My life is a constant cycle between "I need to rest before I burn out" and "I'm wasting my potential, I should work harder"
6K notes
·
View notes
Corroded coffin cover of ‘day man’ with full WWE style wrestling accompaniment of Freak dressed as Day Man and Eddie as Night Man ending with a steal chair knock out and Eddie having to be dragged off stage
40 notes
·
View notes
Riddle of Ages really is Thee Villain Decay book huh. The Whisperer is just collecting dust in Mr. Benedict's attic with a part time job as Constance's tea party chair, Curtain is just their weird mean jail uncle in green plaid pajamas, and then we've got McCracken out here saying lines like "I'm afraid she's a party pooper, gentlemen" with his whole chest and still thinking he can maintain a shred of dignity.
9 notes
·
View notes
Couples Costume monologue save me
2 notes
·
View notes
I love making moth ocs because you'll draw them stylized, your brain will hold off on drowning it in then neck fuzz, then like a year passes. you finally draw them like a great pyrenees, pause.
this cannot feasibly be right.
So you turn to google and go "show me moths"
then when youre greeted by th
Post cancelled have you guys heard of the Venezuelan poodle moth.
if you were on tumblr in 2012 you've seen it. this lil guy
It's existence is so continuous because the only evidence comes from a zoologists, Dr. Arthur Anker, flickr album he took at Gran Sabana National Park in, [ gestures ] Venezuela.
and it's so easy to misidentify it to another species. SO easy infact
Those aren't even photos of it-
The first one is a Bombyx mori- or a common silk moth.
when these little guys don't face the threat of predators once domesticated, They evolve to have larger bodies that are too large for their wings to actually work. they lose their ability to fly. more moth lore for you to go with.
Back to the main event- The Venezuelan poodle moth?
Yeah. This is the only ACTUAL evidence we have of it is this photo
Literally. this it is. it's sitting there like a dog in a bath tub.
Not identified, last officially spotted in 2009- at its portrait session in a macys.
THATS why you get to find fucking mind boggling gems like this when you look for it
there's nothing else to work with.
Oh and you wanted to know about the second photo? Yeah that's a just a common silk moth someone felted.
[ the image has been reposted so many times over the last 12 years that it was impossible to track the source- if you have it please add it! ]
3 notes
·
View notes
[continued from here!] @kings-father @smp-archivist
[wilbur watches her younger self die, over and over, his ruddy brown curls endlessly caking with blood. she watches the life fade from the eyes of her son, her brothers. she watches the scene that plays out behind her eyes every night, and here, the difference: she focuses on the person in the center of it all.]
i-
[one hand goes for the pocket of her coat, the one where she keeps a switchblade. she pulls out a piece of glossy paper instead- a train ticket. waterloo and city line.]
eret-
20 notes
·
View notes
well i didn't sleep last night but i did get visited by a cool moth
0 notes
looking at my favorite pairings like who is the moth and who is the bug zapper
0 notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
a matter of time
pairing: joel miller x f!reader
summary: joel can't remember the last time he took things slow and let himself feel. you give him a gentle reminder.
warnings: 18+ MDNI, late boston qz era, joel's pov, smut, porn with a twist ending, fingering, unprotected piv, creampie, slow/intimate sex, finger sucking, premature ejaculation, nostalgia, internal monologue, tess doesn't exist
word count: 2.4k
It's been a long time.
Joel's all but forgotten what it feels like when it's this gentle. There's almost a tenderness to it, even though he doesn't know much of anything about you at all. Not your name or how you ended up here in this hellhole of a safe haven.
Nothing but the sweet, tacky taste of your 20-year-old Lip Smacker gloss and the tang of sweat and something sweeter lingering on your skin. But he's learning.
And he likes this new knowledge. Even if he never gets the chance to use it again, he'll devour it hungrily because it's a worthy distraction from the monotony of life in a quarantine zone. Day in and day out, he returns to this shitty apartment with its peeling floral wallpaper and rotting mahogany furniture—memories of a distant past that aren't his own and, yet, sting just as viscerally.
Tonight, the space hums with a different energy. Highlighted by the soft rays of the setting sun, the room's only purpose is to serve as a backdrop to you, and that alone changes everything. Your beauty, your responsiveness, as he lays you across his moth-eaten duvet is reminiscent of a different time, and he'll happily accept that reminder.
