in your throat again, tears pricking in your eyes.
No. You will not cry anymore.
You let your phone fall onto the bed and turn on the spot, marching back to the bathroom like a woman on a mission.
"Tasha, make me fucking hot."
--
The Plan: Go to your lesson with Joel. Talk to him about what you saw. Tell him how you feel. And look good doing it.
Communication. Simple. It certainly seems easier said than done; you've never been very good at communication. Your whole life has been spent suppressing your true feelings and your true self for crying out loud - the concept of being completely vulnerable and honest with someone is terrifying. But you know that it's necessary for your heart, and you also know that if you're going to be able to be vulnerable with anyone, it's Joel. He's already seen glimpses of the broken parts of you, not to mention seen you completely naked. How much harder can it get?
And nothing can be worse than how you felt last night.
Tasha essentially makes you her very own doll for the majority of the morning - doing your makeup, styling your hair, choosing your outfit - and you're surprised to find that you don't hate any of it, have no notes or critiques or changes to make. You stand in the bathroom staring at yourself in the mirror with your eyebrows raised, lips parted in admiration at a job well done.
"I look good," you say with a smile, and Tasha grins at your reflection, "I mean it, Tasha. Like, I still look like me, but..."
"All I did was accentuate what you already have, my love," she replies, reaching forward to fix a piece of hair that's not sitting quite right, "You're just a gorgeous human, inside and out."
You can't help but feel touched at her words, lips turning down into a pout as your hands come up to touch your heart, "Tasha-"
She waves you away, shaking her head, "Bitch, do not get sappy on me right now. Save those doe eyes for Mr. Miller."
Twenty minutes later you're winding through the suburban streets of your neighborhood. You're about half an hour early; Tasha had wanted you to be fashionably late but there's only so much of yourself you can alter in such a short amount of time, your punctuality being one of them. You figure you'll just drive around for a bit to build up your courage, plan out your words.
Joel, I saw you at the bar last night. I saw the woman. And I'm not mad, I'm just....
Joel, my feelings were really hurt last night...
Joel, I can't believe you would kiss another woman after everything we've been doing. Do I not mean anything to you at all? Do I-
Nothing really seems like the right thing to say. You figure once you're standing in front of him the words will just come naturally, flow easily in a way that makes sense and articulates your feelings properly. You can only hope.
You've still got about fifteen minutes before your lesson but you figure there's no point in continuing to circle the area - you're just delaying the inevitable. With a heavy sigh and a few quiet words of encouragement directed at your rearview mirror, you turn onto Joel's street, gripping the wheel tightly and trying to keep your breathing as even as possible. You can do this. You can do this.
You're a few houses down from his when you see it.
Panic turns to shock. Shock turns to confusion. Confusion turns to anger. Anger turns to sadness.
You're already pressing Tasha's number in your contacts before you can fully collect your thoughts.
"What is it? Did you go in?"
"There's a car in his driveway," you hiss through your teeth, feeling the tears spring to your eyes again, your hand coming up to cover your mouth, "She stayed the fucking night, Tasha. He fucking slept with her."
"You don't know that," Tasha replies quickly, calmly, already trying to calm you down, "Maybe it's his, maybe he has another car."
"He doesn't have another car, Tasha," your voice is stoic despite the lump in your throat, "He has his truck and that's it. Joel Miller doesn't drive a purple fucking convertible."
"A purple convertible?" Tasha repeats, voice faltering now, processing the information, "Jesus Christ."
You stare at the driveway, at the car in question - you're still a few houses down so it's hard to see any specific details, but you're sure you can make out a pair of fuzzy dice hanging from the mirror inside. This is definitely not Joel's vehicle by any means. Your stomach is in knots, unsure what the fuck you're supposed to do now; you'd thought briefly of the possibility that he'd slept with her, and up until this moment you'd been prepared to hear him admit it to you. But you hadn't expected it to really be true, to almost come face to face with the woman herself.
"I don't understand," Tasha suddenly says on the other line, "He knows you're coming for your lesson, why the fuck would he still have her in the house?"
"I don't know," your voice is almost a whisper, thick with sadness and disbelief, "I- oh shit." You cut yourself off and sink deep into your front seat when you catch the front door of his house opening, eyes going wide as you watch two figures emerge out onto the front step.
"What's happening?" Tasha asks frantically - you can practically hear her pacing on the other end, "Talk to me!"
"They're coming out!" you hiss, "They're on the fucking front step."
"Oh, honey, you gotta leave. You're not gonna wanna see this, you need to just turn around and come back," her voice is full of disappointment, anger that mirrors your own, "I'm serious, this is just-"
"Shhh," you peer over the dashboard at them, squinting against the sun. You can make out Joel's broad back in the early morning light, can recognize one of his band t-shirts and his signature bedhead, pointing in all directions. You can see him, but it's difficult to make out the figure he's with, his body blocking her almost entirely from you. "I think she's leaving."
You watch with a mix of rage and horror as he suddenly leans down and wraps his arms around her, her own winding around his broad form as her hands interlock together behind his back. Your eyebrows raise in confusion, mouth dropping open.
"It's not the same woman," you whisper.
"What do you mean it's not the same woman?"
"Literally that," you breathe, shaking your head and feeling a few tears begin to make their way down your cheeks, "It's not the one from last night, it's someone else."
"How do you know?"
"Because the woman last night was black and this girl isn't, I can see her arms," you snap, a sob threatening to burst its way past your lips, "And this one's shorter, he has to bend down to hug her."
"To hug her?!" Tasha echoes, "What the fuck?"
You watch as they separate from one another, watch with rage burning in your chest as she walks down the steps toward her car. You can see her better now, get a good look at her in the few seconds it takes her to reach the driver's side door. She's wearing a pink dress, frilled at the bottom with a pair of white sandals - she looks young. You're already redacting your prior statement about her not being black - now that she's properly in view, you can see the brown softness of her skin, her afro textured hair plaited neatly into two rows. But it's not the same woman.
"So, what, he had two girls in one night? Is that what you're telling me?" Tasha is saying in your ear while you continue to stare at the woman, watch her open the car door and climb inside with one last wave to Joel, "Hello?"
"I - I don't know. I'm-" you watch Joel wave to her and then head back inside the house, presumably to wait for you to arrive. Your stomach is tight and painful, bile in your throat all over again. "You were right," you whisper, tears cascading down onto your bare legs, "I didn't need to see this."
--
So much for not crying anymore.
You're back on the couch again, wrapped up like a burrito staring at the wall while Tasha paces back and forth around the living room in front of you, talking a mile a minute.
"It was a whole different story when it was just the one girl," she's ranting, hands on her hips and eyes narrowed in anger, "But two? Two girls. In one fucking night. And one of them is half his age," she scoffs, almost a growl, "So what, he just does this in his spare time? Fucks around with girls' hearts and bodies and then acts like some tough, macho contractor with a busy schedule? Please."
You don't need to remind her that you're also half his age - you know she'd come up with a reason why you're different, why you're the exception. And you do appreciate that, but the more she talks the more you're starting to realize that maybe that's never been the case. Maybe you weren't some beautiful coincidence that wandered into Joel's life - maybe he's been doing this for a long time.
Your gaze follows her as she walks around, pacing the same circle over and over again around the coffee table; it's typical Tasha - you've seen her do this on numerous occasions before, but never on your behalf. Your phone suddenly vibrates on the table and your heads both snap toward it, plunging the room into silence. You already know it's him - who else would be texting you this early? You reach over and unlock it, eyes scanning the message:
Where are you?
"He's wondering why I haven't shown up," you say quietly, voice still hoarse from all the crying.
"What a fucking prick. Do not reply," she resumes her pacing, "Two girls the night before he's supposed to have a date with you. Who does that? Who actually does that? Men, that's who. Men do that. I'm swearing off them forever after this. Seriously, I mean it. What the fuck."
You appreciate her concern, appreciate that she's no longer arguing on Joel's behalf, but her words cut you deep regardless. The whole situation still feels surreal. How is it that just over twenty four hours ago he was kissing you softly, sweetly, peering at you with those beautiful brown eyes and telling you he had something special planned for your lesson? What had he wanted to try, a fucking threesome?
"I don't know him at all," you whisper softly, sadly, "I never did. He's a stranger. A complete stranger who I was stupid enough to trust."
Your words seem to touch something in Tasha. She stops her pacing, slowly turns toward you with that empathetic look again and then carefully steps toward the couch, sitting down on the end.
"He just... he was there," you continue, lip trembling, "My parents were being so controlling and I was literally thinking about just... just leaving, finding some way to get back to campus without them knowing and then I heard that fucking guitar and-" you hiccup through a sob, clutching your hand to your chest, "I should've known then. I should've just kept walking. He asked me to come in, Tasha. He wanted to fuck me, then and there. And when I said no I guess I... I became some sort of challenge. Just a stupid, naïve little Catholic girl he could fuck and dump. And I fell for it, hook line and sinker."
She places a hand on your calf, just like she had last night, stroking gently up and down, "You're not stupid," she murmurs, "You're just a girl. A girl experiencing something really special for the first time. And I'm sorry he took that experience from you."
You manage to smile at her, soft and sincere. Despite everything, it feels good to have a friend, to not be alone when you're feeling like this. To be validated and comforted. You have no idea how you'd be processing all of this without Tasha by your side, if you'd have even been able to leave your bed this morning.
"This is so not what I wanted this weekend to be," she suddenly sighs, putting her head in her hands, "I wanted you to have fun, be free. And here you are feeling like shit about yourself. It's not fair."
She's right. It's not fair.
You take a deep breath, then carefully pry yourself out from underneath your blanket, rolling off the couch and coming to stand in front of Tasha with a determined expression on your face.
"You didn't dress me to the nines just for me to cry and feel sorry for myself on the couch," you say confidently, doing your best to wipe away your tears without completely smearing away Tasha's hard work, "I don't wanna think about Joel anymore. I don't wanna cry about Joel anymore. You know what I wanna do?"
She looks up at you, a grin slowly spreading across her face, "Go have fun and be free?"
"Abso-fucking-lutely."
--
You never thought you'd be the kind of person to go day drinking, but here you are. Tasha had fixed your makeup and then gotten all dolled up herself, ready for a whole day of doing exactly what you'd both set out to do this weekend: have fun.
Your first stop is a little bistro within walking distance of the Airbnb; you already know that neither of you will be fit to drive by the time this is all over, so you stick to places that are relatively close to the house. As you sip your cocktails and dig into a plate of sandwiches, Tasha informs you that she'd purposely booked this house in particular because of its proximity to the local club scene - you're not surprised in the slightest.
Your phone vibrates a few times while you're eating but you don't check it, forcing yourself to avoid reading anything else Joel has to say to you. It's only when it actually rings, two cocktails deep and plate empty, that you briefly consider picking it up.
"Nope," Tasha says, grabbing the phone from you and canceling the call before you can answer, "No more Joel today, we agreed."
"No more Joel," you repeat, nodding. You let her slip your phone into her own purse after putting it on silent - you know she'll keep it safe, and you know it's for the best.
--
You spend the majority of the afternoon popping in and out of local bars and boutiques, shopping and chatting to your hearts content as your body adjusts to the constant thrum of alcohol running through your system, making your head a bit foggy in the best way. It's like nothing really matters except this moment, right now, the beat of live music here and there as the sun gets lower in the sky, the conversations drifting past, the smell of food wafting out of restaurants. Tasha is a constant presence at your side, arm linked with yours as she dishes on all the drama of her life you've missed thus far this summer.
You don't think about Joel.
It's obvious throughout your little adventures throughout the day that people - particularly men - gravitate to Tasha very easily. You're not sure if it's simply because of how gorgeous she is - all curves and plump lips and dark curls down to her waist, purple cowboy hat askew above her perfectly applied makeup - or because she's simply a light. She's so bubbly and completely herself, smiling and laughing and dancing, never apologetic or ashamed. It feels good to have a girl like that in your corner, helping you out of your shell, only wanting what's best for you.
You realize as the day passes that you're beginning to mimic her behavior a bit. Whether it's due to the alcohol or your admiration for her, you're not sure, but either way you can feel yourself loosening up, allowing yourself to be more uninhibited, less insecure, not caring if people are looking at you. And people are definitely starting to look at you.
"Dude over there is staring at you," Tasha says quietly to you as you sip margaritas on the back deck of a country bar. You're now wearing her cowboy hat, stolen it after what can only be described as a predictable turn of events where she'd rode the mechanical bull and lost it in one particularly hard buck. You'd picked it up off the floor and placed it on your head, laughing hysterically as the bull threatened to launch Tasha across the room.
"Where?" your eyes go wide as you take a long sip, waiting for her to point him out. She nods at something behind you and you do your best to slowly turn around, not wanting to be too obvious. In your drunken state, however, it's not very smooth. You almost topple off the chair as you spin in place to find who she's talking about.
Through your laughter you spot him. Typical young Texan - floppy blonde hair and a strong jawline, sun-kissed skin and a white smile that practically glimmers against the sunset. He nods to you when he sees you looking, tilts his head to the side a bit and winks.
You turn back to Tasha, shaking your head, "He is not looking at me," you feel your skin heating up, not just from the alcohol, "There's no way."
"He is looking at you," Tasha reiterates, placing her empty glass down on the table, "You're fucking hot."
Your mind can't help but flash back to freshman year, that godforsaken party when another boy with a similar appearance had looked your way. The hope you'd felt, the desire, the confidence... all of it fading when he approached and chose your friend to talk to instead, not even bothering to glance your way despite standing right there beside her. You can't help but worry that it's happening all over again.
But then you hear a deep voice behind you, southern and sexy: "Pardon me, but I just had to tell you, I think you're the prettiest girl I ever saw."
Your eyes widen and you spin back around, still half expecting him to be talking to Tasha, not you, but his green eyes connect with yours instead. His gaze holds you there, your lips parting with no words coming out as you stare up at him in shock.
"She was just telling me that you're not so bad yourself," Tasha offers with a smile, nudging you under the table with her heel, "Right?"
"R-right," you manage to stammer out, still staring open-mouthed at this gorgeous specimen that has somehow decided that you're the girl he wants to talk to right now. The prettiest girl he ever saw.
He smiles at that, toothy and beautiful, "I'm Noah," he puts his hand out for you to take and you do, grasping it tightly and trying to hold on to the reality of this moment, the way his soft skin feels against yours, the way your brain is buzzing with amazement - and tequila.
Tasha's foot hits your ankle again and you quickly splutter out your name, releasing his hand and awkwardly placing yours back in your lap. You feel the bare skin of your thigh and you're suddenly hyperaware of how exposed you are right now - this dress certainly doesn't leave much up to the imagination. Your thighs and breasts are practically spilling out of it, pink material clinging to your body. But he isn't looking at any of that - he's looking at your face.
"It's real nice to meet you," he says with another smile, "Can I buy you a drink?" he suddenly looks at Tasha, like he's only just remembered she's sitting there, "And one for your friend too, of course."
"She'd love one," Tasha answers for you, nudging her arm against yours gently, "We'll both have another margarita."
Noah nods once, sets his gaze to your face again with a smile, then disappears inside the bar to go order the drinks.
The second he's gone it's like you're released from some sort of spell he'd put you under. Your heart is suddenly pounding in your chest, breaths coming shorter as you turn to Tasha with utter horror.
"What happened to swearing off all men?" you hiss, brow furrowing.
"Please, Noah isn't a man, he's a boy," she scoffs with a smile, twirling her hair between her fingers, "And I know alllll about boys."
--
You don't know how it happens, somehow lost the plot about halfway into your second margarita, but Noah is going to the club with you.
You are drunk. You know this for a fact. You hadn't been expecting to already feel this fucked up upon setting foot in the club but here you are, Tasha on one arm and Noah on the other. Tasha's had just as much to drink as you but doesn't seem anywhere near as intoxicated as you feel, continuing to be her excitable self when the bass drops and the neon lights start to dance across her skin. She's stolen back her cowboy hat but you've somehow gained your own - you think it might be Noah's.
"LET'S DANCE!" she screeches, pulling you away from Noah and dragging you onto the dance floor. You watch with slightly blurred vision as he goes in the opposite direction, toward the bar, probably to order more drinks.
The music is loud, the dance floor full of people, bodies swaying back and forth, people jumping up and down, grinding on one another, screaming conversations over the heavy bass. The lights are bright and it feels like all of your senses have been heightened, like you can feel, taste, see, and hear everything in your immediate vicinity to the utmost degree. Your heart is pounding in your chest, but you can feel it in other places too - your feet, your kneecaps, your skin.
"I FUCKING LOVE THIS SONG!" Tasha screams to you, throwing her hands up in the air and spinning on the spot, smile wide and joyous as she starts to dance, "DANCE WITH ME, COME ON!"
Your senses are overloading but you try your best to match her energy, copy her movements, focus on just this instead of everything else that's going on around you. This is what you've been missing all these years; this is what you've been waiting to experience. Enjoy it. You let your inhibitions flow and just exist in this moment, having fun with your best friend, far away from anyone who would ever judge you for being here. Far away from your parents and your neighbors and Bethany and -
No. You do not think about Joel.
