NOT EVERYTHING IN EGYPT IS SAND NOT EVERYTHING IN EGYPT ANCIENT OR MODERN IS DESERT EGYPT LITERALLY IS A BIGASS RIVER VALLEY + DELTA THAT IS GREEN AND HAS PLANTS AND SHIT BECAUSE OF THE RIVER NOT. EVERYTHING. IS. FUCKING. SAND.
12K notes
·
View notes
Having a post get popular enough to be independently reblogged by someone you follow but aren't mutuals with is. Wild
4 notes
·
View notes
Just got an ask from some stranger with a brand new blog about signal boosting their fundraiser. And tbh even if the blog, ask, and fundraiser post wasn't giving me mild scammy vibes I probably would've answered with something like "I can reblog it but it wouldn't be much of a boost, I've got like 10 followers" because I'm such a tiny little nobody blog I doubt it'd get them any attention anyway
0 notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
ok
go
... are you recording me?
yes
wow, awesome. this is superb.
y'know, you are such a pain in the ass sometimes i have to wonder, do you get off on it?
yes john
every time you get your panties in a twist i get this sensual rush through my body akin to the feeling of a big fat greasy fistful of bacon on a sunday morning
oh, cool.
that explains so much.
you're the worst friend ever.
aghh! you're going through a lot of unnecessary trouble trying to get me to start this stupid blog with you!
i mean, come on. everyone knows tumblr is for girls and people who got dropped by their psychiatrists and have no where else to complain.
you're exposing me to nutheads, dave.
and i know that's your forte but, i have this thing...you may be unfamiliar with it,
it's called having a life.
i don't have time to fit responding to internet weirdos into my schedule like you.
ok your royal highness
im sure you have a lot on your plate
what are you too busy sucking your thumb and shitting your diaper
what responsibilities could you possibly have all you do is sit in your room and watch crappy decade old movies all day
while your dad serves you a b list celebrity weddings worth of cake firsthand like a mother to her newborn son
your dad might as well have wished you were a girl with all that pampering you receive i bet you feel like a real princess
but hey man im not here to speak for him
why dont you ask yourself if you think youre so manly egbert
are you still recording?
yeah
hey guys! you're gonna get a real kick out of this one. go to https://dstrider.blogspot.com and hit ctrl f...
shut up
then you're going to want to type in the word...
shut up
THE WORD...
shut up
TURNTECHGODHEAD S-
s-
AID-!
looks like youre cutting out john
F- OR-
yeah dude your wifi is cooked
CK-
AH-
AHHHHHHHHHHHHH-
AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH!!
AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH!!
ahhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH!!!!!!
AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHh fine ill just do this with lalonde
...
you roped rose into this too?
yeah
well, FINE! god, i guess if you insist!
ask box open for reception.
978 notes
·
View notes
The Commander Says Goodbye
I’m not going to lie, I’m extremely anxious as i’m writing this, out of what these news could mean to a lot of people, and my heart feels heavy enough it could drop down my ribcage any minute from now and squish all my other organs. But I’ve been dancing around this topic for a long time now, and I think i’ve finally reached a point where i can’t ignore it anymore, for my own sake.
I hereby announce Commander Yes has come to an end.
As I’ve mentioned plenty of times before, here and to many other people, when I began this comic all the way back in 2018 I was in a really bad, really low place in my life in every sense of the word, and it was a spur-of-the moment decision to cheer myself up, because Path of Fire had just released and my enjoyment of the game had reached fever pitch and I had been playing Guild Wars 2 alone since as far as launch, and none of my other friends had ever really gotten into it. I guess I just, dunno, cried out into the big maelstrom of the community, one voice amidst millions, because i wanted SOMEBODY to look at what i did and revel in the nerdery with me.
And somehow the snowball began to roll and people wanted more and more of what I could do, and I was being actively reached out to, and, well, some time after that I landed my first ever job, I discovered a lot of things about myself, and I found myself in communities that welcomed me with open arms, and many of the people in there have since become among the best friends I could’ve possibly encountered, kindred souls who i’ve shared joys and sorrows for many years and who I can’t imagine living without anymore.