It's one of the few pieces of nostalgia that doesn't ache or eat away at him the longer he lets it in. No, you feel good. You're warm against his fingertips, soft and pliant under the path his lips follow from the sticky smear across your cheek, past the breath hitching audibly in your bared throat, down to your soaked, coarse curls.
You want him. More than that, you want to take your time with him, and he's surprised at how much he wants that, too. Trapped within these walls, what else does he have but endless, empty time? And there's nothing he'd love more than to spend it taking care of you, just like you asked him to.
He hovers above you, refusing to part his lips from your body as he urges you up the bed to rest against his pillows. They're flattened and scratchy from years of use and abuse, but they smell like him, and you like it. He can tell. The moment your hair fans across them, rich and lively in contrast, you bury your face into the fabric to breathe him in, and your body's reaction is instantaneous.
Your back arches with a heavy sigh of contentment and your legs fall apart naturally, welcoming him closer, but he waits. Reverently, he slowly leans back onto his heels to appreciate the sight in front of him, and he can't help but feel grateful. You're already glistening for him, preening under his undivided attention as your delicate fingers trail up to your breast to tweak a nipple.
As your eyelashes flutter and a gasp escapes your parted lips, his hand quickly drops to squeeze his twitching cock over his boxers and he keens, nearly doubling over at the pleasure that overcomes him. A coy, knowing smile quirks at the corners of your mouth, and he decides he needs to taste you again. Now.
He lurches forward, and you let out a surprised squeal as he licks into your mouth and commits to memory the faint taste of artificial root beer and mint on your tongue. The familiar fight for dominance he's so used to after years of quick fucks and one-night stands isn't there, and, instead, you set a languid, passionate pace that makes his head spin. It's a slow, deep caress—wet and warm and all-encompassing—and it's everything he hopes fucking you will feel like.
He's so hard it hurts. God, when was the last time he was this fucking hard? He's leaking messily through his boxers, desperate to be touched and enveloped and claimed.
And how could he not be? He's kissing the perfect woman. A patient goddess who's leading his hands across every inch of bare skin, showing him exactly how you like to be stroked and gripped, sighing encouragingly when he heeds your lessons just right.
You're one hell of a teacher, and he thinks he might just be your favorite student. He separates from you with a lewd smack and a string of saliva keeps you connected for a fleeting second before you lean up to lick it off his bottom lip. Your eyes lock with his and they're dark, almost completely consumed by desire, and it's further encouragement to continue on to his next assignment.
This one might just send him over the edge. You guide his hand down to cup your wet heat and you're drenched, dribbling and smearing slick patterns onto his sheets that he'll probably trace with his tongue while he jerks off to the thought of you long after you're gone.
Bathed in the dwindling embers of twilight, your silhouette—the plush slope of your breasts and soft curve of your belly and thighs—is cast around the room in artful shapes and shadows, and he wishes you were a permanent fixture. That your visage covered these walls instead of false depictions of growth and life. It's a dangerous train of thought, but he's too lost in the haze of your warmth and wetness to think about anything else.
He needs to feel you. He needs to fuck you.
He barely even realizes he's already slipped inside you as if he's been there all along, stroking your walls with the rough tips of his middle and ring fingers and honing in on that hidden, spongy spot with such precision, you'd think he'd done it a million times before. Thick, cording veins strain against his forearms as he tenses with the effort of keeping his thrusts long and purposeful, and he watches, captivated, as your cunt sucks him in greedily and fruitlessly tries to hold him inside you.
Tight—fuck. You're so tight. He's bucking into his unoccupied hand, jerking himself off over his boxers, and he doesn't remember when he started, but he can't stop. It feels too good...you feel too good, and the steady, simultaneous rhythm he sets for both of you isn't nearly enough.
Faster. Harder. Still so goddamn tight. He'll never be able to stretch you out enough to take him, and he's starting to worry he'll cum before he even gets the chance to try. His cock throbs violently against his palm, and he bites back a groan at the vision beneath him. Christ, how did you get here?