You and Tasha dance to about three songs before she's tugging you away from the dance floor and over to the bar, back to where Noah is leaning with a beer bottle perched against his lips. He smiles when he sees you approaching, gestures to the little mini drinks beside him, small enough to only have about a thumb of liquid in each.
"Shots!" Tasha squeals, clapping her hands together, "Shots, shots, shots!" She picks one up and hands it to you, then grabs her own, "Come on, Noah, do one with us!"
Noah still can't seem to keep his eyes off you, though you've begun to notice that he's no longer just looking at your face anymore. This time his eyes fall to your breasts as he puts down his beer bottle and replaces it with one of the shot glasses, gaze falling down to your legs before finding your eyes again.
You catch a glint of something darker there, something seductive, and as you bring the glass to your lips you're suddenly aware that beneath the alcohol you feel a bit... uneasy.
--
You're fucked up. You're really fucked up.
Tasha doesn't leave your side, something you're extremely grateful for. You're starting to have difficulty seeing straight, even walking is becoming confusing, let alone dancing. You grip Tasha's shoulders tightly on the dance floor as you both sway to the music, unsure exactly how long it's been since you arrived at the club. She's looking at you with hazy eyes, much drunker now than she was earlier, and your very intoxicated brain is wondering if you're actually going to leave at some point or whether you're just stuck here for the rest of eternity.
You can feel Noah against your back. He's grinding against you to the song, hands on your hips as his groin presses firmly into your ass. It's weird, being in a Tasha-Noah sandwich that you didn't really sign up for. You're too drunk to really know what you want, actually. You feel fine having Tasha this close, feel safe in her embrace, but Noah's presence is starting to make you feel a bit uncomfortable.
"I'm really drunk," you slur, but it's too quiet for either Tasha or Noah to hear you. Tasha just nods as if she understands, head tilting back and mouth popping open as another song begins. She mouths something, probably I love this song, something she's said about ten times tonight.
Noah pulls you in closer, almost like he's tugging you away from Tasha, but your voice is too faint under the music for your protests to be heard. His arms come up to wrap around your middle, and you feel the unmistakable shape of his cock dip down between your cheeks through your dress. At first you think maybe it's unintentional, but then he does it again, and again, like he's using your body to get himself off. On the fucking dance floor.
"Let go of me," you breathe, but it's lost to the music. You watch as Tasha gets further away, your arms dropping completely from her shoulders as she turns and starts to spin on the spot, still staring up at the ceiling, unaware of what's happening. "Stop," you mumble, feeling his clothed cock rub against you again, a sensation you're now familiar with but certainly not in this context. And certainly not with someone who isn't Joel Miller.
The thought of Joel is what does it.
"STOP," you practically scream, yanking yourself away from him and taking a few heavy steps back, shaking your head frantically, "DON'T FUCKING TOUCH ME."
A few people are turning to look and Noah seems more than embarrassed, hands going up quickly. He's drunk too, you can see it in his face, in his eyes, but you already know he's certainly not the harmless young Texan you thought he was. That feeling of unease earlier sure as hell hadn't been the alcohol talking.
You feel a hand at your waist and you flinch but only for a second, gaze coming to rest on Tasha who's now standing beside you with a look of pure horror on her face.
"What'd he do?" she asks, voice panicked and quick, almost like she's not even drunk anymore, "Are you okay?"
You nod but you can feel tears in your eyes, threatening to spill over at any second. Your ears are ringing like they had last night, but it's different this time, almost like you're underwater as Tasha grips your arm and leads you toward the front of the club, away from the loud music and drunk people. Away from Noah.
"Oh my fucking god, I am so sorry," her voice is shaking with emotion when you get out onto the street, hand holding tight to your arm, "I didn't even notice what he was doing. Jesus fucking Christ," she pulls out her phone and dials the number for a cab - through your bleary eyes you see a few teardrops dribble down the bridge of her nose, "We're going home, I'm so sorry, honey."
"S'okay," you manage to garble out through your tears, flowing heavily now in your drunken state, "It happened really fast."
"Doesn't make it okay," she replies, bringing the phone to her ear.
No, it doesn't.
--
"I want Joel," you whisper through your tears once you're settled in the back seat of the cab, Tasha beside you with her hand resting soothingly on your arm.
"What, honey?" Tasha asks softly, "Say it again, can't hear you."
"I want Joel," you repeat, words slurred as your hands come up to cover your face, "I don't wanna go home. I want Joel."
"We can't go to Joel's," Tasha murmurs, stroking your arm, "It's almost three in the morning, he's asleep."
"I want Joel," you repeat, "I wanna see him."
"I need an address," the cab driver says over his shoulder; he's already started running the meter, "Don't got all night, girls."
Before Tasha can say anything you're spluttering out Joel's address through a sob. Tasha starts to protest but you shake your head furiously, tears scattering everywhere, "I'll just walk," you mumble adamantly, "If you change it I'll just get out and walk."
"But-"
"You owe me," you practically spit, "You owe me after what just happened." You don't mean it, but your brain is nowhere near sober enough to fully realize that. And neither is hers.
She doesn't say anything else.
--
It's very strange being back in your neighborhood not sober. Your mind is still ridiculously fuzzy from the alcohol but part of you is able to acknowledge how crazy it is that you're back here so late at night in such a drunken state, driving through the dark streets while your parents are none the wiser. The cab passes by your house and you find yourself ducking down into the seat, afraid they might see you despite it being almost three o'clock in the morning.
"Can you just keep the meter running?" Tasha asks the cab driver quietly as you approach Joel's house, "I'm not staying, I just wanna make sure she gets in okay and that someone's here to help her."
"You're not coming in," you mutter, voice still slurred and heavy. You don't look at her as you say it.
"I'll just wait in the car for a few minutes then," she says quietly, just as the cab comes to a stop in Joel's driveway.
His truck is here, just like this morning. Except this time there's no purple convertible blocking him in, no other woman standing on the front step hugging him, waving to him.
Anger rises in your chest at the memory.
"I still don't think this is a good idea," Tasha says softly - what happened earlier has clearly sobered her up, almost no trace of drunkenness in her speech, "He's asleep, there aren't any lights on."
"Then I'll wake him up," you mumble, opening the car door and stepping out into the cool night air.
"I'll wait here for a few-," she calls out to you but you slam the door before she can finish her sentence.
You're not sure why you're suddenly being so mean to her. That is, until you stagger up Joel's front steps and feel even more rage bubbling inside you at the thought of standing where he'd stood this morning, where she'd stood this morning. Where the woman from the bar had probably stood too. Oh. You're an angry drunk.
Without any hesitation you push down on the doorbell. You don't bother to wait in silence; you just keep pushing it and pushing it over and over, hearing the dull sound of the bell dinging inside the house. You're vaguely aware of a light being turned on behind the frosted glass as you lean your hand against the door, suddenly feeling dizzy now that you're standing again.
The door opens and you practically fall through it, squinting against the sudden bright light and bringing your hands up to your face as you stagger inside. You feel someone catch you, big hands coming to rest atop both of your arms, and then your name being said in a deep voice, husky with sleep.
Joel.
"Are you okay?" he asks somewhere above you; your ears are ringing again and his voice is loud and muffled, that underwater feeling coming back. You try to mumble something but it comes out an incoherent garble.
You feel him pull you inside, hear the door shut behind you as he kicks it closed with his foot. He guides you inside the living room and your eyes shut tightly against the brightness of the overhead light, shining down on top of you like a spotlight.
"Too bright," you manage to mumble out, bringing your hands up to cover your face. You find yourself being seated on the couch before the light is switched off, plunging you both into total darkness.
"Baby, what happened?" you hear him ask, voice still swimming thickly through your muted ears, "I've been so fuckin' worried about you, where've you been? Where'd you go?" you feel his hands take yours, gripping them tightly. They're so rough and callused, nothing at all like Noah's, and it makes you smile.
"Feels nice," you mutter, already forgetting what he asked you.
"What'd you take?" he asks, and you suddenly realize that there's a very frantic edge to his voice, thick with worry and... fear? "Huh? Tell me what you took so I can help."
"D-didn't take anything," you hiccup, shaking your head slowly.
"Christ, babygirl," he mutters, squeezing your hands again, "Where were you? I called you so many times, I texted you, I-"
"Tasha's got my phone," you mumble.
"Where's Tasha? She alright?"
"In the cab."
"Jesus," he releases your hand and stands up, turns on a dim lamp in the corner of the room so you're not in total darkness anymore. You watch with hooded eyes as he opens the front door again, walks out onto the step and starts gesturing something into the darkness. He looks ridiculous, waving his arms like that - it makes you giggle.
He turns around and walks back over to you with long strides. You can see his face more clearly now, expression lined with worry. He looks tired. He probably is.
"Just wanted you," you mutter, staring at him.
Before he can say anything Tasha is suddenly walking in through the door, expression stoic as she passes the threshold. She avoids Joel's gaze completely, looking only at you.
"What the fuck happened?" Joel asks her, any sort of introductory pleasantries gone out the window, "Where's she been? What'd she take?"
"Nice to meet you too," Tasha grumbles, hitching her purse over her shoulder and walking over to where you sit on the couch, "She's fine, we went clubbing and she got drunk. I'll take her back."
"No you fuckin' won't," he says indignantly, moving to stand directly in front of you with his arms crossed, "How could you let this happen to her? She's never done shit like this before, you know that right? She's never been drunk in her fuckin' life and you bring her back like this? You ever heard of takin' it fuckin' slow?"
"Oh please, like I'm gonna take advice from you," she snaps back, walking around him and reaching down to take your hand, "Come on, honey, we need to go. Now."
"She's not goin' with you, she's stayin' here," his voice is loud, louder than you've ever heard it. In fact, you don't think you've ever seen him mad before. It's strange, seeing the way his eyes narrow, his mouth downturned into an angry frown, fists tight against his chest.
"I only brought her here because she said she'd jump out and walk if I didn't," Tasha argues, voice firm, "She's safe with me."
"Safe, huh?" he scoffs, "So why the fuck do you have her phone? Do you know how many times I've tried to call her in the past fuckin' twelve hours? I was this close to callin' the fuckin' police."
"If anyone here needs the fucking police called on them it's you," Tasha's voice is louder now, every word echoing in your brain, "Fucking creep."
"What the fuck did you just say to me?"
Your drunken brain can't process much of what's going on at all, both Tasha and Joel's voices blending into one constant loud noise. You bring your hands up to your head and cover your ears, though it can only do so much to block out their voices. What they're saying still manages to come through, albeit muffled and distant.
"You heard what I said. Fucking. Creep." Tasha repeats, "She knows what you've been doing, you asshole."
"What the fuck are you talkin' about?"
"What, don't have the balls to admit it?"
"Admit what?"
"Stop," you say loudly, bringing your hands down from your ears, "Stop yelling, you're hurting my head."
Joel crouches down, picks up your hands and takes them in his again, peering into your eyes. You can't see him properly anymore and you hate it, can only make out bits and pieces as your eyesight just continues to get worse the longer you sit here. You feel sleepy, almost like you're on the edge of unconsciousness.
"I'm sorry," he murmurs, thumbs stroking yours gently, "I'm sorry, babygirl. I'll stop yellin'."
You close your eyes, nodding and breathing deeply in and out, loving the feeling of having him touching you again. It's almost like last night didn't happen, like this morning didn't happen.
Last night. This morning.
You suddenly yank your hands away from him, eyes going wide as you remember exactly why you're even here in the first place, why you wanted to get fucked up to begin with. His face comes back into view again, expression confused.
"I know what you've been doing," you hiss, echoing Tasha's words and scooting away from him. You reach your hand up for her to take and she grips it tightly, helping you get up.
"Babygirl," he says softly, brown eyes tender and soft as he eases himself up from the floor, "I don't know what you're talkin' about."
"We saw you," Tasha says then, linking her arm with yours, "At the bar last night." She means business now, you can hear it in her voice, "We saw you kiss someone else."
His expression changes instantly. Worry, anger, concern... all of it gone in a single second.
"That's what I thought," Tasha says firmly, then carefully eases you out of the living room, walks with you as far as the porch before you hear Joel speak.
His voice is quiet, shaky, "It's not what you think."
"Then what is it, exactly?" Tasha turns then, rounding on him again while you cling to her arm, "You're not playing her? You didn't waste weeks of her life making her feel special only for it to turn out you're just like the rest of them?"
He doesn't say anything and you can't bring yourself to look at him, heart in your throat and tears in your eyes once again as you stare at the hardwood floor.
"I didn't... that's not what..." he finally breathes, "It's not what you think. That's all I can say."
"That's all you can say?"
"Well, I can hardly fuckin' explain myself when she won't remember it, can I?" his voice is raw, hitching on the last few words, "Nothin'... nothin' happened other than some kissin'. It didn't go any further, I swear."
"And I'm just supposed to believe you?"
"I'm not askin' you to believe me," he breathes, "But that's the truth. That's the fuckin' truth, swear on my life."
"And what about the girl she saw leaving this morning?"
He's quiet again for a moment. You're still afraid to look at him, can barely even comprehend that this conversation is even really happening right now.
"That was - Jesus, I never wanted you to find out like this," he mutters, and Tasha laughs without humor.
"Yeah, you thought it'd just stay your little secret, huh?" It's hard to believe she's had just as much to drink as you have tonight - you wouldn't know it by the way she handles herself now, the way she speaks to Joel like she already knows him. She's done this before. She's no stranger to confronting men who did her wrong, or in this case, her friend.
"That was my daughter," he says softly.
Tasha freezes.
The words do their best to seep into your skin, to make their way into the sober depths of your brain that lie dormant, somewhere hidden. You still feel so fuzzy, bleary eyed and heavy and confused, but the words register somehow.
You slowly unhook your arm from Tasha's to finally look up from the floor, moving your gaze to Joel's still form. He's standing there by the couch, arms still crossed across his chest but not angry anymore, a look of pure sadness and shame on his face. He looks small.
"Y-you have a daughter?" you whisper.
"Yes," he replies softly, eyes slowly lifting to meeting yours, "And the woman at the bar, that was her mother. My ex wife." You see tears shining in his eyes, watch as his lip trembles as he softly whispers, "And I swear - I swear it never went further than some kisses. And it won't go any further than that ever again."
You feel Tasha reach down and squeeze your hand. What she's trying to communicate to you, you're not sure. You just stand there staring at him, unable to process this information in your current state, head swimming and ears still ringing.
"I'll tell you everything," he continues quietly, taking a slow step toward you, "When you're feelin' better, I swear. Anythin' you wanna know, I'll tell you." He takes another few steps until he's standing directly in front of you and Tasha, leaning down so he can peer directly into your eyes, "I'm so sorry it happened this way," he whispers, "I never thought - Jesus, I'm just so fuckin' sorry."
You swallow tightly around the lump in your throat, completely unsure of how you feel, of what you're supposed to say or do. Nothing makes sense. Nothing is computing properly.
"You need to take her home," he murmurs, pulling back and turning his attention to Tasha, "Look, I'm sorry for-"
"No, I'm sorry," she suddenly breathes, "I was- wow, that's... I mean, I wasn't expecting that. I'm sorry. I just, I thought-"
"It's okay," he replies, voice still a bit stiff, "Just get her back safe, okay? She's-" he cuts himself off to look at you again, eyes peering down at you sadly. "She's special."
Tasha nods, "I know she is."
The last thing you remember, the last thing that's at least semi-clear in your mind, is the soft look of affection on his face as he stands on his doorstep and watches you go.
--
You're not sure exactly what time it is when you wake up on Sunday. The only thing you're sure of is that your head is pounding and the sun streaming through the window is only making it worse. You roll over in bed and press your face into the pillow with a low moan.
You're never drinking that much ever again.
There's movement beside you and you open your eyes briefly to see Tasha laying in a similar position, still in her dress from yesterday, face smooshed into her own pillow. You can't remember how you got back, memories extremely hazy and shrouded completely in too much alcohol. The last thing you can remember is being at Joel's house, of the brief conversation he had with Tasha, the words he'd said to you...
My ex wife.
It never went further than some kisses.
That was my daughter.
Now that your brain isn't under the influence, you can finally think straight, can finally process everything he said to you last night. Or at least what you can remember. You roll over again with another moan, sensing nausea in the pit of your stomach.
"The hangover is the worst part," Tasha mumbles, and you turn your head to see her looking at you through messy mascara, smudged and smeared all over her eyes, "But you'll be okay."
You stare at her for a few seconds, everything else from the night before slowly coming back to you in bits and pieces. The club, Noah, the way you'd snapped at her...
"I'm so sorry," you whisper, "Tasha, I was so fucking mean to you."
The part of her lips that you can see curve upward into a smile and she shakes her head slowly, "It's all water under the bridge, babe," she murmurs, voice still heavy with sleep, "You had every right."
"No, I didn't. That stuff with Noah, that wasn't your fault."
"I should've known better than to invite him along," she sighs deeply, "I just wanted you to have fun, you know? I wanted you to forget about..." she trails off, biting her lip.
"I know," you breathe, "And I did, for a while. You couldn't have known about Noah, he certainly had me fooled."