And all the while I kept making the comics, and with every entry posted every week I’d keep having people stopping to comment on them, and whether they were dumb jokes or personal takes on the story, they’d all share how much what I do kept hitting them in the kokoro, and to this day whenever I play anywhere in the game I still get people who recognize me and thank me for doing what I do. It was wonderful, it IS wonderful, and seeing that response motivated me to keep going, because what did still mattered to people, out there.
But I did always say I planned to keep doing these comics until I ran out of energy for them, and I think i’ve finally reached that point.
Because ever since I actually landed that job I’m exhausted and sleep-deprived every other day, so much so that I only have time to work on the comic on saturdays and sundays, and it gets harder and harder to just sit and draw, and at that point it was just more work, and while I still enjoy and play Guild Wars 2 a lot, it no longer consumes my time and attention like I’ve used to and i’ve been having fun with more personal projects, and honestly the direction the story is taking these days does not sit right with me and it’s hard to find inspiration in that, and this might be borderline selfish but every year I find people care less and less about the comics and it really takes a hit to you motivation when hardly anybody responds after you’ve spent a whole weekend trying to squeeze a five-page comic out.
And, well, I have been doing these for six years straight, and I think that’s a good run. I’m tired, and ready to move on, at long last. Let it be someone else’s turn.
But that’s the beautiful thing about this community, isn’t it? Even if I’m hanging up the hat, there are a whole lot of fantastic artists out there, as we speak, still cranking out works of art, deserving of all the attention they can get. And think of all the artists yet to come! For every story that ends, another story is just about to begin!
The world keeps on spinning, one way or another.
I’ll be closing my patreon shortly after this, but the reddit archives and tumblr blog shall remain for people to browse whenever they feel like (or until they both go in flames, i guess, what social media isn’t about to these days)
I still don’t think I ever was that much of a big deal, but all the same, to everyone who’s ever supported me and helped me be the person I am right now, to everyone who’s been there from the beginning, to all the devs of this game that has captured us for nearly a decade now, to all my fellow players and artists out there
Thank you.
See you out there, fellow commanders. Still the stars find their way.
370 notes
·
View notes
AITA for bitching about fics I dislike on my blog?
as a foreword, this is kind of a non-issue and no one's ever told me to stop, but I'm curious what other people think of fandom etiquette.
the fandom: a fairly small one. 2.4k fics on ao3 small. I recognize most people posting in its tumblr tag small. if I tell you the name of the source you'd almost definitely be able to find me small.
the source: pornographic, which means everyone involved is or should be an adult. it's BL with a switch MC, but the fandom overwhelmingly prefers bottom MC/top LIs (love interests), to the point where I've had people be astonishingly rude to me because my favorite character is a bottom LI and some of my friends have been outright harassed for the same. I used to not care about sex positions in the slightest, but now when I see bottom MC fanworks I can't help but remember how poorly I was treated.
the fics: wildly and inexplicably popular, even though they are, frankly, poorly written. it's eternal bottom MC turned up to 11, complete with copious amounts of OOCness in order to turn every ship into the worst ye olde yaoi gender roles dynamic you can imagine. it's things like MC, canonically a 23yo plank of a dudeguy, being written as a big titted milf in his 40s (which is made more confusing by the fact that one of the LIs is already a big titted milf). it's also things like the MC being written as disliking sex and having to be coerced into it when one of the most charming things about him is that he's a hilarious sex pest, or writing the LIs sexually harassing the MC when they really would never do that. I've likened it to replacing the characters with OCs that share the same name and my friends have agreed with me. I'm honestly convinced that the author and his readers don't actually like any of the characters if they feel the need to change everyone so thoroughly.