You can't possibly be real. Your thighs are quaking on either side of his waist and your pussy clenches dangerously hard around his scissoring fingers. There's a thin sheen of sweat matting the wispy hairs around your temples and pooling everywhere your body connects with the mattress, your searingly hot skin an addictive, sticky trap he willingly and faithfully succumbed to.
And those sounds.
You need his cock. Fucking hell, you need it. Greedy, patient, needy fucking woman. He can hear it in your soft pants and hitched breaths. You're quiet and subtle in your pleasure, so unlike any other woman he's ever been with, but when you whimper—fuck. Fuck.
He's going to give it to you. Right now, after taking the time to map and explore and discover, he's going to use his newfound knowledge to hollow you out, then fill you up until you're overflowing with him.
He slows to a stop and pulls his glistening fingers from your cunt, and there's that faint, perfect sound again. A stuttered, broken whimper that lilts with each knuckle that catches on your entrance. He sucks his ring finger into his mouth and adds your taste to his list of all-time favorites, right alongside your Barq's root beer-flavored lip gloss.
Then, he offers you his middle finger, and he swears he can feel your lips sealing tightly around his cock as you wrap them around it. You work your mouth up and down, bobbing your head eagerly like he's about to blow his load down your throat, and—
He's going to fucking cum.
With his finger still nestled between your lips, he wrenches his boxers down his thighs and lines himself up with your entrance, ignoring how close he's suddenly teetering on the edge. His balls are already taut between his legs and it worsens as he inches in his aching, neglected tip.
"S'time, beautiful," he grits out, still tender in his touch as he splays his hand across your waist to stroke your heated skin. "You ready for me?"
You nod quickly, humming your affirmation around him, and he gives you another shallow inch. He was right. No amount of preparation was going to ease the stretch. You're gripping him so hard, it almost hurts, and the thought of how tight you'll be when you cum—he feels delirious with it.
Yes. Yes. Squeeze him. Let him feel you wringing him fucking dry. Let him pump you so full of his release, you'll be dripping him for days, an intimate, lingering reminder of this night. You have no fucking idea how long he's been waiting for this, for you. He doesn't even know your name, but that doesn't matter. Right now, all that matters is this.
This deep-seated, unspoken connection. It's been a long time. And, right now, his time is up.
He slides home in one long, deep thrust, the tip of his cock tenderly nudging your cervix, and your body struggles to accept him. He lights up every nerve ending like a live wire, drags against every sensitive pressure point in perfect succession, and your walls begin to mold around him as if they recognize the sensation. Like your body's remembering him.
Sharp nails dig into his side and drag from his shoulder down to his ass, urging him closer. You're trembling beneath him, your breasts thrumming with sharp, rapid breaths akin to a hummingbird as he fucks you further up the bed, one slow thrust at a time. You're fluttering around him, a delicate spasm and, then, an indicative clench, and it forces a sob from his chest that he barely recognizes.
That's it, beautiful. It's right there. C’mon, give it to me.
He doesn't speak it aloud. He hasn't coaxed or rushed you with his words this entire night and he's not about to start now. He knows, for some inexplicable reason, that he doesn't have to.
But you do. It's barely a whisper—a single, hushed syllable that trembles and passes your lips like a plea. A prayer only he can answer.
"Joel."
Christ. He knows you.
Christ, he's cumming.
His vision whites out, and he's only vaguely aware of his tightening grip on your hips and the long, drawn-out groan that tapers into something devastatingly familiar. Your name.
Now, it's his turn to pray. He repeats it like a mantra, breathing it into your lungs as his lips crash onto yours. It's almost as if he's afraid he'll forget it again if he stops, but your body's response quickly convinces him otherwise.
You bear down on him harder, driven closer and closer to your peak each time he calls out to you, for you. You're molten hot around him, searing each letter into his skin with every pulsing clench of your cunt, and he does the same, thick spurts coating your walls.
He can't help himself. He stays deep—he knows he shouldn't, knows how dangerous the consequences could be, but he needs to—and your ankles digging painfully into his back to hold him in place wordlessly tell him you need it, too.
So good, you're so good. You're perfect. You're his. You're—
Gushing, squeezing, finally moaning for him. You’re cumming.