She nods, closing her eyes and nuzzling the pillow a bit. You both lay there in silence, the elephant in the room growing bigger and bigger the longer you go without talking about it.
"So, Joel's got a daughter," you finally whisper, "And an ex wife."
She opens her eyes again, raising an eyebrow, "I'm surprised you remember that. You were pretty fucked up."
You wince, "Did I completely embarrass myself?"
"No, not at all," her hand comes up to touch your shoulder gently, thumbing the skin there, "You stood your ground, you did good. And now... now we know the truth."
"The truth," you echo.
More silence. It's like neither of you really knows what to say to the other. You're sure Tasha has already formulated her own opinion, has probably known since last night exactly how she feels about the whole thing. And that scares you a bit - because what if she doesn't feel the same way you do?
And how exactly do you feel about it anyway?
"I think he texted you again a little while ago," she finally says softly, pointing toward your phone on the night stand, "I heard it when I got up to use the bathroom. And there's a lot of texts there from yesterday. He, uh-" she bites her lip, "He was really worried about you, honey."
You reach over and pick up your phone, taking a deep breath before unlocking it and looking at the damage: 9 texts. 18 missed calls.
Shit. You suppose it makes sense. The last time you'd talked to him was on Friday morning in his kitchen, when you'd told him you were planning on going out with Tasha and having a girl's weekend, finally having your college experiences. He hadn't known anything that happened between then and last night, hadn't known you'd seen him at the bar, that you'd gone to his house on Saturday morning and left again, not giving him any explanation as to why you hadn't shown up for your lesson. To him, it had just been complete radio silence.
With a shaky finger you press his name, heart pounding as the unanswered text messages flood your screen. First, the three you've already seen:
Hope you're having a good night, babygirl. You deserve to have some fun. I'll see you tomorrow. Be safe.❤️
You get home ok? Let me know x
Where are you?
And everything else:
???
Hey, I'm worried about you. Give me a call or a text ok?
Please call me.
I'm outta my mind over here baby. Please let me know you're alright.
I'm scared for you. Last I heard you were going out with your friend and then nothing since. Please call.
Just a text is all I need honey. I promise. If you're not feeling this anymore that's okay. Just wanna know you got home safe last night.
I'm so worried about you. I can't sleep. Please call me.
I don't know what to do angel. Can't stop thinking about you. Wish you were here in my arms. Please be safe.
Please.
The most recent text was sent this morning, around ten:
I'm so sorry. Words can't even describe how fucking ashamed and embarrassed I am. I can't imagine how horrible that must have been for you. I understand if you don't want to see me anymore, but I want to tell you everything, if you'll let me. I hope you're feeling okay today, angel. Drink lots of water, stay with Tasha. Text me whenever you're ready.
"Did you read these?" you ask Tasha softly, eyes unmoving from the last text, scanning the words over and over.
"No," she replies, "Just saw the notifications."
You scroll back up and read them again, and again, like you'll somehow be able to rewind time if you just keep reading them. You can't believe there's this many, can't believe that the man who'd been so distant the past week is the same man who sent you all of these.
The same man with a whole other life he never told you about.
"What do I do?" you whisper.
Tasha sighs, then carefully pulls herself up to lean against the headboard, crossing her legs and looking over at you, "What do you wanna do?"
You lock your phone again and sit up beside her, exhaling deeply, "I don't know."
You both sit there in silence for a few moments, lost in thought. You can't explain it but you feel nowhere near as betrayed or angry as you'd felt yesterday. Rage is no longer present - and neither is sadness. The only way you can describe how you feel is... relieved.
"He has a daughter and an ex wife," you state.
"He does."
"He has a daughter and an ex wife," somehow saying it again makes it feel more real, but the words still don't trigger any strong emotions. You sigh and look at Tasha, urging her to say something else.
"So, other than that, what's changed?" she asks.
You bite your lip and turn away from her again, shrugging your shoulders slowly, "I mean, that's... that's a lot."
"It is," she agrees softly, "It is a lot."
You swallow, fingers playing with the edge of your dress, reminding you that you're still wearing the same outfit from yesterday. God, you need a shower. You need to wash this entire experience off of you.
"You remember where we landed Friday night?" Tasha asks suddenly, "We talked about the possibility of him kissing someone else and we agreed that communication was the way to go, right?"
"That was before we knew he had a daughter and an ex wife, Tasha."
"Yeah, well... now we do know. And we know he's willing to talk to you about it," she twists her mouth in thought, "So do you wanna talk to him about it?"
"...I don't know."
She suddenly eases herself off the bed, stretching her arms above her head and yawning loudly. You watch as she assesses her pillow, grimaces at the dark makeup stains on the white cotton.
"I'm scared," you admit softly, avoiding her gaze.
"What are you scared of?"
You don't know how to answer that, biting your lip and sniffling a bit. You bring your knees up to your chest, hugging them and leaning your face into your warm skin.
"You're falling in love with him, aren't you?" she asks quietly, absolutely no judgement in her voice, "That's it, isn't it? You're really starting to fall and that's why you're scared."
You can't speak, unable to say anything because you know you'll burst into tears if you do. Instead, you nod your head slowly, up and down against your knees.
"Then you gotta talk to him, honey," she kneels down on the bed, places her hand on your shoulder soothingly, "You gotta hear what he has to say."
You groan, bringing your hands up to cover your face as you stretch out your legs again, turning on the bed and scooching downward to smoosh your face back into the pillow.
"I'm gonna take a shower," Tasha murmurs softly, "I feel disgusting."
"Welcome to the club," you mumble into the pillow.
You're vaguely aware of Tasha moving around you, grabbing things from the nightstand and puttering around the room as she gets ready for her shower. You sense her standing close to you for a bit longer than necessary, like she's just staring at you without really knowing what to say. With a roll of your eyes you turn to face her, and you catch the briefest moment that she places your phone back down on the nightstand.
Your brow furrows, "What are you doing with my phone?"
"Nothing," she says quickly, turning around and leaving the room without another word.
--
You fall back to sleep without meaning to, and when you wake again, it's only because you hear someone talking in the other room, someone with a deep voice. Tasha must be watching a movie. You curl in on yourself a bit, rubbing your eyes and wincing when you feel the makeup smudge across your face. You really should get up and shower.
You suddenly hear footsteps in the hallway, getting closer. But there's something different about them, something heavy in the way they sound against the floorboards.
The door opens and there's just silence for a few seconds, no movement. Then the footsteps return, closer now, slow and unsure.
You know it's him before his weight sinks into the bed.
Oh, Tasha. Of course you did.
You close your eyes as you feel his arms snake around you from behind. You allow him to pull you in close, feel his nose against the back of your neck, his scruff against your shoulder. He smells like his cologne, feels warm and solid against your back, the denim of his jeans brushing against your bare legs.
"I'm so sorry," he whispers.
You immediately turn within his embrace, coming face to face with the man who you've spent the past twenty four hours hating, being angry at, feeling betrayed by - he's looking at you with a tenderness you can't describe, lips downturned into a soft frown that says everything. He's upset. He's ashamed. He's sorry.
"Why did you kiss her?" you whisper.
He takes a breath, "We have this... arrangement," he murmurs, "We've had it for years. Whenever she's in town - which isn't very often, maybe once every three years or so - we sleep together. It's been goin' on for over twenty years now, it's just.. it's just what we do."
You nod slowly, eyes falling to his mouth and then back to his eyes, "But you didn't this time."
"We didn't," he breathes, "I swear to you, we didn't. We went back to my place, we... we were kissin'," he winces but doesn't close his eyes, keeping his gaze on you, "I.. I went to grab a condom out of my bedside table before things got heavy and I-" he cuts himself off, taking another breath.
"What?"
You watch as he reaches down into his pocket, fishes something out. He brings his hand up and extends his fingers, shows you what's sitting in the palm of his hand.
Your crucifix.
"I saw this," he breathes, "And all of a sudden, I just... I just knew I couldn't."
You stare at the gold cross, watch it glint in the sunlight still cascading through the windows. His breath hitches and your gaze goes back to his face, the lines and wrinkles and grey whiskers, his soft brown eyes and curved nose.
"I understand if you can't forgive me," he whispers, tears shining in his eyes, "I don't expect you to, but I want you to know that I never meant to hurt you. I'm sorry that I did."
He closes his fist around the crucifix again and slowly brings it downward to your own hand, urging you to open it. He slips the chain past your fingers, goes to pull his hand away, but you stop him. You grip his hand tightly, the cross digging into both of your palms.
"We never established anything," you whisper softly, "We... we've never said that we're anything. It's just been sex."
He doesn't say anything, eyelashes fanning over his cheeks as he waits for you to speak again. He's so handsome, so unreal in a way that doesn't make sense to you, and probably never will.
"I wanna be yours," you breathe, meeting his gaze, "I don't want you to be with anyone else."
He leans forward to gently brush his nose to yours, eyes closing as he breathes deeply, the tears spilling over onto his cheeks.
"Okay," he whispers.
You know there's more for him to explain, so many more details you don't have yet that you do want to know. But in this moment, you don't care about any of it. You just want him.
It doesn't take long for you both to be completely undressed, clothes tossed over the sides of the bed as your naked bodies press warmly up against each other, soft and eager. He presses kisses to your neck, breathes you in, runs his fingers through your hair as he hovers above you with absolute need in his eyes, a look you're sure mirrors your own.
He knows you're still not ready without you having to say it. Knows this isn't the right time. There's no need for any words of reassurance or any questions. He knows what you need. You know what he needs.
His cock moves firmly down against your tummy beneath the sheets, his shaft settling perfectly against your pussy, already wet and aching for him like it had been the second he walked into the room. He puts both hands above your head, leans down to kiss you as he drags himself up and down within your folds, up and down, up and down.
It feels incredible, just having the thick length of him rubbing back and forth against your clit, the wide head catching at your entrance every now and then, eliciting a deep groan from Joel and soft whimpers from you. You grip his back tightly, broad and firm and yours, fingertips digging into his skin as he fucks himself against you.
"Feels so good," you whisper in his ear, voice trembling with every thrust, "Feels so good, Joel."
"I know it does, babygirl," he whispers, kissing your ear and grinding himself against you even deeper, moving his hands down to grip your hips as his cock continues to slip back and forth against your folds, "You're so sensitive, aren't you? That big cock feels so good against your little pussy, hm?"
You nod frantically, arms moving up a bit to wrap around his neck, your cheek brushing against his.
"You want a bit of my cock inside your hole, baby?" he whispers softly, secretly, pushing your hair away from your face, "Huh? You want the tip, honey? Just a little bit?"
You don't even have to think.
"Yes," you moan, "Yes, please, put it in, please."
"Okay, baby," he murmurs, pulling back a bit to look down at the mess you're making together, reaching his hand down to position his cock at your entrance, "Just the tip, babygirl, I won't go any further than that. Don't be scared."
"I'm not scared," you breathe, and you absolutely mean it, looking up at him with what you're sure is a completely wrecked expression, "I want it, Joel. Please."
He places the head of his cock against your hole gently, very gently. Then he takes your hands from around his neck and holds them in his, presses them up against his chest as he looks deep into your eyes. You look back, gaze never leaving his as he slowly pushes himself inside you - just the tip.
You gasp.
"Shhh," he breathes, squeezing your hands and continuing to peer into your eyes, never breaking eye contact, "Shhh, you're okay," he murmurs, "You're okay, angel."
You lay completely still, lips parting and eyes going hazy as you focus all your energy on experiencing this moment, on feeling the way the head of Joel's cock feels inside of you. It's pulsing, warm and wide and big inside your pussy, throbbing against your walls.
It feels fucking amazing.
"Joel," you whimper, eyes still locked completely on his.
"You're mine," he breathes, jaw tense and eyes alight with something you can only describe as pure passion, "You hear me? You're the only one I want. Don't want anyone else, baby. Nobody."
You nod desperately, thighs shaking as the fat head of his cock pushes inside just a little more, making you squirm. He stills his hips, still holding your hands against his warm chest.
"Look at us," he murmurs, "Just look."
Your gaze finally unlocks from his, eyes trailing downward to where you're connected, where the thick length of his cock juts out from between your legs. You rise a bit on the bed, whimpering as you look down at exactly where he sits inside of you, wet and dark and filthy and fucking beautiful.
"You can take all of me," he whispers, "I know you can, babygirl. But not now, not here."
"I know," you breathe, swallowing and looking up at him again with tears filling your eyes.
He pulls himself out of you then, places his thick and throbbing shaft against your pussy again and begins to thrust, moving downward so he's pressed up tightly against you, your hands caught between each other's bodies, the crucifix still hanging between your fingers.
"I'm gonna take you away with me, okay?" he says, almost a whimper as he stares into your eyes again, intense and focused, "We're gonna go away and I'm gonna tell you everything you wanna know about me, alright? And I'm gonna fuck you, baby. I'm gonna fuck you so good."
You're nodding as he speaks, whimpers and whines flowing continuously from your mouth as you near closer and closer to your orgasm, that familiar feeling in the pit of your stomach growing stronger.
"I'll fuck you in the bed, I'll fuck you in the shower, I'll fuck you on the fucking floor," he groans, eyes suddenly shutting and breaking the eye contact he'd managed to hold for so long, his face coming down to bury itself in your neck, "You're mine, angel, you're mine."
"I'm yours," you cry as your climax hits you, knocks the wind out of you as you start to shake beneath him, your hole fluttering against the length of him, "I'm yours, Joel, only yours."
You feel his come hit your stomach, painting your skin as he releases a deep groan into your ear and puts his entire body weight on top of you. You just close your eyes and feel him, exist in this moment for as long as you can, just listening to his breathing match your own as you both come down from your high.
He nuzzles his face against the heat of your neck, squeezes your hand in his between your bodies. The crucifix digs into your palm but you barely feel it.
"I want you to keep it," you whisper in his ear, and he doesn't have to ask what you're talking about, just presses a soft kiss to your neck and finally pulls back to peer down at you with total adoration.
"Okay," he murmurs with a soft smile, "I will."
2K notes
·
View notes
Faking It | Jack Hughes
summary: when Jack learns that his girlfriend faked her response in bed the previous night, it can only ever land up with them back in bed as he gives her a time she couldn’t possibly fake.
request: yes/no
warnings: sexual themes, p in v (unprotected), oral (fem receiving), use of vibrator, bondage, ice play, swearing.
word count: 2.49k
authors note: surprised I got this one out today if I’m being honest. @hischierhaze said I can blame her for my lack of a filter for this and @sweetestdesire just told me to tag her. This is what happens when I am left unattended to do things… with that being said I hope you enjoy what came from this prompt!
The sound of your headboard hitting the wall rang through your ears.
Jack held your legs around his waist “right there baby.” Jack grunted dropping his head so that his lips could kiss at your collar bone.
Even with his lips sucking at the sweet spot of your skin you couldn’t seem to get his cock to hit the spot that you needed him in “fuck Jack.” Your cry was more so out of discomfort as a cramp formed in your thigh officially meaning that you had lost any chance of having a good night with your boyfriend.
The hockey player had come home after a long road trip and he wanted nothing more than you and your bed. But all you wanted to do was sleep after a long day at work “you want to be a good girl and come for me?” Jack asked as you clenched your pussy around his cock.
You knew that he was close by how his cock throbbed from inside of you and you knew that he wouldn’t be able to handle it if you didn’t come tonight “shit yeah.” You forced your breath to go airy as your hands reached up to tease your nipples in the hopes that it would help build some pressure in your stomach.
As Jacks grunts began to grow stuttered you decided that then was your chance to act like you came “oh my god Jack,” you huffed your chest making it sound like you had just ran a marathon.
Jack rode out his orgasm before he flopped onto the bed next to you “you were so good baby.” You couldn’t even remain upset for long as the hockey player hooked his fingers under your jaw so he could pull you into a kiss.
After last nights disappointments you invited some friends over to full up your time before Jack was meant to come up from practice “you okay girl?” Mia asked as she sat next to you sensing your silence “can I tell you girls something?” You sighed watching them all nod.
Jack walked back into the apartment deciding that he wanted to be quiet so that he could hear whatever gossip it was that you were talking about “we had sex last night.” Your voice made him stop dead in your tracks “and he thinks I came but I didn’t.” That confession made his eyes go wide.
It wasn’t that he was sad you told your friends, he was sad that you felt the need to fake it and not address it. Because if Jack knew that you had done that you wouldn’t be sat there today “hey baby!” Jack pretended to shut the door once more again but louder this time before he made his way into the living room.
Your eyes were wide as you looked at your boyfriend “how was practice?” You asked trying to ignore the embarrass looks your friends were sending the Hughes boy “it was good, gonna go have a shower now.” He smiled pressing a kiss on your forehead.
Instead Jack actually walked into your bedroom and began deciding his plot of how to make you pay for faking your orgasm whilst he also tried to give you a night of pleasure to make up for what you missed.
Jack was given plenty of time as you ended up back in your room 90 minutes later once your friends had left “how are they all?” Jack asked sending you a smile as you crawled into his lap “don’t care about them right now.” You mumbled running your fingers along his jaw.