why I might be an asshole: it's assholish to hate on free fanworks, and I've bitched about these fics on my public tumblr blog. the fandom is small enough that there's a non-zero chance of it getting back to the author and a reasonable chance that fans of the fics have seen my bitching. I'm probably projecting the hostility I've received onto someone who's done absolutely nothing to me, and I am absolutely just straight up jealous that their fics get better stats than mine. I may also be being an asshole to myself, because being critical of other people's fics has made my hypercritical of my own.
why I don't think I'm an asshole: I think everyone has the right to be bad at things, but I also think everyone has the right to be a little hater. I don't put the fandom tag on these posts; they stay on my blog and my blog alone, and if later on I feel like I was unfairly vitriolic I'll delete the posts. I only post on tumblr because I'm certain the author in question only uses twitter, which dramatically lowers the odds of him stumbling across my posts. the fics are so popular that it's definitely possible that their fans would see my posts, but I think it's unlikely that they'd bother looking at my blog because 99% of my posts are about one of the bottom LIs. I have never and would never leave comments on the fics themselves, and I generally try to keep the bitchy posts to a minimum; it's far from a constant thing.
tl;dr - I publicly bitch about fics that (in my opinion) are poorly written and extremely OOC, under the assumption that it's unlikely the author would ever see it. AITA?
What are these acronyms?
197 notes
·
View notes
(nsfw-ish) Hiii can you make headcanons for the diaboys when they have a wet dream of their s/o?
💦🥵 When the Diaboys have a wet dream of their s/o—
Warning: 18+ content below; don't read if you're a minor and aren't comfortable with slight NSFW, sexual arousal, and orgasm-related concepts. This is a fictional work and should not be taken seriously.
Caution: Unfortunately, Tumblr has a history of admins quarreling over completing carbon copy asks due to users sending the same request(s) to multiple admins, thus, resulting in unintentional plagiarism. With this, please DO NOT send the same request to multiple blogs as it can cause unintended plagiarism discord to other blogs across Tumblr. The word “plagiarism” stems from the early 17th-century Latin word, “plagiarius,” meaning “kidnapper.” So please, do not send in the same request to multiple blogs and make admins appear to be “kidnapping” other people’s work when it isn’t their intention. If this is to occur with any of my posts, please contact me so we can work something out.
Hi there, Anon!
Thank you so much for requesting! I'm very sorry for the long wait! I hope you enjoy reading it. Feel free to request again anytime. :)
Created with: @liannelara-dracula
Before we get into this scenario, let’s get into some context about it:
Scientifically speaking, wet dreams or sleep orgasms don’t have to necessarily be caused by having erotic dreams.
However, because the Diaboys are not human, I think this applies to them a bit differently.
@liannelara-dracula and I think that because they’re immortal, having wet dreams is ONLY caused by having erotic dreams.
And because an immortal’s senses and feelings are known to be heightened compared to a human’s, let’s just say their wet dreams are a bit, well . . . messy.
And by “messy” we mean to the point where the sheets have a big stain on them.
Anyways, let’s go on to the hcs.
Shu:
He was kinda confused when he woke up because he did not see it coming.
I mean, unexpectedly finding this big stain on his pants and bed?
At first, since you were sleeping next to him, he honestly thought you wet the bed.
Asshole.
It took him a minute to realize that that wasn’t the case and that he was the cause of this mess.
Although, it definitely didn’t stop him from waking you up and accusing you for it.
“See what you did? You couldn’t control yourself.”
“Shut up! You’re the one with wet pants.”
Knowing he couldn’t get you to believe otherwise, he changed subject.
“Whatever, it doesn’t matter. Just clean the sheets.” He’d say, closing his eyes, attempting to drift off again.
“Shu, you’re not some baby where I have to wipe your ass for you.”
Being the smartass he is, he’d smirk, “Well . . . .”
Knowing he was being an ass, you’d instantly grab a nearby pillow and start hitting him with it, to which he’d just laugh since he’d find your reaction amusing.
Reiji:
He never thought he’d wake up this way.