With it, your orgasm brings every memory of you flooding back at once. Late summer afternoons spent in bed while Sarah visited her grandma. Champagne-flavored kisses on New Year's Eve, soundtracked by Dick Clark and cheers from the crowd in Times Square filtering through the plasma TV in his living room.
He loved you. He loved this. He should've known the moment he kissed you, the moment he saw you, but he's been surviving for so long. He can't remember the last time he lived.
Your limbs surround him, pulling his entire weight down to rest on top of you, and you continue to swivel your hips into his pelvis, riding out your high as his name falls breathily from your lips. He works you through it, frantically blinking away the sudden blur that engulfs his vision so he doesn't miss out on another moment with you. Not ever again.
He's...he's crying. He didn't even know he was capable of that anymore. Sensitivity starts to set in, in more ways than one, but he doesn't want to leave the heat of your embrace. He thinks he might break at the sight of his cum leaking out of you and seeping into the undeserving fabric of his co-opted sheets, far away from where it belongs.
But, then, your lips meet his tanned, weathered cheek—a stark contrast to the young man he was when he was yours—and you kiss away his tears. He feels more fragile than he has in decades, and that's surprisingly okay. Because you're here to protect him, now.
Trailing from the apple of his cheek to his lips, up to the years of tension creasing his forehead, back down to kiss him tenderly, you establish a comforting repetition. He chases you every time you part, but, after a while, he's struck with a realization. What you've been trying to convey with your actions all night.
You always return to him. So, maybe this was just a matter of time. A slow smile spreads across that beautiful face he hadn't allowed himself to think about since the outbreak, and you huff out an affectionate laugh, your fingertips curiously running across his back and tracing raised lines and jagged shapes you've never felt before.
"Hi, Joel," you murmur fondly, still close enough for the tacky remains of your gloss to catch his bottom lip, and his tongue darts out to taste you.
It's real—it's too vivid not to be real. His eyes dart between yours, and he can still see everything your future together was supposed to hold. He still sees forever.
"Hey, baby," he rasps, his voice thick with tears and disuse, and something unidentifiable that sounds a lot like hope.
He hasn't felt this way in a long time. Not since you.
thanks for reading!
2K notes
·
View notes
"Amid the lilies floats the moth,
The mole along his galleries goeth
In the dark earth."
- Hylics Afterlife monologue
750 notes
·
View notes
I wanna move to a hippie commune so badly. Yknow the type Björk grew up in. We'd write and read stories and poetry all day and make our own food and make our own art and when the night comes we'd dance around the campfire to some sick ass techno.
56 notes
·
View notes
I might be in the minority here, but let me cook for a minute.
If you break up with Ascended Astarion (refuse his offer to turn you into a spawn), he approaches you a couple days later and will go into this whole mantra about how he would have abused your love, you made a mistake, etc. Basically trying to convince you that he's not the least bit upset about it, and that he's doing you the favor of seeing to destroying the brain. He also asks if you could work together as partners during this, as well.
This is a hot take on this but...
Astarion is lying through his fucking teeth in this scene. Receipts below the cut.
During the sex scene with Ascended Astarion, you get a Wisdom check where you can look into his thoughts. If you pass this Wisdom check, it's revealed to you that Astarion essentially thinks very highly of you, as he would believe you'd be degrading yourself if you choose to become his spawn. He knows it's wrong of him to put you in this position, but at that point in time he's so incredibly infatuated with the new powers he's been given, as well as finally having his insatiable craving for blood lifted for the first time in 200 years. He's absolutely drunk on power and it's heavily clouding his judgement.
If you face Cazador without Astarion, there's a skill check you can pass when he's in his coffin recovering where you can also look into Cazador's thoughts. Essentially, Cazador's inner monologue does not match who he is on the outside. He's essentially trapped in his own body and mind, and basically wishes for death. He hates how much of a hold blood and power has over him; he wants it all to end. He hates who he has become.
In the D&D lore, true vampires are soul-less beasts. They become driven by blood lust and a desire to turn the whole world under their command. They lack the ability to harbor empathy or other emotions, especially love. BG3 introduces the Vampire Ascendent into the D&D lore; they basically regain multiple aspects of their humanity while still keeping the powers of a true vampire. They can still drink blood and turn people into thralls/spawn, but they no longer require blood to survive, are able to walk in the sun, enter homes uninvited, walk through running water, etc. You're basically a living vampire, but still immortal.