The hockey player smirked “want to be a good girl for me?” He cocked his head pecking your lips.
You nodded “always,” and just like that you had fallen into his plan.
Before you knew it your clothes were all off as you were laying on your bed fully naked whilst Jack was only in some sweatpants “you trust me?” The hockey player grabbed his belt as he held your hands together before he tied them to the headboard making sure that the belt was done tight enough you looked at him with a smile.
That wasn’t going to work for him causing the boy to grab his tie “relax baby,” he encouraged you as Jack held it up to your eyes “I’ll be back in a sec,” was the last thing he said after tying it behind your head.
It all felt foreign to you as Jacks tie blocked out the light from your eyes leaving you in darkness “J-jack?” You called out hearing his footsteps retreat “I’m here baby don’t worry.” He cooed coming back to your bed letting the mattress dip as his knees pressed into it.
You grew wet with anticipation as you waited for him to touch you “remember the safe word is red.” Jack mumbled pressing a kiss to your lips before a buzzing noise between your thighs pulled your attention away from his lips.
That feeling was familiar from anywhere, the vibrating was shared between your clit and your pussy making you realise that it was your red rabbit vibrator. It was a purchase you got when Jack was on a roadtrip and when he came home he caught you laying on your bed in some pretty robe for him but when you got impatient you leaned on your new friend to help you out. Rather than get upset Jack spent that evening learning how to further improve your experience in bed with the help of the red device “shit Jack!” You gasped realising that your boyfriend had gone for the highest speed setting straight off the bat.
Your hips jerked against the device as you felt your high quickly approaching “don’t stop,” you begged desperately tugging at the belt that had your hands up by your headboard “not yet baby.” Jack clicked his tongue turning the speed of the vibrator all the way down to its lowest setting.
It caused you to whimper “don’t be a brat about it.” He warned using his free hand to softly hit your clit “you want to embarrass me like that in front of all your friends?” Jack’s harsh words made your jaw go slack “and think that you won’t get punished for it?” He let out a laugh as he shook his head.
Jack let the speed slowly increase again as it looked like you had fallen enough away from your high “let’s see if you take this one like a good girl this time?” The hockey player increased the speed up one button more as he grabbed an ice cube from the cup next to him.
Your body ached as your toes curled “y-you know?” Your voice trembled, quickly you felt bad at the thought out your boyfriend knowing what you had done “had to hear you telling all of those fucking friends of yours too.” You didn’t have time to think about how his voice sounded mumbled as the boys lips dropped down to your breast “shit!” You groaned almost jumping out of this constraints you jumped so hard.
The cold ice cube served as the perfect contrast to your hot skin “fuck Jackie!” You cried at the sensory overload that you were feeling “breathe baby.” Jack ordered watching in awe as the water dripped from your stiff and sensitive peak.
You huffed trying to hold back a moan desperate for Jack to let you come “‘m so sorr-” you cut yourself off as he moved his attention to your other breast repeating his actions with what was left of the ice cube “think you should beg to come.” Jack had to admit that his cock pulsated in his sweatpants as it felt forgotten and unloved waiting for you to turn your focus to it “please Jack!” You cried trying to form a coherent sentence.
Your thighs shook as you couldn’t keep them planted on the mattress anymore “I’ll never fake an orgasm ever again.” You offered with your voice oozing in pleads “going to need more from you than that.” Jack shook his head again dropped the ice cube onto your stomach causing him to grunt out in pleasure as he watched it glide down your torso finally stopping just above your belly button.
It seemed like as the ice cube stopped so did your vibration causing your high that had built up to quick drop again “think you can go again?” Jack asked massaging the little 86 tattoo that you had on your hip “uh huh,” you whimpered feeling your vibrator slide out of your core.
Jacks weight shifted to the side of your bed before he went back to the centre, his arms wrapped around your thighs as if you could have tried to go anywhere else “shush baby.” Jack cooed as he pursed his lips around the cube of ice bringing his mouth down to your slit.
You cried out in pleasure feeling the cold cube pressed up against your clit as Jack ran the cube down your slit “p-p-please Jack.” You whined tensing up your whole body as he pushed the cube into your soaked cunt.
It made you moan as the ice began to melt in your warm core leaving Jack to suck at your clit “want to touch you,” you complained as tugged as the belt once more now fully aware that it was going to cause a bruise on your wrist’s tomorrow “not yet.” Jacks words could barely be heard as he didn’t pick his head up from your clit as his tongue swirled around the sensitive nub.
It didn’t help that you were still feeling those two previous attempts at orgasm that failed so now all you wanted as for this one to suck you into the bliss that would have been coming around his cock as you saw the stars “Jesus baby you’re soaked.” The hockey player smirked to himself knowing that this was all his work.
He went back to letting his tongue work on your clit as your body began to shiver, thighs driving towards him “all for you.” You stumbled over your words “all real too.” You added desperate to clench around something that wasn’t the quickly melting ice as that was how you liked to come.
Jacks cock stuffing you to the brim as his thumb played on your clit or with your nipples “you know the rules tonight.” He pulled away once more making you huff in annoyance.
The hockey player stared at your body sat there all innocently as he smiled seeing how frustrated you were “you had enough?” Jack asked leaning forward as he pushed the tie off of your head.
It took you a few seconds to adjust before you looked at him “just want you now.” You complained sending him a needy look that he couldn’t say no to.
Jack nodded undoing his belt before he rubbed your wrists “next time, I’m tying you up.” You mumbled cupping his face with your hands so that you could pull him into a kiss.
The boy almost fell onto your bed as you pulled him down “I wanna fuck you.” Jack confessed deciding that the pain in his cock was no longer worth it.
The hockey player smiled as you hooked your fingers in his waistband “no baby, I’m gonna work for you tonight.” Now this was the apology part of the plan.
He let his sweatpants drop to the floor as he kicked the ends off “been so good for me baby.” Jack cooed leaning down to kiss your lips.
Your eyes fluttered feeling his cock run against your clit “please don’t tease me.” You begged not believing that you could handle more of it “just making sure you were ready.” Jack joked not giving you enough time to snap back at him before he thrusted his throbbing cock in your wet cunt.
Jack didn’t even need the time to let you adjust before he hooked your legs over his shoulder “my flexible good girl.” He mumbled hovering his lips over yours as he established a good rhythm that would be aided by your sensitive core “god Jack.” You moaned feeling your breasts bounce with each thrust of his cock.
The sight was hot, no distance between the love drunk couple as the sound of your moans harmonised together “just me baby.” The hockey player grunted feeling your pussy clench around his cock “you want to come already?” His tone was teasing.
Your face grew red as you nodded “making me feel so full your toes curled as pleasure pulsated through your body.
Jack needed just a bit more from you “hold it,” he warned not wanting to ruin a hot night because you couldn’t listen.
His order made tears form in your eyes as he stared down at you, letting his hair down to tickle your face “Jack please,” you begged as the pressure between your thighs threatened to burst at any minute.
His grunts quickly joined a competition with your moans in an effort to drown the other out “keep squeezing my cock like that baby.” Jacks thoughts began to grown foggy as his orgasm approach too.
Your fingers slid between your two bodies “I can’t hold it anymore Jack.” You confessed letting those fingers attach your clit as they rubbed in a circular motion.
Jack let his head drop to your neck in a similar way that he did it the night before “come for me baby.” He ordered replacing your hand in your clit “come so the neighbours can hear who makes you feel like this.” The hockey player let his lips nip at the skin of your neck in order to control himself.
His hips snapped so fast if was like they might have snapped out of place “fucking shit Jack!” You cried out grinding your hips into his as you eyes screwed shut.
His orgasm came shortly after yours with how you came around his naked cock -something you two hadn’t done before- “holy shit baby.” Jack gasped final a final thrust into your cunt before he pulled his cock out “you squirted.” He pointed out looking at the wet patch on his lower torso.
Before you had the chance to grow embarrassed he smiled “that was the hottest thing I think I’ve ever seen.” Jack confessed kissing your cheeks, a habit he had picked up whenever you blushed.
You smiled looking at him “think I should fake some more orgasms if we are gonna have sex like that afterwards.” You joked running your fingers through his hair “next time I’m not going to let you come.” Jack warned making you laugh.
The hockey player had to admit that these small moments after sex with you were some of his favourites “bath or shower?” He proposed knowing that you both desperately needed a clean “bath.”
1K notes
·
View notes
Forced Arbitration Added to Discord's Terms
First up: forced arbitration is effectively a legal way (in the Unites States) for a company to stop you from suing them. It means if anything happens that is sue-worthy (say they massively fucked up and people's data got stolen en masse), you would not be allowed to sue them.
Instead you'd be forced into a process called arbitration which is private (you wouldn't be allowed to speak on what was going on publicly) removed from the courts and handled by arbiters who were selected by and beholden to the company that did the shady/illegal thing (Discord, in this case) so your odds of getting anywhere are basically zero.
The good news:
You can opt out of this bullshit pretty easily. You just need to send an email clearly stating that you are opting out from the email address associated with your discord account.
Unfortunately, you only have 30 days from April 15, 2024 (or 30 days from your account's creation if you made a new one) to send this opt out email. So you're gonna wanna get on that pretty quick, even if you don't ever imagine you needing to sue Discord, having the option taken away from you is never a good thing.
The email you need to message is:
Again you need to send from the email inbox associated with your discord account, you should also save the email after you send it so if you need to pull it out and wave it in someone's face later you have it handy.
The email doesn't need to be in depth or long, just something direct and simple like:
"I am writing to opt out if the arbitration clause added in their most recent update to their Terms of Service."
Remember, just because you don't think you'll need to does not mean it's okay for them to be shady and take the option away from you.
Go forth and be spiteful my dudes
646 notes
·
View notes
Just Take It | Jeon Jungkook | Part Five
Summary: You start a conversation with Jungkook about where you stand but are interrupted by an uninvited visitor
Pairing: Inexperienced f!reader x Best Friend's Dad Jungkook (20 year age gap)
Word Count: 4.7K~
Warnings: Suggestive and explicit language (an argument). Nothing too crazy honestly. Horribly edited too because it's been three weeks and I wanted to get it out!
a/n: Sorry it took me so long to get this chapter out but I was away from home for a week and then wrote a couple of one shots and blah blah blah lol but anyways I hope you enjoyyyy
Requested by: @kkusadmirer 💜
After our eventful afternoon Jungkook and I ended up laying in his bed and watching movies since like he said, he wanted me to be "well rested" before we have the talk. The talk that could change everything between us...
There are multiple outcomes to this scenario and I'm not sure if I'm ready for any of them.
On one hand he could say this was all a mistake and he was just acting on his urges. I know now for damn sure though that he's attracted to me but I don't know what his motives and feeling are towards me. If he even has any besides surface level physical attraction.
On the other hand he could want to pursue a friends with benefits sort of arrangement. Being fuck buddies or whatever with an older man does sound exciting when I think about doing it with him. It's just that don't know if I'd want something like that even if it was with him.
I told Jared before that I wanted to save myself for marriage and I feel like that's something I still want to stick to. I've definitely crossed so many lines with Jungkook in the last not even twenty four hours, more like twelve hours or something like that but regardless lines have been crossed and I'm still not sure how I feel about any of it.
I want to say that I don't regret it and it's not just because it felt fucking phenomenal and out of this world but because I feel safe with him.
It might just be because over the past couple of months that I've been living with him he's become someone I care about and honestly trust with my life so I didn't really feel a need to say no to him. I wanted it to happen, I know I did I just didn't really think it would ever happen. I thought that it would stay in my hormonal fantasies forever and I was okay with that.
The way he's been treating me has shown me that he cares about me. Although I was trying to convince myself that it was somewhat of a paternal instinct in him and that he was just being protective over me, I knew that it was something beyond that.
I tried to somewhat address it in a weird sort of way with the whole asking why he didn't have anyone over conversation and he knew what I was trying to ask and addressed it but his answer made me even more confused.
"I wouldn't want to ruin what we have going on here" like what does that even mean? He doesn't want to ruin the dynamic we have in the house in terms of we're comfortable with each other and feel no need to let anyone inside our little safe space.
Or did he mean that he didn't want to ruin what we have going on here because he wanted to see where things went with us on a more romantic level?
He hasn't explicitly told me that he would want to pursue a relationship with me but circling back to before he's given me clear signs that he's attracted to me and isn't one to hide it.
He knows to a certain extent that I find him attractive too because I asked him to take my virginity. (I'm never gonna be able to live that one down) Anyone could tell that he was clearly struggling to hold himself back and the fact that he kissed me just shows that he wanted to. That he wanted me.
Then there's another possibility that he might want a sugar baby sort of relationship and I don't even want to think about something like that.
Don't get me wrong! I respect the hustle, but that's just not for me.
If I'm gonna be doing something like what we are doing right now then I want it to be something that I want to do without any ulterior motive. I don't want to put a monetary value on the time I spend with him but not gonna lie, living it large and not having to worry about money or working sounds very tempting.
I don't think he's that kind of man though...or at least I hope he's not.
"Penny for your thoughts?" he asks playfully, having noticed that I haven't really been paying attention to the movie we've been watching.
"Just thinking" I answer, cuddling in closer to him as I've refused to let go of him today and he hasn't made moves to do any different.
"Bout what?" he prods further, placing a kiss on the top of my head and taking in the fresh scent of his shampoo in my hair.
"Things" I continue, liking the game we've started to play.
"What sort of things?" he chuckles, telling me that he's enjoying it too.
"All kinds of things" I say nuzzling closer into him and he wraps his arm tighter around me to keep me there.
"Wanna share a few?" he asks, clearly not letting this go since he wants to at least make sure I'm okay.
"Thinking about how you might want to make me your sugar baby" I mumble into his chest and he laughs wholeheartedly making me even more embarrassed.
"Is that something you'd want?" he asks and I shake my head.
"You don't wanna be at home and sit pretty, waiting for me to come back and shower you with gifts and jewelry and give you the world?" he teases while pinching my sides making me pull away from him, trying to escape.
"N-no! Now s-stop" I choke out through laughter and gasps of breath. "What would you want" he asks after having tackled me down onto the mattress making sure to do a thorough job of tickling me until I could barely breathe.
I take a second to think, my eyes going back and forth between his while his stay still, focused and almost begging for an answer.
"I thought we weren't going to have this conversation until I was well rested" I say, breathless, still not knowing up from down when it comes to us. If there even is an 'us'.
"You feel well rested?" he asks, cocking a brow at me and I nod my head quickly, giving me a crooked smile in response. "Then it's perfect timing right?" he continues and I nod again leaving him getting off of me and leaning his back against the headboard, waiting to hear what I have to say.
I take a minute or so to gather my thoughts and the whole time he's watching me curiously, almost able to see the wheels turning in my head.
"What happened between us kind of caught me by surprise" I start, looking down at my lap and playing with my fingers nervously. "I don't regret it, it was just, well I'm just kind of confused about how you feel about me, and I'm really confused about how I feel about you" I admit and I can see his expression go a bit wary but I jump at the chance to explain myself.
"It's just that I think both of us know at this point that we're extremely attracted to each other" I start out and the corner of his lips upturns for a second but nods in confirmation, waiting for me to continue.
"With us getting physical and all so quickly I can't help but think that maybe we should take a step back. I would like to know your thoughts and intentions and feelings about all of this. I might be overthinking it but I really think it's best to be up front and honest with each other" I say and take in a shaky breath, scared I might've said the wrong thing.
"You're so sexy when you act so mature like that" he taunts and I groan, wanting to keep this serious. "I'm just playing Bunny. Well I'm not because you really are sexy but I don't want you to feel all nervous and insecure like you are right now. We're being open and honest right?" he questions and I nod my head, eager for him to continue.
"Meaning it would be the perfect opportunity to tell you that I have feelings for you right?" he says and my eye bug out in response, not knowing what to do now. "Wasn't expecting that huh?" he chuckles and I shake my head making him laugh even more.
"Cat got your tongue Darling?" he teases and scoff at that. "No I was just being polite and letting you keep talking since you let me do the same" I say, making excuses and trying to keep my voice level.
"Sure Bunny" he smirks not believing a word I said but continuing nevertheless.
"I've had feelings for you for a while now and I haven't told you or acted on it because I wanted to respect the fact that you were in a relationship. I never liked Jared though for what it's worth" he says without hesitation and it makes me cringe at the thought that I was about to marry that snake.
"Is it harsh to say I'm glad he's out of the picture?" he says boldly making me laugh. "Not just because it benefitted me but because he didn't deserve to marry a beautiful, intelligent, kind hearted woman like you. I would've said something but I'm not your father so I knew it wasn't my place" he finishes and making me smile, thankful that he was so considerate.
Now that I think about it, even back then I respected and trusted his judgement so it wouldn't have bothered me even if he did say something.
"It's not harsh to say because I'm happy about it too. To be honest though I don't really know what I ever saw in him. I think because he was the first guy that more or less respected my boundaries that I thought I had to hold onto him. I don't know" I say and he nods his head.
This is something I haven't experienced before. Someone sitting and taking the time to actually talk things out without any outside distractions and focusing on each other and hearing each other out.