I mean, wet because of you?
He never saw this coming obviously.
And he was so embarrassed by it.
And to make matters worse, you walked in and he instantly threw a blanket over himself and the bed stain.
"Good morning, Reiji. Did you sleep well?” You’d ask.
In a tense tone, and with the blanket up to his neck, he’d reply, “Yes.”
Noticing that his response seemed off, you questioned, “Are you okay?"
"Of course!" He'd quickly respond, attempting to keep calm under the pressure of keeping you in the dark about this. “Just give me a few minutes, dear.”
“ . . . Okay.” You’d say walking out, giving him his privacy.
Reiji sighed in relief, and couldn’t think straight for the rest of the day.
He found it so hard to be around you and ended up making himself a tea to calm him down.
Dude should’ve smoked a cigarette after that dream lmao. xDD
You kept asking if he was alright since found his behavior to be bit weird, but nevertheless, he just kept to himself.
“Reiji, are you sure you’re alright?”
“Yes, yes!” He’d reassure, a bit jittery in response despite his collective nature. In hopes of changing the subject and to keep you from asking further questions, he’d deter by keeping you busy. “Now then, let us go for a walk, dear.”
Laito:
Is not bothered by it.
He's had so many wet dreams anyways considering how long he's been around.
But he’s a little sad that what he was dreaming about was over and that it couldn’t continue.
“Aw, what a shame. We could’ve taken things to the next level.”
He even keeps tallies on how many wet dreams he’s had.
"Well, here’s another one to the list."
He even writes about the dreams that caused them.
He’s amused whenever he has one
But unlike some of his brothers, he’s able to get through the day quite normally, almost like it never happened.
Unless of course he saw you for the day and you did something super suggestive, then it takes everything in him to act composed.
He looks forward to the next time it happens and may try to make it happen by fantasizing about you before going to bed.
But honestly, when is he not fantasizing about you?
Kanato:
Finds it to be a pain since he “wet” himself and finds it a bit annoying.
Definitely wants to be alone when having to handle his wet pants and sheets.
Like, if someone knocks on his bedroom door, he yells at them to get lost.
He doesn't even want the servants cleaning it up because he finds it humiliating.
"They're not worthy enough to see this."
Knowing you caused this, he is beyond sexually frustrated and upset at you.
He literally cannot eat sweets without thinking about what happened.
He’ll be in such a grumpy mood that day.
But if you provoke him, he’ll pounce on you instantly.
Ayato:
He didn’t even know it happened, like, he was very much out of it.
He just kept sleeping on it and sooner than later, he finally sat on the edge of his bed, feeling heavy and not ready to take off for night school.
Laito walked in to tell him to get ready for school since they were already running late.
Of course, with Laito being Laito, he noticed Ayato’s state and had to tease him for it.
“Y’know brother, I thought we were much past you wetting the bed.”
“What are you—oh my god!” Until that point, Ayato hadn’t even noticed and it had been pointed out to him.
Embarrassed, he quickly grabbed his uniform, running towards the bathroom to change as he swore to brother, who was only amused by this situation. “This stays between me and you man. No one else can know.”
Subaru:
Oh shit! You were sleeping next to him when it happened
So how does he cover it up?
It’s simple—he can’t!
He turned red af.
He just couldn’t believe it happened, especially with you being right next to him.
Runs into the bathroom to hide himself.
“Subaru, it’s okay. It’s just-,”
“Leave me alone!”
Kino:
Isn't ashamed at all.
In fact, he's just amused that you had this effect on him while unconscious.
"Hey babe, look what you did to me."
Blushing hard, you covered your face, not being able to bear with the situation.
“Kino, please just change.”
Ruki:
Isn’t bothered by it, even if you're there sleeping next to him or not.
Is only going to act on it if you make a big deal about it.
“You keep complaining, but you’re the cause of this. You should be paying for this.” He’d saying coming out of the shower only in a towel.
“But I never said anything! You’re not being fair!”