Given that Astarion becomes the Vampire Ascendent, his brain is not clouded by a need to consume blood. He doesn't have that pit in his stomach that drove every other vampire that came before him. He's being blinded by power. He has the ability to think rationally. When you refuse his offer to bend to his will, he becomes incredibly, incredibly hurt. He says the biggest crimes known to man are committed in the name of "love." If you call him a hypocrite, he shrinks back into his insecurities and states that your character's "true colors" are finally revealing themselves. He becomes incredibly bitter because you rejected him. You hurt him by refusing what he has become. And it absolutely destroys a large part of him on the inside.
Honestly that's the only rationale I can come up with as to why he eventually decides to smooth things over with you by saying there's no use in fighting, he admits he would have abused your love, played with it to get what he wanted until you were nothing (again, he's heavily deflecting here and trying to convince even himself that's what he would have done), and wants to still be partners in battle at the very least. He still wants to be near you. Because a large part of him still cares about you. Even if he can't understand it at that moment because he's clouded by power, he's still drawn to you like a moth to a flame. He's trying to convince himself that he no longer cares about you in that way. If he genuinely didn't care about the PC, he would leave regardless of whether you helped him or not. He would choose himself and his own interests; he wouldn't stick around and repay some petty debt. He got what he wanted, why bother helping some poor sod fix their problems? As revealed in the wisdom check, he still does think highly of the PC.
Despite what option you choose for Astarion (Ascended vs Non), he will tell you in both endings that you basically gave him his life back, and he will thank you for it. That I believe is genuine on both ends as it happens in both endings. If you ask Ascended Astarion to be gentle when he bites you, he heeds your request and performs the act in the most gentle way possible, choosing your wrist (kissing the back of your hand first) as opposed to your neck.
I'm rambling at this point but the bottom line is Ascended Astarion does still care for the PC, imo. It's just being heavily clouded under a mountain of new found powers and awe. I have no doubt that once that all blows over, he'd absolutely 100% be at your door on an almost nightly basis borderline begging you to take him back, or trying his hardest to convince you to at least give him a chance to talk. He's not a monster driven by horrific bloodlust. He's infatuated with this newfound power and mental clarity. Imo, unless there are new rules in the D&D lore that state differently, this is a temporary thing. And he'll absolutely be back to wanting you again at some point.
But fuck waiting around for that, lmao.
704 notes
·
View notes
Conspiracy theory time, what if Crowley’s in the attic right before each student overblots and he monologues about how he’s gonna take advantage of their negative emotions and Akumatize them (miraculous ladybug reference if you don’t know)
Omg, Dire Crowley is Hawk Moth confirmed???? 😭 No wonder why he’s so useless/j
I can see him now… Standing in his office that oversees NRC campus, peeking out through a window… forming a shadowy, violet-veined bird (instead of a moth) in his hands and sending it out into the world…
“Fly away my little Akuma, and Evilize him!”
There’s many fan theories about how Crowley is intentionally triggering the OBs and then turning a blind eye to them, but I think this one is the silliest and therefore my favorite interpretation/j I’ve heard so far www
148 notes
·
View notes
The Porcelain Killer – Professor Aaron Hotchner (Profiling 101 Series, Part 2/?)
Chapter two, here we go! Promise there will be lots of smut (you know me), but please show some love to this chapter which has barely any smut in it. Please like and reblog if you enjoyed reading this, your comments keep us writers motivated. Enjoy my loves. xxx
Summary: The reader enrolls in professor Hotchner's class "Profiling 101", a man she has always looked up to, a man who treats her like an asshole from day one. Will her need for academic validation manage to push the two closer together? Will her bright mind push her into the world of Aaron Hotchner and the BAU team? Will he manage to keep his distance before the world he tries to protect her from can get its grasp on her?
Warnings: 18+, masturbation (f), Aaron is an asshole, authority kink, university professor x student relationship,
Pairing: Professor!Aaron Hotchner x fem!reader (2.4k words)
Profiling 101 Series Masterlist
Part One Part Three
“Excuse me, professor?” A guy had raised his hand, interrupting the professor‘s monologue, abruptly cutting it short. The professor’s dark eyes zoned in on the student, taking in his appearance for a few more seconds before he nodded his way, waiting for him to keep on talking. “How is this relevant to us? You said we’d work on active cases, not stuff that is over hundred years old?”