Maybe it's just an age thing and the fact that Jungkook does fit the standard of dating older and more mature men is better. We're not dating though, but I guess we'll hopefully figure out where we stand once this conversation comes to a close.
"I'm really confused and I kind of don't know how to feel but I'm not closed off to figuring things out" I say, glancing up at him and back down at my lap, nervous from seeing how fascinated he is with me right now.
I hold my breath and wait for him to say something but when nothing ever comes I chance looking up at him again and I'm surprised to see how he's still watching me.
"Like I said, I've had feelings for you for a while and if you're open to seeing where things go then I would really like to take you out on a date. Like on a proper date. I know since we've been living together and we've been spending a lot of time together but I-" he start off strong but begins to ramble and is regretfully cut off by the sound of the front door opening.
"Dad! Dad where are you?" Jina calls out and neither of us dares to move or make a sound. "Dad" Jina drags out, regretfully confirming that I am in fact not dreaming. "Be down in a second" he says then presses a finger to his lips.
"Just stay in here and I'll take care of it" he whispers and I nod my head, watching him as he panics internally before leaving the room and closing the door softly behind him.
What the hell are we gonna do? My car is out there! Or wait, did I put it in the garage yesterday? I can't remember but I really hope it's not out there otherwise she'll already know I'm here.
"What are you doing here?" Jungkook says. I can hear his muffled voice through the walls and I know I probably shouldn't listen but curiosity gets the best of me making me rush to the door and quietly crack it open, needing to hear how this conversation goes.
"Nice to see you too dad" she says, and I hate the fact that I'm only able to hear them but I'll settle for this.
"You should've contacted me before you came over Jina. You know I don't like people showing up unannounced" he says sternly.
"You're usually totally fine with me coming over" she says sounding thoroughly confused and I can hear Jungkook clear his throat before she starts again.
"Am I interrupting something?" she asks after no doubt clocking the dishes that were left over from lunch. Two plates, two cups and two sets of silverware. A dead giveaway that someone is here especially since it hasn't been cleaned up yet.
"You are actually" he says and I trip, surprised that he would straight up admit it but he has no reason to hide, and neither do I.
Having pushed the door open thanks to my clumsiness (somehow able to stay upright and keep my dignity this time) I'm faced with the dilemma of if I should just go back inside and pretend that never happened when it clearly did or come out and face her.
I'm given the luxury of having that choice since she hasn't seen me yet but I decide it's better to do this as soon as possible. We've hid the fact that I've been living here for two months so what's adding on the fact that I've been messing around with her father while doing so.
(Although this is a newly added feature but she doesn't need to know that)
I take a deep breath before stepping out from behind the door, watching Jina's face go from surprised to confused to disgusted to angry before turning back towards her father.
"You're fucking my best friend?" she accuses, not completely wrong but semantics.
"Best friend's don't fuck around and get pregnant by their friend's fiancees" I remind her, walking down the stairs in conveniently only Jungkook's shirt making what's going on, or what's starting to go on between us even more clear.
"Oh grow up! It's not like there's anything we can do to change that now can we? Plus looks like you're doing just fine without him" she throws at me and from that moment I'm not pulling any punches. She wants to play dirty? Fine, let's play dirty.
"Jina stop it" Jungkook growls, going on the defensive, not being able to gauge what kind of mindset she's in or even her reasoning for coming here but wanting her out all the same.
"Grow up?" I chuckle dryly, "I guess you're right, I guess maybe I have started growing up since it seems I've matured enough to be with someone like your father. Which, last time I checked, wasn't someone you have any business in questioning on things like his sex life and who he does and does not partake in it with" I say, placing a hand on his bicep possessively and I feel the tension he had once held in his body start to melt away.
Interesting to know that I have this effect on him...
"Come on, we both know that you're probably just a piece of ass to him" she scoffs before turning to address him. "Didn't know you started picking up strays. I wondered where she had ran off to" she says, continuing to disrespect the both of us without a care in the world.
"Don't call her that!" Jungkook says, jaw clenched as a way to keep himself in check.
All I see is red though and the next words I hurl out are ones that I couldn't stop myself from saying even if I tried. The ringing in my ears fanning the flames of my agitation making it impossible to hold back.
"How's life being pregnant with my fucking ex boyfriend's baby? He's probably taking real good care of you huh?" I taunt, cocking a brow at her and from the way the color rushes to her cheeks and the words die in her throat are enough to tell me everything I need to know.
He hasn't done shit for her.
She balls her hands into fists by her side and lunges at me but Jungkook jumps in between us, grabs her by the shoulders and turns her around, forcing her out the front door.
"You're gonna throw me out and choose that slut over your own daughter?" she yells struggling to get out of his grasp the whole way.
"Last time I checked honey the only slut around these parts is you" I throw back, following right behind them and the way her jaw drops is just priceless.
"That's enough! Jina go!" Jungkook says through gritted teeth letting go of her once she's passed the thresh hold, leaving her standing there, looking between the two of us before scoffing and storming off down the driveway.
"I knew you were obsessed with her I just never thought you would bother acting on it" Jina spits out at her father and when she sees that he doesn't flinch she hurls more baseless lies and insults at the both of us.
"You know she's just using you to get a place to stay and get over her ex right? What happened to staying a virgin until you got married y/n? Huh? Guess getting cheated on really fucked you up" she spits while unlocking her car.
"And I guess fucking around with an ego-driven two-timing narcissist gets you pregnant" I throw back and she purses her lips before sinking down in her car, accepting defeat this time and leaving like her father told her to.
"Say hi to Jared for me" I call out, waving at her as she grips the steering wheel until her knuckles have gone white, putting it in drive and backing out of the driveway.
I walk over to the couch and let out a big sigh once I've sat down, throwing my head in my hands as a way to ground myself.
Breathing through this dizzy feeling from that whole confrontation that I had not been prepared for is a lot tougher than I thought it would be, my whole body still buzzing.
I hear Jungkook close the door behind him after having watched her speed down the street, still worried for her safety but also wanting to make sure she was actually gone. What happened just now was enough of a confrontation to last me a lifetime, or at least it feels that way.
"Hey" he whispers, kneeling in front of me and rubbing my back, "Are you okay?" he continues and I nod my head, feeling the tears prickling in my eyes, calling my bluff.
"Come here" he whispers, sitting on the couch next to me and pulling me onto his lap, rubbing my back again and holding me while I let out some of those tears I had held back.
"I don't even know why I crying" I say, sniffling and sitting back up to dry my eyes.
"No one likes getting into fights with someone they used to care about. Well, nobody sane likes getting into fights with someone they used to care about" he says, trying to lighten the mood and it does the trick making me scoff a bit, smiling at his efforts to make me feel better.
He cups my face and wipes a few tears that had fallen, looking at me with his brows pinched together as if his heart is breaking with mine.
"But you still care about her though, don't you?" he asks and I nod my head. "It's hard not to" I admit, getting off his lap and sitting next to him which makes him angle his body to face mine, taking hold of one of my hands, encouraging me to speak my mind.
"She's been my best friend for the past six years. That's not something that can magically be turned off for me. I know what she did to me was devastating and I don't think I'll ever be able to forgive her for it. I'm still trying to heal from it all so I don't know, I couldn't help but defend myself, and you. I'm sorry you had to see that" I say, mumbling the last part and feeling so much regret for saying those ugly things about his daughter right in front of him.
"Everyone has a right to defend themselves and when you're being attacked like that, you can't help but say hurtful things. She had no right and she knew that and wanted to hurt the both of us anyway" he says and I take a deep breath before turning my attention back to him because she said just as many hurtful things to him as she did to me.
"Are you okay?" I question, tightening my hold on his hand to hopefully encourage him to be vulnerable with me as well.
He nods his head with a sad smile and waits a beat before saying anything and I hold my breath until he does.
"No one wants their daughter to end up in the kind of situation she put herself in or see the people that they care about hurting but what she said didn't hurt me" he says and I nod my head, paying attention to his hand that I have placed in my lap, tracing the swirls of ink with my eyes as they travel further up his arm.
"What did hurt me though was the way she was talking about you. You know that's not how I feel about you at all right?" he says, tilting my face up towards him making purposeful eye contact with me, needing to know that I believe him.
"I know" I nod, giving him a sad smile accompanied by my still glossy eyes making him even more sad seeing how upset all of this has made me.
"Can I do anything to make you feel better?" he asks, cupping my face and keeping my eyes on him when I try to turn them away. "No, I'll be okay" I shake my head and he studies my features before nodding and accepting my words at face value.
"Okay, do you wanna go back up to my room? You can sleep in there with me if you'd like" he says, brushing a tear dampened strand of hair out of my face.
I give him a mischievous smile, telling him I know what he's up to but he pulls away and puts his hands up in a way to defend his motives.
"Just sleep, I promise. Scouts honor" he says, crossing his heart and I laugh at his playfully defensive nature. "Sure" I say, taking hold of his hand while he stands up and leads me back to his bedroom.
~~~~
After having talked a little bit more about what had happened the topic of conversation circles back to what we had been in the middle of before she showed up.
"So earlier it seemed like you wanted to ask me a question" I say, taking a sip from my soda that had come with the take out we had ordered hours ago, toying with the straw and keeping his attention.
"Yeah? And do you know what your answer might be to said question?" he teases, wetting his lips and keeping his eyes trained on mine.
"You have to ask the questions first Daddy" I say placing my drink down on his nightstand and when I turn to face him again he's tackling me down on the bed peppering kisses all over me.
"Stoooppp" I giggle and he laughs along with me before leaning back to hover over me. "Will you go out with me?" he asks and I can tell that this whole moment has him feeling like a teenager again.
"I thought you'd never ask" I say, running my fingers through his hair making him lean into my touch.
"You can't take it back though. Once we do this I won't ever let you go" he husks out, placing a kiss on my palm and I shutter at the feeling. "Then don't" I breathe out making a flame of desire flash through his eyes.
"You're gonna get yourself in trouble you know that?" he warns, placing a kiss on my nose before getting off me and turning off the tv. "Hey! I was watching that!" I pout "No you weren't" he chuckles. "Plus it's time to go to bed. We've got a big day ahead of us" he says, getting under the covers and motioning for me to do the same.
"Big day?" I question, not remembering we had something on the agenda this weekend. "I may or may not have planned out our date this morning while you were still in bed Sleeping Beauty" he says, pulling me onto his chest but I sit up pulling away from him with my brows scrunched together.
"How were you so sure I would say yes?" I scoff, shocked by his bold assumption. "From the way I've been making you moan my name I figured you wouldn't mind going on one date with me in return" he says and my jaw drops, throwing the covers off myself and making a break for it but he yanks me back towards him making me flop down on the bed.
"You can't just say things like that" I whine, hands over my eyes as a way to block him out of my vision and hide the very apparent blush that I'm sure is starting to bloom.
"Am I wrong?" he taunts, placing kisses on my neck and collarbone, dangerously close to making me moan his name again.
"You're no fair" I say, pushing him off and giving him my back making him chuckle at my shy behavior. He lays down and pulls me back into him. My back now against his chest and his hand placed on my hip where I'm again reminded that I'm only wearing his shirt and my under ware.
"Keep your hands to yourself Mr." I tease while prying his hand off me. "Come on darling, you know I'm a man of my word. Just sleep, nothing else" he says, this time sliding his hand further up to hold onto my bare waist.
"Fine" I grumble out and he laughs and nuzzles his nose into my neck, taking another deep breath, flooding his senses with my scent.
"Goodnight Bunny" he mumbles against my skin. "Goodnight Daddy I tease and am rewarded with a slap on my ass.
"Did, did you just spank me?" I say trying to wiggle out of his hold but he's already got his arm wrapped around my waist again. "I told you that pretty little mouth of yours was gonna get you into trouble didn't I?" he says, switching to rubbing his hand along the tender flesh he just struck, caressing it in a way to ease the pain.
I pout and settle back into the bed, not dignifying his words with a response. It's only when I accidentally move my hips backwards do I freeze from gaining a soft moan from him, no doubt caught off guard from the contact of my ass up against him.
"Sorry I didn't mean to I-" "I know Bunny, just go to sleep" he says placing a kiss on my neck and holding my hips in place, putting a little more space between us.
As I slow my breathing to a steady one I start to lull myself to sleep but I flinch at the sound of his cute snores in my ear. 'Something I'll have to tease him about in the morning' I giggle to myself and take his hand off my hip, choosing instead to hold it against my chest having him surrounding me. Soon I'm slipping into that dreamland he had drifted off to moments before, safe and warm being in his arms.
prev / next
Series Masterlist
Taglist: @jkslipppiercing @trina864 @kaitieskidmore97 @goddesofimortality @coolbluedude @00frenchfries00 @bangtans-momma @coralmusicblaze @pastelpinkjoon @joonwater @marvelbun @j3nni-rs @evidive @beomieboi @forevrglow @jesssssmaybankk @teugiie @chaconnelatte @whoa-jo @snehal @xumyboo @mindurbuzznezz @diorh0seokie
Join my Taglist!
Feel free to fill out the form or just comment on any of my fics to be added :)
446 notes
·
View notes
Shunning: Jason Todd x reader
request: Jason comforting reader cause her friends ostracised her.
A/N: hopefully this will put a smile on the face of everyone who felt back for being rejected in any form it may come.
***
They were madly in love, there was no denying that.
But not in a lovey-dovey kind of way that was reserved only for the time they were alone and felt safe enough with the other to let that side out. It was rather mercilessly-teasing-not-really-meaning-all-those-mean-words-coming-out-of-my-mouth-cause-only-I-can-do-that manner.
However, there are boundaries to every relationship.
Especially when one of the parts in couple is a infamous vigilante/antihero.
And ever since the beginning Jason made it very clear that Y/N was not supposed to visit his apartment when he was not there. It was his duty to keep her safe. At all costs. And since sometimes it happened that due to lack of strength after patrol he just crashed his regular flat instead of safe house, no one, no one, was allowed to connect Y/N Y/L/N to Red Hood.
No fucking one.
Even if it meant giving her the spare key as a sign of commitment (but only because Jason tended to lost his own too often), but also simultaneously pushing her away by making the hereinabove mentioned rule.
Yeah… it hurt.
But she understood.
She understood all the rules and boundaries and safety precautions coming from being with him and if that’s what it took to call him hers – so be it.
So normally she stuck to the principles.
But—
***
8 a.m.
It was one of the hardest patrol he had ever had, but some kind of crazy instincts made him push forward and patch himself up at the nearest lair. Which wasn’t even his in the first place, but that was something Grayson would never know. And also- besides the point.
The fact was, though, that he came back to his official address (official for someone who was still legally dead, of course), dressed in regular clothes and without blood stains with plasters all over his face.
Planning to maybe call his girlfriend so they can spend the nice day together.
Hoping to see her teasing smirk and eyes rolling, knowing she was the one to match his sarcasm, give him hard time making this relationship a challenge for him, which was exactly why she fell for her in the first place. Or maybe it was the fact that underneath all that rough-around-the-edges surface they were so similarly sensitive on the inside it made it easier to connect on so many levels.
Lost in his thoughts he opened the door and immediately knew something was wrong.
Energetic music coming from the kitchen.
Some crazy (DELICIOUS!) smell.
And the opened curtains that make the dim Gotham light permeate the room.
The hell?
Jason grabbed his pistol from the shoe (regular clothes or not, forewarned is forearmed) and busted into kitchen, grabbing the intruder by the arm, pointing the gun to their head.
“Auch! Fuck! Jay!”
“Y/N!” the gun landed on the floor and she immediately kicked it away, so it wouldn’t fire on her leg or foot.
‘Well morning to you to!”
“The hell you doing here?!”
“fucking breakfast!”
“What?!”
The scene was truly grotesque.
Boyfriend and girlfriend, who were, may I remind you, madly in love, standing on the opposite side of the kitchen, one of them clearly in need of some loving and rest, the other offering exactly that and yet they settled on yelling their surprise out at one another.
“I’m gonna ask you again- what are you doing here?” Jason almost hissed, his own protective and possessive instincts kicking in in a Red Hood style.
“I told you-“ she became a little defensive, but sure as hell not submissive or humble.
“Y/N!”
“Stop yelling at me Jason!”
The way she accentuated the last word, his name, made him stop for a moment, groan in frustration and run hand over his face, almost poking his eyes out. Right. He was Jason now. Her Jason. And she didn’t deserve the aggression and violence (she had her fair share of that coming from men).
“Okay, fine. I won’t yell. But explain to me.”
“I needed you—” she finally whispered.
Any other guy would just melt at such sweet confession coming from the loved woman, but Jason? Nah. He was way more perceiving and knowledgeable about her quirks.
So he noticed.
Her sad eyes.
Her nervous energy.
Her feigned smile.
And the fact that she not only just made him his favorite breakfast but also was currently keeping an eye on the blueberry muffins in the oven.
“Y/N….” he said calmly to get her attention.
“Yeah, huh, what’s wrong?”
“I should be asking you that question…”
“What you mean?” she raised an eyebrow.
“Don’t trick me honey.” He warned with a grin and before she realized what was happening around her he grabbed her, threw her over his shoulder and carried her to the living room, ready to coax, force or hug the truth out of her. No holds barred.