“You already have your answer, don’t you?” Professor Hotchner’s deep voice forced (y/n) to straighten her posture, grateful that she wasn’t his target of annoyance this morning. It had been exactly one week since their first class, since the exchange of emails that had left her fuming, torn between anger and embarrassment. But today (y/n) had decided to find her way to her usual seat, in the second row, staring the professor down at any given chance.
The guy only looked at professor Hotchner with confusion swimming in his pupils, not understanding where the professor was going with this. “Your question alone gives us enough reason as to why it is important to learn from old cases, just like our Jack the Ripper readings. Does anybody here have an idea why this case is so important for us to talk about?”
(Y/n) counted the seconds fading by, wondering if anybody would dare to answer the question, not wanting to be called out by the professor with an awfully cold demeanour. (Y/n)’s hand was slowly raised, forcing his eyes to meet her hesitant ones, pondering over her words carefully before she started to speak, “There are many reasons, but I would assume it’s also because of the big gender debate it still is focusing on. As profilers we need to keep options open, we can’t just focus on one theory without taking others into consideration, just like the possibility of Jack the Ripper actually being a woman.”
“Obviously he wasn’t a woman, he was a classical serial killer.” The guy who had asked the question had spoken up without raising his hand, once again interrupting professor Hotchner before he could give his thoughts on (y/n)’s reply. The professor turned away from her, focusing on the guy who wore a smirk on his lips, finding pride in the way he had spoken out about (y/n)’s idea.
“What is your name?” Professor Hotchner’s voice boomed through the room, forcing all other students to quiet down once again, attention drawn to the tall, brooding man like moths drawn to any source of light. He’d burn them all before they could even start to realise what was happening, falling victim to his games.
“Josh Lorey, professor.” No longer was the guy smirking, tightening his grip on his pen as he began to realise that speaking up hadn’t been his smartest move. (Y/n)’s heart picked up its beat, pounding in her chest as she watched the scene unfold, unable to bite down the anticipation thumping through her veins, hoping that the professor would defend her – not that she couldn’t defend herself, yet she desperately hoped that he’d be on her side, just this once.
“If I were you, Mister Lorey, I’d be careful with my assumptions. Next time think before you speak up. Miss (y/n) has made a valid point, we can never know for sure what will expect us, theories change, just like our unsubs may change their behaviour all too suddenly. I want you to keep this in mind for this week's homework, it seems like time has once again cut our lesson short.” (Y/n) kept watching the professor for a few more moments before she started to pack her bag, eyes flickering back to his features every few seconds. She hurried down the steps, towards Aaron Hotchner before he could disappear down the hallway.
“Professor?” His eyes met hers, forcing goosebumps to rise on her skin, making her breath hitch in her chest as if an icy wind was teasing her limbs, freezing her from inside out. “I didn’t get any feedback on my homework, will we still get some in the upcoming days?”
Her voice wavered, trembling with every syllable rolling off her tongue. The way he stared her down forced (y/n) to tighten her grip on her bag, fighting against the urge to take a step away from him.
“I don’t give feedback on homework that isn’t outstandingly good. Yours was basic at best. Do better next time if you are craving validation this desperately. And take some more time before turning it in this early, careless mistakes don’t look good on you, miss (y/n). Now, if you’ll excuse me.”
……
“Okay wait,” a chuckle left Mandy, taking another sip of her drink. “So, you called him an asshole to his face? You apologised for it, but he’s still an asshole to you? And this is the same guy you’ve been horny for since year one?”
A tipsy laugh left the two girls sitting in front of (y/n), sharing knowing glances as they watched (y/n)’s expressions change, hiding her face in her hands with a sigh leaving her. The two kept staring at her, wondering what to make out of the mess (y/n) now found herself stuck in, desperately trying to drown her embarrassment in her fourth drink of that very evening.
“I don’t even know what to do anymore, I can’t let this rest, not before he understands that I’m not just some stupid, clueless girl.” Vivian’s hand found (y/n)’s, tightly squeezing it before she let go once again, hoping to ease some of her friend's pain.