“My muffins!” she yelled struggling against his grip.
“Yeah, whatever, as long as we don’t need firefighters here I don’t care.”
He threw her on the couch sitting beside her.
“Talk to me.”
“It’s nothing really I –“
“you know I’d hate to be the therapist in this relation and steal the job you do for me, but for Christ’s sake Y/N, let it out.”
Okay, so he clearly did not think those words out.
And it was not his intention to make her cry.
Even if her snuggling into his chest made him feel like she actually needed him. Like she wasn’t always the tough, self-made, self-sufficient girl.
“Oh…” he gasped wrapping arms around her. “Shh… sh… it’s okay. I got you. I got you, you can tell me.” The mindless words were just coming out his mouth when he pulled her closer not caring about black mascara smudges on his favorite shirt. (which was old either way, so no shame in ruining it).
“Do you think I’m pathetic for being an introvert?”
“What?” he blinked a couple times, frowning and searching her face to make sure she was serious with that question “Since when you’re an introvert?”
“Jason…”
“Ok, princess listen to me. I have no idea from where that idea got into your pretty little head but-“
“My friends.” She stuttered wiping her eyes smudging makeup even more looking like a cute little panda and despite all the seriousness from her part Jason smiled for a moment considering the view adorable.
“come again? Your friends?”
“Yeah…” she sniffled “my friends. We were supposed to hang out last night, but when I reached out, cause I was feeling a tad lonely” she send him a look “they all respectively said that they are busy and tired and maybe another time.”
“Uh-huh.” He nodded “I got a feeling I know where this is going-“
“Believe me, you have no idea.” She rolled her eyes, sadness slowly making way to annoyance and frustration “not only they went partying, which I found out via Instagram, hashtag somuchfun, hashtag hotgirlsparty, but also figured it was Allison’s bachelorette party!”
“That Alison?! The friendship bracelet Allison?!”
“yes! Can you imagine the audacity!? And she’s been engaged for months and everyone knew!”
“No way!” Jason gasped while they both acted at least like Hollywood wives gossiping about first world problems.
“Also, I have to say how much I appreciate you actually listening to all my silly girly ranting.”
“Of course baby” he kissed her forehead rubbing her back affectionately “but don’t tell it to anyone. Now seriously, all jokes aside, are you all right? I mean – not that I have much experience with friendship-“
“Roy.” She cuts him off with a firm voice.
“Ok, fine, fine! I’ll make peace with him!” he raised his hands in surrender “that’s not the point. You were straight forward casted out! Ostra-fucking-cised! And the fuck why??” now he was becoming a little angry.
“Cause clearly I’m a mood killer, no fun, tense, embarrassing, don’t know how to party-“
“WHAT?!”
“Jason?” she looked at him briefly “Jason! JASON! HELL! Put that gun down and get back here!” she yanked the back of his shirt pulling him back to the couch before he could something reckless and irreversible.
“Let go off me princess I have to-“
She started crying again.
“Oh god! Oh baby please don’t cry, I’m sorry-“ he cupped both her cheeks falling to his knees and wiping the tears away “Y/N, love, please I didn’t mean to –“
“There’s only one thing you have to do now.” She calmed down at once, revealing that her tears were just another trick.
“Bloodbath?”
“What?! NO! You stay here and pamper me! Comfort me!” she smacked him on the head, soft enough to not make any damage. “Jeez! How many times will I have to teach you!? A girl, your girl is crying. What do we do then?” her voice was reminiscent of that of a primary school teacher
“We hug. We say nice words. We don’t let go until she feels better. We let her do all she wants cause she’s sad.” He answered mechanically.
“Very good, Jason” Y/N teased “gold star for theory, now can you please make it into practice?”
Ten seconds later she was wrapped up in his strong arms, with one of his hand cradling her head and brushing the strands of her hair, the other on the small of her back.
“For the record, I think introverts are cool. Seriously, the hell is wrong with the world making a false impression that you need to crash everyone just to get somewhere in life? Like I don’t know, make a name for yourself by being loud and show-offish.
“Jason…” she laughed and it made his chest reverberate
“What--? Oh! Hey! That’s not what I meant! We were talking about you,, not me!”
“Well you made me laugh, so good job on that!”
“You know what on the other hand, introverts are assholes. They are always quiet and listen and remember everything you say only to use it against you later on. Like little rat searching for the hole in everything.”
“Hey!” she poked his ribs
“Oh no, princess, that’s out the line!” he laughed rolling on top of her, tickling her. “You’re the most amazing introvert I have ever met, you hear me? Life is a constant party with you and your beautiful mind, ok? So what if they didn’t tell you about the bachelorette? I mean, sure it sucks, but I bet her fiancé is an ugly ork.”
“And how is that supposed to make me feel better?”
“Cause baby believe me, once you get thrown a bachelorette I’ll make sure that not only Instagram but also all the magazines will be racing to get photos of that party. How could they not? The prettiest, most amazing girl in Gotham not being available anymore! Damn, Kardashians will get jealous of you!"”
“Are you asking me something here Jason Peter Todd.”
“You and your admirable fantasy.” He smirked kissing her forehead “I’ll leave you hanging, but tell me one thing. Do you really need fake friends? You already have a zombie boyfriend, isn’t that enough for you? Starring in a “Walking Dead”, now you also want “Mean Girls?” he faked indignation “so greedy!”
“Your impossible you know that?” she smiled at him, the first genuine smile since she came to his apartment.
“Hell no, I’m way more handsome than Tom Cruise!”
“Jason!”
“What? You wanted to be comforted, you can only get it done my style.”
“Hey. Hey look at me” she cupped his cheek so their gazes could meet.
“Yeah? What is it my sunshine and rainbows?”
“Don’t stop, okay?”
“Never.” He grinned. “You’re stuck with the tacky humor and dry jokes.”
***
And with a burning blueberry muffins
481 notes
·
View notes
this time (alhaitham x gn!reader)
SALUTATIONS. this time (part two of next time)
ADDRESSED. alhaitham (w/ gn!reader)
STAMP. in which things have never been the same since your lover found you after you’ve been kidnapped, and tries to win your heart once more as well as for your forgiveness. (this is mostly on alhaitham’s pov after saving you)
CONTENT. angst/with-comfort, slight spoilers to sumeru archon quest (3.2), mentions of kidnapping, mentions of violence, reader now has a vision and is slightly traumatized, grammar errors, ooc alhaitham (only skimmed through his lore while writing this fic)
POST-SCRIPT. yipeeee it’s finally done !! special thanks to @crowbird who sent an ask about this fic, it’s acc what i was going for as well (but ive made reader suffered enough so i didnt go all out)
LINKS. masterlist \ taglist
How long has it been since Alhaitham has been waiting outside of Bimarstan?
He couldn’t recall, but neither did he care about that. What he cares more is what’s happening inside the hospital where you’re currently treated.
As soon as Alhaitham’s done with his part on the mission, he didn’t waste any time to start looking for you, his heart beating faster than ever from his worries of what the Akademiya has done to you.
Whatever they did, he hoped that you were okay.
With the help of Cyno and some of his friends, he managed to find out that you’re located in the desert, but not in a state he had hoped he’d find you in.
It took him two days until he finally found you in an abandoned hospital, only to see you standing in the middle of the room with a hollow look on your face, surrounded by fallen eremites and other people who are working for Azar–
Not to mention.. A vision in your hand, one that holds the symbol of anemo.
What happened?
Alhaitham paid no mind to the unconscious bodies on the ground, his focus is on you – who remains unaware that you have other company besides your captors.
“...( Name )?” He cautiously called out.
You immediately turn around when you heard a familiar voice, only for your eyes to widen at the sight of your lover standing not too far away from you, his weapon in hand–
Oh gods, what have you done?
It begins to dawn on you when you realize what you just did, causing you to start breathing heavily. “I… I didn’t mean to–” You look down at your shaking hands with wide eyes, “I didn’t mean to knock them– th-they tried to take me away, to some… to some guy who goes by the Doctor and I-I was so scared, I was freaking out and, and one of them was about to hit me and suddenly everyone’s jus–”
You find yourself falling onto your knees with a sob, the fear and anxiety you tried to hide for the past two days as you were pushed and dragged through the sand and heat slowly started to come out in the open.
“I’m sorry, I’m sorry, I’m sorry” were all the words you could muster at the moment, not noticing how Alhaitham starts walking towards you.
It was only when you felt something warm beginning to wrap around you when you realized your lover’s hugging you in a comfort embrace, causing you to let out a shaky gasp.
“I don’t care what you did to them,” Alhaitham tells you, his heart shattering at the sight of you being frightened with yourself, “I’m just glad you’re okay now. You’re safe, ( Name ).”
He closes his eyes shut, not intending to let you go just yet. “I’m… I’m sorry for everything. I’m sorry for leaving you. I regretted leaving you out of the dark with what I was doing and… I just wanted to keep you safe, but it seems it only made things dangerous for you instead.”
You couldn’t help but be taken back from how his words sounded so sincere, so genuine – you knew how your lover is with these kinds of things, so you knew just how much he means it when he apologized.
You couldn’t help but break into tears.
“It hurts so much…” You hiccuped, hugging him back as you sob. “I thought… I thought I did something wrong that made you–”
Your breath hitches when he holds onto you tighter. “This is never your fault. It’s mine alone for never considering how this would affect us badly. You’ve been nothing but an amazing person in my life and I took it for granted.” He said, angrier with his foolish self for making you feel this way for all this time.
“I… When I found out that they took you, I felt like I.. I’ve...” He struggles to find the right words to tell you just how scared he was when he found out about you being held captive by the Akademiya.
He relaxes when you start moving your arms around him. “I know..” You whispered reassuringly, as though you read his mind. “Just take me back, ‘Haitham.”
–
“Mr. Alhaitham?” Alhaitham’s thoughts are cut away when he hears the familiar voice of the doctor who took charge of healing you, causing him to stand up when he sees him walking out from the door.
“How’s ( Name )?” The scribe asks.
“They’re doing well. They just need more food, water, and plenty of rest and they’ll be okay. Though, we need to keep them under our watch for the rest of the week to check up on their major injuries now and then.” Zakariya then let out a sigh. “I just can’t believe their captors are heartless enough to not feed them well, not to mention the injuries inflicted on them. It was fortunate enough that you’re able to find them before things could’ve gone worse for your lover.”
Alhaitham’s heart feels broken once more when he hears about your condition, making him all the more angry that he wasn’t fast enough to find you (and the fact that Azar and his pathetic followers’ punishments aren’t enough).
“May I visit them now?” He asks.
The doctor nods in response. “I believe so. They were looking for you when they woke up.”
That was enough for Alhaitham to immediately come inside the hospital (not without thanking Zakariya, of course) and visit you, bringing your favorite meal that he made beforehand as well as flowers.
It reminded him of back when he was on his way to take you out on your first date together, with him always fixing his outfit (despite the fact that you’ve seen him wear it everyday) and checking if he has everything – as though he was a bit nervous.
By the time he eventually arrives to where you are, you notice his presence immediately, causing you to turn away from the view of your window and look at your lover.
The two of you stare at each other in silence, not knowing what to say.
Alhaitham decides to break the silence. “...How are you?”
“...Never been better, I suppose.” You respond quietly, looking down at your hands. “I mean, my lover’s finally talking to me after so long and I’m no longer blind and tied up for two days straight; not to mention how I didn’t kill anyone when I received my vision so… that’s good.” He winces from your words.
You then look up to where he is. “I can’t… forgive you so easily for what you’ve done as much as it sounds selfish of me.” You confessed.
Alhaitham shakes his head. “No, it’s alright. I expected you to not forgive me straight away.” He says reassuringly. “All I ask is if you could give me a chance to make everything up. Let me make up for the time we lost.”
You frowned. “Then what? Will you suddenly get busy again and ignore me for the next few months? A year maybe?”
“I won’t repeat what happened last time.” He said. “Not when it almost cost me to lose you.”
Your eyes soften. “I’m too scared to take the risk and experience the same thing all over again.” Deep down, you were touched when you heard from your nurse that your lover did everything he could to find you and get you back, as well as how he waited for a long long time until he was allowed to come inside the hospital and see you again – without reading a book even.
But you knew that you can’t just let what he did slide so easily.
“Trust me. Just one last time.” Alhaitham asks, almost in a desperate way. “If I mess up again, and I’ll make sure I won’t, then you can leave me.” He wanted to come closer to you, to sit down on the edge of the bed and place his hands on your wrapped hands in a reassuring way, but he didn’t want to overstep your boundaries. “If you still want to leave me without a chance, then that’s alright.”
You quietly think about what to do. As much as you’re heartbroken that your lover had ignored you for such a long time, you still unfortunately love that man, but you can’t forgive him just yet.
You let out a sigh. “I’ll give you one month to make it all up to me, then I’ll decide if I leave.” You said, causing his shoulders to relax.
“I won’t let you down, ( Name ).” He declares with confidence.
You smile lightly, now noticing the things he’s been holding throughout the whole conversation. “You do know that giving me my favorite food and my favorite flowers today isn’t enough to make me forgive you, right?”
Alhaitham hums. “I’m aware. I’m guessing that the hospital didn’t give you any food that you’re craving, so I thought about making it for you before I visit.”
You know he was right, although the hospital did give you food to eat, it didn’t match the sweet taste of the ones you’ve been longing to eat, such as the foods that your lover always cooks for you whenever he can just for you.
“Pretty sure they cooked better than you though.” You joked.
His lips slightly move upward. “Oh? Won’t you try and see if you’re right then?”
You scoot over a little, a small invitation for him to finally come up to you. “Only if you hand-feed me.” You said, thinking he’d refuse and make you eat it yourself.
To your surprise however, you underestimated just how much that man loves you.
“If that’s what you wish then.” Without hesitation, he instantly comes up to your bed and sits down next to you, putting your flowers next to your bed and unpacked your meal (you didn’t bother to point out how he looked so eager to do so).
As you eat your meal that he made, you can’t help but reminisce about the times when he used to do this to you. Particularly when you get sick and he has to take care of you, something that he always reassures you that he’s completely okay with it and willing to do it as long as it’s for you.
“I’ll have to cook meals for you everyday then if it makes you that happy.” He suddenly says as he feeds you, making you realize that you’ve been smiling the entire time. “What do you say about curry shrimp tomorrow when I visit here?”
“You’re going to visit here again?” You ask in a surprised tone. “Don’t you have things to do with the Akademiya?”
“Even in different situations, I’d still put everything down just to take care of you.” Alhaitham explains. “Don’t worry about my duties in the Akademiya, I’m sure they’ll be doing alright without my presence for a while.”
You hummed. “Alright then.”
–
Alhaitham is one dedicated man, you’d admit.
Everyday, he’d always come and visit you with a meal in hand, as well as things that could make you no longer be bored from lying down on the hospital bed all day. On some days, the two of you would play TCG (with Cyno, Kaveh and Tighnari whenever they visit you), read books together silently, listen to music together with his music player that he personally made when he first became the scribe, and even take a stroll around the street together.
You’re still reluctant with his company, but nevertheless, you didn’t feel uncomfortable from it.
Of course, there were other things you’d do whenever Alhaitham is away. Sometimes you’d be found helping the doctors and nurses taking care of the patients, taking care of all the flowers he gifted you, and so on.
Your injuries were slowly getting better, much to everyone’s relief, and you were no longer as shaken up as before from the incident that happened on the day Alhaitham found you.
Not that he asked you about it. Now that you think about it, not a single person dared to ask what happened to you during your kidnapping, nor did anyone ask how you got your anemo vision, excluding some clueless people who were unaware of what happened to you.
Cyno did a good job in making sure that it looked like the eremites and Azar’s subordinates were ambushed by him and Alhaitham and not you, not wanting you to get in trouble for simply defending yourself from your captors. You’re grateful that he never questioned you about what happened.
It was hard to get used to the vision that reminded you of what happened, but with your friends’ help, you managed to slowly live with it as well as learn how to use it to protect yourself better.
By the time you were released from the hospital, you’re surprised that Alhaitham’s still continuing to do the same thing he’s been doing for the past week.
During your meals, it was Alhaitham who’s been doing the cooking instead of you, with Kaveh whining about why he doesn’t get the same treatment. He also made sure to always kiss you goodbye before he sets off to tend to his duties in the Akademiya, something that you missed for so long.
For someone who has an unpredictable schedule, he always makes sure to make time for you, for what is freedom if he can’t enjoy it without you?
Slowly and surely, you begin to forgive him and find yourself smiling every now and then.
Sure, he’d sometimes come back home late, but it was never like last time. Sure, he’d sometimes be too focused on his work in his office, but it was never like last time. Unlike last time, you finally feel like you’re living with a lover and not a stranger.
Whenever you could, the two of you would go out in the woods and train your skills with your vision, something you’re grateful for since using a vision isn’t as easy as you thought it would be.
The kidnapping still haunted you with nightmares that made you lose sleep as well as some things that reminded you of it, but with Alhaitham, you feel less scared and more comforted from him, who always made sure to stay by your side and be with you when you needed it.
He’s more considerate than before, you’d admit.
Of course, you made sure to show your gratitude by visiting Alhaitham in his office in the Akademiya like you usually did before, secretly surprised with how he’s always found in his office despite the fact that he’s usually everywhere but there (it’s as if he’s been anticipating you to visit him), and give him a meal that you made before going your way to the Grand Bazaar.
Until one day, Alhaitham requested you something.
“When you come and visit me at the Akademiya…” You slowly waited for him to tell you to not come there, only for your eyes to widen at his next words. “...Do make sure to bring two meals so we can eat together.”
You processed what he just said to you. “You mean… eat our meals together? You and me?”
He nodded in response, looking as though he’s unbothered with what he said. “Who else if not you?”
You try to hide your smile before obliging his request. “I’ll keep it in mind then.”
Since then, you find yourself eating your meal with your lover whenever you come and visit.
You never dared to point out how his lunchbox is always clean and empty whenever he’s done with it.
Sometimes if time allows it, he’d also visit the Grand Bazaar to watch you perform on stage with Nilou, who’s shocked to see the scribe himself – especially with a fascinated look on his face as he watches you perform.
After your performance, Nilou couldn’t help but carefully ask him about his presence in a place such as the Grand Bazaar.
The man could only huff. “Am I not allowed to support my lover?” He comments. “Don’t mind my presence and go enjoy what you love just like what I’m doing right now.”
“Watching your lover?” She questioned quietly, looking back at where you are, who’s currently helping one of your colleagues with another task. “You must really love ( Name ), huh?”
“Not just love.” He clarifies, crossing his arms. “They’re my freedom and eternal oasis.”
Nilou feels touched by the scribe’s words. She could see now why you’re so willing to give him another chance.
“( Name ) feels the same way, if you’re wondering.” She said with a soft smile. “I hope you’ll continue to make them happy like they are now. It’s been so long since the Grand Bazaar’s last seen ( Name ) being this happy.”
“I’ll make sure of that.” Alhaitham assures the woman, his eyes softening at the sounds of you laughing at whatever your colleague told you. “I’ll make sure they’ll be happy, even if we’re no longer together like now.”
Even when you’re still hesitant to forgive him in fear that it’ll happen again, Alhaitham is willing to wait for you and prove to you that he won’t do the same thing ever again no matter how long it takes.
Just like how you waited for him to come home when he was nothing but distant, he’s willing to wait for you the same way.
PENPALS. @scaraslover @saving-for-xiao @dawgimsohot @kazu-topia @chiruru @aqualesha @renamichii @mrkamisato @shenhesl0ver @serami00 @serenareiss @hiqhkey @emperatris-rinaka @bystander36 @irisxiel @ladycoleigh @034ven @dear-dairiess @owozi8 @hadesaedes @chiro-chiro-kun @hersscherofyatta @mariusvonhangme @yuzuricebun @hoshikistarlette @solaaresque @crowbird @lordbugs @flowersforayato @headintheclouddd @estelwrld @giyusimpsassemble @irethepotatosblog @moonlightaangel @alice0blog @shotosbrainrot @sniffoat @chihawari @mxsomn @kuni-kuzushii @jiminscarmex @mitsukii14 @nejibot @ylimeprive @sachispet @loreleis-world @sn-owo @starforecasts @someonetookmynamelmao @ceylestia @astrequa @ymikkos @reallysporadicarcade @melodyyamino @dudufodd @somberrock @yevenly @lemontum @nghing @shaiah @aintafraidtolove
3K notes
·
View notes
wait and see ✴︎ cl16
genre: enemies to lovers, fluff, angst barely, other drivers appear
word count: 2.5k
The grid recounts the evolution, nature, and many ups and downs of your and Charles' vague relationship.
auds here... req'd, this was p fun to write i hope u guys like it! :) short bec if it was any longer it wouldnt have been as nice to read i think? anyway... i love u guys. title from this.
Lando takes a seat. “Is this the thingy for…? Yeah? Okay. What am I supposed to do again?”
“Just describe the two of them.”
“Easy. She was always pissing him off.” He rubs his chin, lost in thought. “But… in a good way?”
—
“I told you a hundred times I didn’t want this to be the soundbite you published.” Charles chases after you, his footsteps quickening like a lost puppy as you wrestle your way into the media pen. “A hundred times, and you said okay, and you still published it. Che succede?”
You turn, crossing your arms over your torso. “Look. I said yes, but when I looked it over, nothing else you said was really worth it. It was all just repetitions of the same PR bullshit that makes you look good on camera.”
He rakes a hand through his hair, exhaling with frustration, watching his biting comment on Iñaki rack up hundreds of thousands of views. “This was not a good idea!” He repeats, the same sentiment he’s been telling you in the half-hour he’s known of this video’s publicity.
“But it happened.” You adjust your mic and gesture to Lando, who’s awkwardly waiting for the cameras to roll so you can start the post-FP2 interview and he can talk about his shit car. “I’m busy, so deal with it. Your fans will appreciate you not riding Ferrari’s dick all the time.”
Charles opens his mouth to argue, but shuts it, shoving his way back outside and into the motorhome so he can cooperate in damage control. He doesn’t admit it—to you, to Carlos, to anyone—but the PR that comes of it is more good than it is bad in the end. He doesn’t admit it because it means admitting you’re right, and God if that’s the last thing he’ll ever do.
—
“They were always butting heads,” George says, laughing as he soaks in the memories of it. “Always fighting over something. Anything. Whatever there was that could be disagreed on—they’d be disagreeing.”
—
It started harmlessly enough. Seb walked in with two swatches of color—a blue and a purple—and addressed the room with a light tone, asking what color would best suit the tablecloths at his wedding. And then, as it always did with you and Charles, chaos ensued.
“Blue suits green better.” You wave the blue in his face. “You’re busy thinking of red all the time so you don’t understand color theory.”
“It’s not about coordination! It’s about creating a highlight!” He gestures with his hands, aggressively gesticulating to try and get his point across. “Highlight!”
“Oh, bullshit! Blue!”
“Purple!”
“Are you crazy?!”
Across the room, Seb and George watch in mild horror at the two figures caught in a needlessly intense argument over colors at a wedding that isn’t even theirs.
An AlphaTauri engineer comes in to refill his coffee for the third time, finds the two of you still fighting and is genuinely stupefied. He turns to the two onlookers, asks, “Bridezilla, huh? Happened to me once, too. I swear the grooms always try to weasel their way in to seem more involved but their choices never make sense.”
“Oh, no. They, uh, they’re not together.” George clarifies quickly.
“They’re not?!” The engineer and Seb ask at the same time.
They all watch the argument, bemused, but secretly they all wonder just how correct George is.
—
“We have a saying in Spanish. Del amor al odio hay un paso. Neither of them will understand it—it’s in Spanish, obviously—but I think that applies to them. One minute you think they hate each other, and the next…” Carlos lets himself taper into silence, smiling softly.
—
Being around Charles feels like karmic retribution, a constant eternal push and pull. But it makes the both of you better, even if neither of you admit it in the end. You can’t really grasp why, or how it started—it might take ages if you do so much as try—but you’re content with letting things happen the way they do.
Or maybe you’re not. “You ruined my fucking broadcast, dickhead!”
You toss your earpiece at his chest, body welling up with annoyance. Your segment was being casted live until Charles insisted he take up your airtime to do whatever-the-fuck, you honestly don’t care. And yeah, sure, he’s way more relevant, but the less airtime you get, the less easily you get the exposure you need.
“It happened one time.” He sounds amused, and it patronizes you, sets you on fire. He clutches your earpiece to his chest and hands it back to you.
“Fuck you.” You tug it toward yourself, and suddenly you’re closer, noses almost touching. You step back, but it’s not enough. “You have no idea how much that mattered to me.”
His eyes flit toward your lips, your bodies melting together. “If it really did…” he says, inhaling, “you would’ve just ignored me.” And damn, he’s right.
Charles does not like you. He just knows you well. But then one might argue—isn’t that the same thing?
—
“They have trouble not calling the shots, is the thing,” Lewis offers. “So put them in a team, in a room together, and boom.”
—
“…We didn’t agree on this script.” You underline the problematic lines and toss it onto Charles’ lap from where you stand in front of the sofa. “You want your fans to hate you?”
“The questions were clumsy. I asked you to reword them, but you didn’t.”
“You didn’t ask, to be clear. You demanded.” You click your tongue.
Lewis is in the middle of posting on Roscoe’s Instagram account and manually making typos, but he looks up, interest piqued by the increasingly heated conversation.
“I asked,” Charles insists stubbornly. “Plus, this is a Ferrari segment. You get hired to write on Ferrari, you follow Ferrari.” He points to the yellow logo on his shirt. Ferrari, he mouths. Lewis stifles a chuckle at the sarcastic exchange.
“Jesus.” You reread the script. “Fine. I’ll reword this and this.”
“And that.” He points, tapping the paper.
“Only if you edit this and this. Oh, God, and this.”
“Fine. Wait, that?”
“Are you serious? It’s the corniest statement ever. Edit that or I edit nothing.”
“Okay, bossy.”
Lewis exits Instagram in favor of texting Seb to ask if you two are dating. The response he receives is equally unhelpful: Nobody knows mate.
—
“You know, for all the disagreeing they did, they actually agreed on so much of the same stuff. If they stopped fighting for two seconds they would agree on most things.” Alex muses. “But they never did, so. Or maybe a few times.”
—
Media is a tricky thing. It’s either on your side, or it isn’t.
And this weekend, Charles has drawn the short straw, subjected to bouts of backhanded journalists and tweets for his strategy during quali. You know this especially well—you’re media, for Christ’s sake—and you’ve seen your colleagues hound Charles for how he chose to tackle the session.
Alex is in the middle of a FaceTime call with Lily when he hears it. “Wait—I think they’re talking,” he says to his girlfriend when he hears you approach him, carefully maneuvering himself into optimal eavesdropping position.
“Is this the right thing to do?” Lily’s voice comes through like static.
“I know it’s wrong,” Alex confesses. “But—”
“No, I meant I can’t hear properly. Move the phone closer, you dick.”
So he does, and the two of them listen intently to your talk. You go first, a few shuffling footsteps and an adjustment of your media pass, then. “Will’s been all over you today.”
“Yeah,” comes Charles’ voice, tired if anything. “I, uh… I just hope I can understand where I went wrong and, uh. Well, uh.”
“No, I…” There’s heavy silence. “I think you did the right thing. You didn’t get pole, but it was a good strategy. Better than what was being proposed, anyway. I think that would’ve landed you at the back of the grid, to be honest.”
You both laugh. “Thanks,” he croaks.
“You did great. Don’t, um… don’t let them tell you otherwise. I’m proud of you.”
Alex never tells anybody what he heard. But it inspires many long-winded conversations with Lily about the nature of your relationship. Each time, though, they never arrive to a solid answer.
—
“Hey, listen. I always knew something was there with those two. They had the kind of dynamic you only find once in, like, a million instances.” Daniel says firmly. “But I also kept thinking… poor Charlotte.”
—
You’re half-sure Pierre was the one who bought you all shots. Or a quarter-sure. Okay, you’re not sure at all. Your mind’s cloudy, your inhibitions lowered, tongue loose and laugh contagious. Around the table everyone is laughing, some others have gotten up to dance, but you, Daniel, Lewis, and Charles are all conversing about work, albeit while drunk.
“Is… tequila… plant-based?” Lewis grimaces as he throws another shot back and you all laugh mindlessly.
“Danny,” you say, tapping his shoulder. “Any plans once you’re out of the paddock next season?”
“Ah,” he hums. “Self-discovery and a shit ton of shrooms.”
You all cheers to the epiphany, shots once again entering your system. “And a party again tomorrow!” Daniel adds half-jokingly, much to your delight. Charles, right beside you, throws an arm over your shoulder as he laughs. You’re unfazed.
Daniel’s gaze lingers on his arm a little too long, especially because your own hand reaches upward to wrap around his wrist, to make sure he doesn’t pull away. But you’re both drunk, he reasons. And plus, you can’t usually stand each other’s guts.
“I’ll pass, mate, if it happens,” Charles says, his tone clearly inebriated.
“You’re no fun,” you say lightly, laughing and turning to him. Your eyes are on the other’s, dark, lips almost touching as if you’ve forgotten Daniel and Lewis are even around (though the latter is as good as dead, honestly.)
“Invite Charlotte instead,” Daniel says with a smile, to try and test your reactions. “How long, now? Three months?”
You clear your throat, looking away with a faux smile.
“Oh. We’re not doing so well, to be honest.” Charles smiles, tight-lipped. He hopes Daniel doesn’t ask why. He can’t think of a lie quickly enough to cover how Charlotte told him I love you, Charles, but this is over. I hope you end up with her someday.
—
Seb takes some time to think about it. “Those two always fought. Everyone said that, didn’t they? All the time, disagreeing.” He hums. “I could tell very early, though, that they were also the only two who could truly understand the other. Figuratively, obviously—but as a result, also literally.”
“Elaborate?”
“When you understand someone that well, inside and out, you end up understanding everything they say.” Seb smiles. “That was them, I think.”
—
“It’s impossible to transcribe your interviews,” Will says to Charles. It’s that hour on the paddock where everyone’s waiting for the pre-race bustle to start, so small talk is what’s keeping them busy.
You’re reviewing a few clips from practice on your phone and Seb is chipping into the conversation, which has moved from Mick’s future to F1 into Sky Sports into this.
“What do you mean?” Charles asks.
“You’re always sliding in and out of your three languages!” The Englishman laughs. “I have to consult a native speaker of both Italian and French each time. And you’re always going I, I, I, or we, we, we… but hey, the fans dig it, innit?”
“I think I sound perfectly understandable.” Charles smiles. You’re still busy, unfocused on the conversation at present.
“Like, okay. Look at this.” Will retrieves his phone, opens his voice memos app, and plays one of the audio recordings there. It’s a scratchy one of Charles describing his quali session, and sure enough, even if he’s speaking straight English, the adrenaline and exhaustion have him sounding totally indecipherable.
We—we had gasjdhfhs and I, I, I… I think we need to rejshdhs and thijsjsh about the hsfhdh, yeah? And, and, uh, we ajhshajs. And
Will closes it. “Sebastian, can you tell me that said?”
He shrugs, amused. “Sorry, Charles. I genuinely can’t.”
“See?!” Will makes a voila motion. “Nobody understands this.”
“He said we had good traction and I think we need to recalibrate and think about the boxing strategy, yeah? And we need that mindset.” You’re still going over your phone, busy and not 100% invested. “You two just aren’t listening.”
Charles doesn’t take his eyes off you, or the smile off his face, the whole hour.
—
Pierre comes last, clearing his throat. He’s ready. He knows exactly what to say, so he says it. “Those two are fucking soulmates.”
—
It’s three-thirty when somebody knocks on your hotel room.
But your body still feels like it’s five in the evening, your brain’s stuck at two in the afternoon, and your sleep schedule thinks it’s nine in the morning, so you’re not asleep but instead rewriting notes from the weekend prior.
You’re horribly disoriented when you grab your pepper spray and unlatch the door, and even more disoriented when you see Charles on the other side of it.
“Am I crazy?” He asks, breathless, like he’s been waiting for you all his life. Maybe he has.
“You’re at my hotel room at three a.m., so… a bit.” You rub sleepiness and jetlag out of your eyes. “Charles, what’s going on?”
“I love you.” There it is. “It sounds so stupid. But I love you. And it’s almost—I can’t bear it. I woke up this morning? You, on my mind. Lights go off after a race? You. I go to sleep? You. It’s always you. And I know, I know it’s—I know, with Charlotte, and—but it’s true. I, I, I—I think about you every minute. And usually this happens accidentally. Nous sommes tous des idiots quand il s’agit d’amour... moi y compris.
“But this was… I knew I was falling in love and I let it happen. And so I thought, why keep waiting? Why let it drag on and on and fight over and over when I can just come and tell you how much I—and maybe, hopefully, see if you feel the same?”
He pants, tired from his clearly rambled and unplanned confession.
“I love you, too,” you say, struck. Oh God.
“Can I kiss you, then?”
“It’s may,” you breathe. “May I kiss you.”
“You may,” he whispers.
“Right now?”
“Anytime.”
“So now.”
“It’s now or next Tuesday,” he jokes.
“Now is… the best. Now would do.”
“Now would do.” So you cross the threshold and let him scoop you into his arms so he can well and truly kiss you.
—
“Is that all?” The interviewer asks Pierre. “Just… those words? We need a bit more for the article on this event.”
“Oh, yeah.” He gets up, straightens his tie. “Don’t worry. You’ll hear the rest during my best man speech.”
Del amor al odio hay un paso – From love to hate, there is one step.
Nous sommes tous des idiots quand il s'agit d'amour... moi y compris – We are all fools in love... me included.
3K notes
·
View notes
steak
carmen berzatto x reader | 3.8k | tw: pregnancy, implied smut, general nonsense
“I need a favor.”
“A favor?”
“Yes. A favor.”
You were already beginning to regret asking, watching Carmy swivel in his chair and ponder the request. Or he was staring into space, it wasn't clear.