“I’m sure it’ll be fine, just keep on proving your intelligence in class, then he simply won’t be able to treat you like this!” Neither (y/n) nor her friends seemed to notice the group sitting close to them, neither of them noticed the tall man staring at (y/n) from afar, watching her ramble on – oblivious to her surroundings.
Aaron Hotchner had joined his BAU family for a few rounds of drinks, wanting to catch up since he hadn’t joined them on their last cases, staying behind to teach his classes, only supporting them digitally. And yet, even though he wanted to pay attention to the stories his colleagues told him, he couldn’t help but study (y/n).
He could still remember the first time he had seen her, when he had given his first talk at the university. She had been sitting in the second row, scribbling down every word that had left him, as if this was some lifesaving ritual she needed to follow. Back then Aaron had cursed himself for being interested in a student, unable to stop himself from studying her, the gorgeous features he had been thinking of every now and then since that very morning.
But now, as she was his student, he desperately needed to keep his distance, giving into the annoyance thumping through his veins whenever he crossed paths with her, hoping that his annoyance would distract his mind from the schoolboy crush he fostered on her.
“One last round?” Derek patted Aaron’s shoulder, ripping the man out of his thoughts, following his colleague to the bar. He tried to keep his distance, tried to not pay any attention to the conversation he now could pick up on all too clearly. But the second he heard them speaking his name, he couldn’t help but listen in, giving into the frown tugging on his features once again.
“Honestly this Hotchner guy sounds like the worst asshole, you should stop thinking about him, (y/n).” Aaron’s heart clenched at the words leaving (y/n)’s friend, making him freeze in his step, waiting for her to speak up.
“He is, fuck, he is the absolute worst, such a stuck up asshole, but why does he have to be this handsome?” Before Aaron could even pick up on what his body was forcing him to do, he left Derek behind, walking up to (y/n) and her two friends, instantly catching the attention of the three women. He picked up on the way (y/n)’s pupils grew dilated, almost choking on the sip of her drink, watching him approach them.
“Miss (y/n), in case you don’t remember my word of advice, I’d like to remind you of it. Going around and openly calling your professor an asshole isn’t a strategically smart move, especially not when talking about your possible future boss.” He stared her down for a few more seconds, wondering if she’d speak up, but (y/n) kept quiet. “Well, have a good night, ladies.”
No word left the three women, watching him turn back towards the tall man who had watched the scene unfold with a confused expression. (Y/n)’s heart was in her throat, begging her to speak up, to profoundly apologise once again, but no word managed to leave her as she watched the two men disappear in the crowd.
……
The two cups of coffee (y/n) was carrying were hot in her hands, just enough to warm her cold fingers, guiding her on with the sound of her shoes meeting the ground echoing through the hallway. Her eyes were focused on the doors she kept walking by, searching for the number 3.57, the office she hadn’t set foot in ever before.
Only as (y/n) found the office she was searching for did she come to a halt in front of the closed door, inhaling a deep breath to hype herself up. She shuffled the cups around before she raised one hand to knock on the black wood, pushing it open after a dull “Come in” had echoed through the evening.
Professor Hotchner was sitting at his desk, working on some files. His eyes snapped up to meet hers, fuelled by surprise filling him. Slowly (y/n) closed the door, walking closer towards him with her trembling hands carrying the coffee.
“Peace offering?” She placed the cup down for him, watching him study it for a few seconds before he reached for it, nodding towards the chair placed close to his desk. He took a sip as (y/n) sat down, not expecting the satisfied hum leaving the man, not used to seeing him this calm, relaxed almost.
“Thank you, (y/n). That’s very nice of you.” She fumbled with her fingers, struggling to express the words she had rehearsed for the past hour, no longer able to remember what she wanted to say to him.
“It’s the least I can do. I am sorry for calling you an asshole twice, that wasn’t very considerate of me.” He placed the cup down before he leaned back in his chair, no longer covering the file he had been working on, giving (y/n) a chance to look at the rather cruel looking pictures. One of the pictures showed a woman’s body, surrounded by a circle of lit candles, her throat had been slit, but she was wearing a porcelain mask with an almost theatrical expression. The other four pictures showed victims in other positions, killed differently, and yet they were all wearing a porcelain mask.