“Alright,” He nodded after a moment. “What is it?”
You took a deep breath, bracing yourself. It would have been easier to ask him to murder someone than what you were about to.
“It turns out that I am responsible for making 30 cupcakes for this Saturday and I could use some guidance.”
“I see,” Carmy nodded, pointing the spoon in his hand at you. “and what else? Sandwiches, burgers, hot dogs, stop me when I get the right one.”
You let out a sigh.
“And..three trays of sandwiches. And mini quiches, egg rolls, a crudités platter and a cake.”
“Okay,” Carmy sat up a little, lightly tapping the spoon against his cheek. “Just..a couple of questions.”
You walked closer to the desk, leaning against it and giving Carmy a nod. “Fire away.”
“First, why are you responsible for all of that?”
“Because apparently I promised my best friend if she ever got pregnant I would plan the entire baby shower.”
“Uh-huh. Why?”
“Because I was very, very intoxicated at her bachelorette party.”
He smirked a little, and you rolled your eyes with a small smile.
“Noted. Second question,”
“Third,” You interjected, holding up three fingers. “Technically.”
“Third question, is there a theme to this party?”
“No, of course not,” You frowned, folding your arms. “Themes are for kid's birthday parties and epic novels.”
“Hm, I thought so.”
“What's that supposed to mean?”
“It just doesn't seem very..you know,” Carmy set the spoon down in his lap before interlocking his hands. “cohesive, I guess.”
You rested your hand on the desk, lightly tapping your nails on the surface.
“I'm willing to ignore that remark if you help me.”
“Alright, fourth question..why do I have to help you?”
You thought about it for a moment, working out your best angle to get him on board.
“Well..because I love my best friend and I want to give her an amazing experience, it's basically free publicity for the new restaurant, and we're..you know,” You gestured between yourself and Carmy with a grin. “We're friends. We're close. We kissed that time.”
“Yeah, yeah we did,” Carmy nodded, looking down for a moment before looking up with a smile. “When we were like..six? I don't see what that has to do with me adding to my already hectic schedule.”
“I would just really appreciate your help, even just a little guidance,” You smiled, holding your hands up. “What is the point of having a world-class chef as a friend if he doesn't help you out occasionally..”
“I promise to think about it,” Carmy nodded, picking his spoon back up and pointing at you. “Can you cook anything more advanced than french toast?”
“Depends on your definition of advanced,” You shrugged, pushing off the desk. “I look forward to your decision, I know you'll make the right one.”
“Get out of here,” Carmy rolled his eyes with a small smile. “I'll text you.”
You were heading to the front door when you bumped into Richie, who was carrying a box he promptly dropped on the nearest plastic-covered surface when he saw you, wiping his hands.
“Hey. What brings you here?”
“Me?” You gestured to yourself as you walked closer to Richie. “I just..I thought it was time. To declare my undying love for you.”
“Hm,” Richie nodded, rubbing his jaw before stepping closer to you and touching your shoulder. “I gotta be honest, I thought you'd never do it. Vegas wedding?”
“Vegas wedding,” You nodded with a grin. “Bye fuck-face.”
“See you later darling.”
It was the following afternoon when you got a very simple text from Carmy, relief flooding you as you read it.
‘Fine. Address?’
Opening your front door and seeing Carmen Berzatto standing on the other side was something you hadn't experienced for a long time, but it was a welcome return.
“Come on in, everything is set up in the kitchen,” You smiled, holding the door open and frowning slightly as you saw a worn grocery store bag in Carmy's hand. “Did you bring stuff when I told you that you didn't need to?”
“Sure did,” Carmy nodded, gesturing to his shoes. “Off? On?”
“Whatever you're comfortable with,” You waved your hand, gesturing to the bag. “I got everything, you really didn't need to waste your money on..liquid potassium or whatever, the food is not going to be anything too complicated.”
Carmy raised a brow as he slipped off his shoes. “You do know I'm a chef, not a mad scientist, right?”
“Oh shut up,” You sighed as he laughed, leading him into the kitchen.
“The fuck is liquid potassium anyway?”
“Here we are,” You spun around to face Carmy, gesturing to your humble kitchen, the dining table covered in various ingredients, in no particular order. “I really appreciate your help, I know you're busy.”
“It's fine,” Carm nodded, walking over to the table and setting the bag on the floor before picking up things on the table and inspecting them. “I'm not uh..I'm not needed, today.”
“Well I need you,” You grinned, walking over to the table. “The plan is I prepare everything today, then tomorrow I just have to heat up, and serve.”
“Organized, I like it,” Carmy nodded, looking over to you. “Where exactly do I fit in all this?”
“You..are my assistant for the day. Executive assistant, really.”
You gestured to the bag on the floor. “Show me what you got.”
An hour later, your kitchen was a whole lot messier, but progress was going well. Carmy had the patience of a saint, calmly explaining how everything was done. You were surprised how quickly you were picking up what he taught you, usually you got halfway through a YouTube cooking tutorial and gave up, ordering takeout instead.
“Okay, what's next on the list?” You asked, sprinkling herbs onto the egg roll pastry before wiping your hands. “I still can't believe you made me write a fucking list.”
“You needed the list,” Carmy grinned, reaching for the slip of paper. “Trust me. Okay, once you've finished those we can..almost cross off all the savory, just crudités but that's pretty simple. I can show you how to make dips, if you want.”
“Thought you'd never ask,” You grinned, flicking a loose crumb of pastry at him. “the vegetables are in the..”
You looked up for a minute, trying to think.
“Bottom of the fridge,” Carmy supplied, gently touching your back as he passed you to get to the fridge. “got them.”
You rolled up the pastry under your hands, setting it aside with the other egg rolls that had been prepared.
“So how has it been, being back?” You asked, going to rinse your hands. “I feel like I never asked you properly.”
“It's..fine, yeah,” Carmy replied, his head in the fridge when you glanced over to him. “Hasn't changed, much, well..you know. Never thought I'd end up back here.”
“At least you got out,” You shrugged, drying your hands before moving back to the counter. “How was New York? Incredible?”
“Incredible,” Carmy repeated, coming back to join you and reaching for a bowl. “Hand me that cucumber, please?”
“I need to visit one day,” You sighed, reaching for the cucumber and handing it over. “It's like..it's just there, I can go anytime, but I don't..I will, though.”
“Mm,” Carmy nodded. “You can pour greek yogurt into a bowl if you want.”
“On it,” You smiled, going to get a bowl. “I feel like such a domestic goddess right now, I gotta say. I never really cook. Not like this.”
“Are you enjoying it?” Carmy asked, not looking up from cutting up the cucumber. “I know cutting up vegetables isn't exactly an adrenaline rush.”
“I am enjoying it,” You got a bowl and went to set it on the counter, standing by Carmy. “It's relaxing. I'm not thinking about anything except the next step. I don't have to worry about anything except what I add next.”
“Lemon,” Carmy gestured to the yellow fruit over on the table. “Worry over.”
You smiled as you spooned the yogurt into the bowl, glancing over to Carmy. “You wanna know a secret?”
“Is it..that you're actually a serial killer who kills your victims by liquid potassium poisoning?”
“Oh shut the fuck up,” You groaned, going to grab the lemons as Carmy laughed and shook his head.
“Don't worry, your secret is safe with me. What's this other secret?”
“No, I'm not telling you now,” You sighed, taking the lemons back to the counter. “If you're just gonna be an ass.”
“I'm sorry, I'm sorry,” Carm murmured softly, gently nudging you. “Please tell me.”
“It's a world exclusive secret,” You grinned, walking over to the table and picking up your bag from one of the chairs. “Only three people will now know..”
You reached into your bag, pulling out a clean white envelope.
“Time to see if we need to use the pink or blue food dye.”
“What do you mean?” Carmy looked over to you. “Like a..gender reveal? That's still a thing?”
“I know it's a little cheesy,” You shrugged, looking down at the envelope. “But my best friend is just really excited to have this baby, she wants to know everything she can. So she gave me this,” You held up the envelope. “And I get to whip up some frosting.”
“So, what's it gonna be?” Carmy asked as you walked back over.
“Let's see,” You opened the envelope slowly, feeling Carmy's eyes on you. “Ah..not what I expected.”
You handed the paper over to Carmy as you picked up a lemon. “There's gonna be a little kid running around that looks like her..crazy.”
“Nice, though,” Carmy shrugged, setting the paper aside. “You know, if you..if you're someone that wants that.”
“Mm,” You nodded, taking a knife to cut the lemon. “She has, for a long time. I was so excited for her when she told me. Then I went and agreed to do all this, because..”
“You were drunk?” Carmy supplied.
“Yes, that,” You laughed, shaking your head. “It's not going that bad though, right? Everything is under control.”
“True, but uh..” You looked up as you felt Carmy's hand on your arm, looking down and finding yourself staring at his tattoos.
“You might want to cut the lemons, not your fingers.”
“What? Shit,” You frowned as you looked back to your hands, a trickle of blood appearing. “Spoke too soon.”
“It's okay,” Carmy led you to the sink. “just wash it off, have you got band-aids?”
“Uh..yeah, I think so,” You nodded, running the water. “in the bathroom cabinet.”
“Okay, wait here.”
A few minutes later you were leaning against the counter watching Carmy apply a band-aid to your finger with the precision of a surgeon.
“I can't remember the last time someone put a band-aid on me,” You murmured softly. “Thanks.”
“Don't mention it,” Carm looked up, his hand still holding yours. “I'm an expert at it.”
“So I see,” You smiled, inspecting your finger. “Excellent work. I'll be sure and recommend you.”
“I might need the extra work,” He sighed. “We're getting close to the deadline and it just feels like we're not progressing.”
“Hey,” You gently squeezed his hand. “Stressing out won't change anything except to make everything harder. Just keep going, do what you need to do, and then on the tiny, tiny, chance it doesn't work out you have a career lined up as a professional band-aider. You can patch up my victims.”
Carmy was quiet for a moment before he laughed, really laughed, and you felt a weight slip off your shoulders.
After a moment a comfortable silence fell over the two of you, your eyes held on each other.
“I‐”
“I should actually be going,” Carmy spoke before you could finish. “I just remembered I need to call this guy about the..”
“Okay,” You nodded, clearing your throat. “I can..I can handle the rest. Don't let me keep you if you're in a rush.”
You could see the guilt in Carm’s eyes, choosing to look away.
“I'm sorry to leave you in the middle of all this.”
“Don't be sorry,” You shrugged, looking down to your bandaged finger. “It's my responsibility, I got it. Thank you for your help.”
Carmen gave you a nod and you mustered up a smile in return, watching him leave.
A couple of hours later, the sun had set and your kitchen lights were bright as you flicked some cupcake batter off your fingers. When you heard a knock at the door you looked up, pausing for a minute before grabbing a cloth to wipe your hands.
“Coming, hang on.” You called, setting the cloth aside and heading to the door.
It wasn't a total surprise to see Carmen on the other side.
“Hey,” He said after a moment. “Can I come in?”
“Of course,” You stood aside, holding the door open. “Come on in.”
You watched him as he took a deep breath, hand clutching the zip of his jacket.
“So, about earlier, I-”
“I know,” You smiled, holding up your hand. “It was a lot. It was fun, and..domestic, and kind of intense, and that's a lot. I get it.”
“Yeah,” Carmy breathed, nodding sofly. “But..I'd still like to help you out, if you'll let me.”
“Then get your shoes off and get in the kitchen,” You smiled. “I'm just starting the cupcakes. Assistance is definitely needed.”
Half an hour and a lot of batter later, the cupcakes were in the oven, and the daunting prospect of the cake stood in front of you.
“Do I really need to make a cake and cupcake?” You mused, looking at the messy counter. “It feels excessive.”
“You're making the cake,” Carm nudged you gently. “Show me what you've learned.”
“Prepare to be amazed,” You grinned. “For better or worse.”
You cleared some space on the counter and glanced over to Carmy for a moment with a raised brow. “Hold still, you got batter in your hair.”
You gently moved your hand to carefully remove the fleck of batter.
“Would I be out of line to suggest you might be overdue for a haircut?”
Carmy laughed softly and shook his head, ruffling his messy curls.
“It's on a list, somewhere. I'll get round to it eventually.”
“I could do it,” You suggested, looking back to the counter and taking a clean bowl. “I know my way around a pair of scissors.”
“Really?”
“Really really,” You nodded, reaching for the flour. “you help me with this cake, I'll make you look like a new man.”
“Deal.”
Once the cupcakes were out of the oven and the cake was in, you sent Carmy off to wash his hair in your shower, leaning against the counter when he was gone and taking a deep breath. You reached for the note that your best friend had given you, smiling as you read over it.
When Carm came back into the kitchen, you felt your heart race a little. He was dressed the same of course but his damp hair was slicked back, and he had a warm, clean scent that still had a musk to it that was really doing it for you.
“The cake will be a while, I checked,” You smiled. “Skewered it like a pro. Take a seat, let's get you fixed up.”
“Are you going to skewer me?” Carmy asked, raising a brow as he sat on the chair you'd moved up by the counter. “I'm a little intrigued.”
“You'll see,” You grinned, picking up the blue towel you'd grabbed when Carmy was in the shower. “Be on your best behavior just in case.”
“Yes ma'am.”
“Alright,” You draped the towel around Carmy's shoulders, adjusting it a little before picking up the scissors and a comb. “Let's see what we can do. Head down, please.”
“About earlier,” Carmy began, and you felt a knot twist in your stomach. “I..I just want to apologize, I shouldn't have just left like that.”
“It's okay,” You murmured softly, gently combing his hair and holding the ends between your fingers. “Like I said, I get it.”
“No, it's..it's complicated,” Carmy sighed. “Because..I don't want you to think that I didn't enjoy being domestic and having fun with you, because I did, and I think you're great, I really..I really like you and it just freaked me the fuck out a little.”
“Like when we were six,” You smiled softly, gently snipping his hair. “And I kissed you. You freaked out and left me alone in that treehouse. I was devastated.”
“Hey I didn't expect it,” Carm shrugged. “You didn't give me a heads up.”
“I'm giving you one now,” You grinned, lightly tapping his head with the comb. “Head up, please.”
“Why did you do it?” Carm asked, soft curiosity in his voice.”I mean, why did you..why me?”
“You weren't like the other boys in our class,” You shrugged, gently sweeping the comb through Carmy's hair. “And you weren't like Richie or your brother. You were just..Carmy. I always thought about you. I liked that you were doing your own thing. Tilt your head sideways, please..thanks.”
He stayed quiet while you cut his hair so you kept talking.
“I don't think I really had a crush on you or anything back then, I just liked you. Then as we got older I started seeing you differently but I never acted on it because I didn't think you were interested. We never really hung out much, for all I knew you were a major dick. Then,you were gone and I tried to forget you..head down, please.”
“What do you think now?”
You thought about it for a moment, holding the comb in Carmy's hair.
“I think..you've actually got really great hair.”
“That so?”
“Oh yeah,” You nodded. “I mean usually it looks like a bird should be nesting in it so anything is an improvement.”
He laughed slightly and you felt your shoulders drop a little.
“I also think,” You murmured softly, slowly closing the scissors on the ends of his hair. “Those tattoos on your hands are really doing it for me.”
“Yeah?
“Big time.”
A silence hung over you as you continued the haircut, trying to keep your hands steady.
“Just because I freaked out doesn't mean that I don't..that I haven't been thinking about you.”
“Yeah?” You mused, lightly brushing some hair off the towel.
“Big time. But..” Carmy let out a sigh, clearing his throat. “I'm really not..an expert at the whole relationship thing. I'm not even a novice, I'm like..a nightmare. I can't do the flowers and dates and meeting the parents and all that like..I know I should want all that and maybe I do but..something just stops me and I can't..I can't do it.”
You slowly walked around to stand in front of Carmy, meeting his eyes as you glanced down.
“Head up, please.”
You focused your attention on his hair, feeling the nervous energy radiating from him.
“First of all, you know my parents. So that's not relevant. Second of all..I'm not saying that I want a relationship because I don't even know if I do. But..I wouldn't mind having someone I hang out with, watching movies and talking shit and eating takeout and figuring out if we want to be more but it's okay because we're still good how we are. And I could see you being that person.”
You took a step back, tilting your head slightly.
“All done.”
“Good,” Carmy nodded, standing up and stepping closer to you, his hands reaching out to touch your face and leaning in close til you felt like you couldn't breathe. “You can check the cake.”
You let out a frustrated sigh before laughing and moving your hands to grip the towel around Carmy's shoulders.
“You're definitely a major dick.”
You pulled him in for a kiss, feeling a rush shoot through you. When you pulled back you thought your heart was on fire.
“Wow, you've really improved,” You grinned. “I'm impressed.”
“You don't know the half of it.” Carmy grinned, pulling you back in for another kiss.
He wasn't lying, as you discovered when he put you up on the counter and feasted on you til you cried.
You had wasted no time, pulling him right down onto the kitchen floor to show what you'd learned too.
The next day, when you watched your best friend cut into the cake and scream with joy as layers of pink and blue sponge were revealed, you made a silent vow to volunteer your services more often.
496 notes
·
View notes