“Is this a recent case you’re working on?” His eyes flickered down to the pictures before he looked at (y/n) once again, only nodding his head, waiting if she would comment on what she could see, giving her a chance to prove her knowledge. “They almost look like a work of art, don’t you think? I mean, besides the masks, look at the dramatics used in these scenes.”
Professor Hotchner reached for one of the pictures, studying them for a few moments before a hum of approval left him, “You’re right, does it remind you of something?”
“Have you ever heard of Goya’s Saturn drawing?” Silence engulfed the two, filling the room like fog, growing thicker with every passing second. He kept staring at the pictures, eyes flickering between the different victims, seconds (y/n) used to move closer, getting a better view.
“That’s really good, (y/n), thank you. I’ll have to make a few phone calls now. Feel free to come by in the next few days, I’m sure I’ll have a few updates on this case by then, if you’re interested.”
……
Ever since she had left Professor Hotchner’s office, (y/n)’s mind hadn’t been able to stop racing. While one part of her kept thinking of the case the agent was working on, the other part of her couldn’t help but think about him. She could still smell the expensive scent of his cologne, could still hear his raspy voice rumbling through him, pushing waves of heat through her.
And while that one part of her wanted to make her feel ashamed for what she was about to do, the other encouraged her fingers to keep on moving. Arousal was covering her folds, dripping from her at the mere thought of Aaron Hotchner, of the tall man with hands that would fit around her throat all too nicely.
(Y/n) couldn’t help but wonder what he could do to her, how he’d touch her, if he’d still be as cold to her, or if he’d allow her to see more of the kind man she knew he was. Her fingers circled her pulsing bundle of nerves, adding more speed with every passing moment, back arched off her mattress.
The thought of professor Hotchner guided her, pushed sinful pictures through her racing mind, making her burn in pleasure. The big shirt she was wearing covered her upper body, and yet (y/n)’s mind painted a picture of Aaron Hotchner touching her naked chest, fingers tugging on her hardening nubs. A high pitched “Fuck” left (y/n), knowing that she’d cum soon, with moans and groans leaving her.
She pushed two fingers into her tightness, curling them against her swollen spot, pushing herself even closer to the edge. Goosebumps covered every inch of her skin, making hairs rise on her arms, giving into the intense sensation she had been desperate for ever since this afternoon.
With a shaky breath exhaled, (y/n) came around her fingers, head thrown back against her big pillow, eyes squeezed shut. Her orgasm thumped through her, with as much strength as a bullet piercing through her skin, leaving never fading marks. She kept moving her fingers for a few more seconds before she relaxed, still imagining Aaron Hotchner towering over her.
Fuck, she needed to get over her crush, quickly, before she’d do something stupid, something that could easily force her to leave his class.
257 notes
·
View notes
yknow its interesting to me how ppl read the final bit of the monologue where oliver says that sometimes he hated felix as like. genuinely contradictory and therefore usurping of the fact that he also loved him. because 1) multiple things can be true at once 2) none of yall know what an unreliable narrator is holy shit 3) my immediate first reading of that scene was specifically that *he hated how much he loved him and how helpless it rendered him*. especially considering the one thing we really seem to know about oliver is just how much he hates being humiliated, just how much he hates being out of control. and with felix he is utterly undone. because every single shot in the montage where he says he loved him is obviously romanticized shots of felix looking like a god yes but. but. every shot where he says he hated him is not of felix being cruel, not of felix doing anything worthy of garnering hatred, but of *oliver*. oliver falling to his knees. oliver crying. oliver sobbing. oliver humilated. oliver covered in grave dirt. oliver wretched and helpless and agonized, wracked in pain by the love that has overtaken him and will not let him go. he resents it. he is repulsed by it. he is a moth to a fucking flame and it *burns*. he is swallowed whole by it, and it frightens him. consumed by the desire to consume, his object of desire reduced to ash by the intensity of the flame, and he himself left badly wounded with nothing to show for it. of *course* he hates him. by god i loved him. how anyone can think those things dont go hand in hand is baffling to me, really
140 notes
·
View notes