“Oh really?” He’d say mischviously, pulling his sheet of the bed only to throw it at you to get you “wet.”
“Stop!” You’d yelp as you tried to dodge the wet spot of the sheet from touching you as he laughed.
“Eww! Oh my god, Ruki!” You’d exclaim.
He’d laugh approaching you, “C’mere.”
You’d back away in fear, “No, I don’t trust you!”
If you're not there, he's gonna be blaming you for it all day long in his mind.
Is going to let you pay for it by leaving you sexually frustrated for the day with some intimate activity he’ll initiate and then abandon, not allowing you achieve satisfaction.
“It’s only fair after what you did to me.”
Kou:
Like Shu, he woke up confused, but quickly realized what had happened.
Recollecting, that dream was steamy, leaving him to comment on it.
“Oh, that explains it.”
Wishes you could see what you did to him.
"Damn, I wish she was here."
Instead, he sent a picture to you about the wet sheets with the caption, “Look what you did to me last night.”
To which would lead you facepalm and leave him on read. xDD
Wants to try out what happened in his dream with you and will flat up try to ask you about it.
“Hey babe, why don’t we-,”
Knowing what he’d want, you’d be quick to deny, “No!”
Yuma:
When he woke up, he was kinda pissed.
Not because he dreamt about you, but because he’d have to clean the sheets since everyone does their own laundry in the Mukami household.
"Ah, shit." He'd hiss, looking at the wet sheets. "I knew I shouldn't of gone to bed thinkin’ of her."
And to his dismay, Kou walked in on him and this scene, and because Kou’s an ass, he has to tease Yuma about it.
“Damn, someone was thinking real hard last night.” He’d joke around.
“Why you!” He’d say, chasing Kou out of his room.
And if it wasn’t Kou who was in his case about this, someone else was bound to.
When Yuma got down to the laundry room, Ruki decided to have his fun because once he saw the sheet Yuma was putting into the washer, he couldn’t help himself.
“I’m surprised you’re washing the sheets earlier this week, Yuma.”
“Yeah, well, they needed a change.” Yuma would say, attempting to the situation up.
“I see. I guess with Y/N on your mind you’re bound to wash them more often.”
Knowing that Ruki had figured it out, Yuma would retort, “Tch!” leaving Ruki to smirk as he walked out of the laundry room.
And knowing Kou, he’d probably have a picture as well of Yuma when he experienced this.
Or, to make matters worse, he’ll just tell you about it when he arrives at school.
“Hey, Y/N, guess what?!” Kou would yell from across the hall.
“You asshole!” Yuma would react, threantening Kou to keep silent, “Shut up before I throw you outta one of these windows!”
Azusa:
He didn’t understand what happened when he woke up.
It took his brothers to explain to him.
“Oh . . . so that’s what . . . it is?” Azusa would comprehend.
Since he was given an explanation, he was happy you were in his thoughts since he finds no better way to sleep.
He hopes he’ll have more of these experiences since they’re centered around his one and only Eve.
"I wonder if . . . she has . . . wet dreams . . . about me? . . . I guess I'll . . . never know."
Carla:
Good lord, what did you do to make him wet?
He covers it up and pretends that it didn't happen.
He cannot live with himself right now.
And if has to see you that day, he’s not ready to face you.
All he can think about is what you two were doing in his dream.
“Carla, are you alright?” You’d ask finding his behavior to be a little off that day.
“The King of Founders is just fine.” He’d assert, ever so calmly.
“Okay, but you’re acting really weird today.”
“How is that?”
“Well, you seem tense.” Based on this, you further offered, “Do you want a massage?”
Just thinking of your touch on him was enough to make him lose his composure, so he’d refuse despite wanting one.
“No, no, it’s fine, really.”
And if you by any chance do something that turns him on, he’s not gonna be composed anymore.
He’ll give up and try to get you to the bed, or will just take you on a random surface.
Shin:
He blames you 100% and doesn’t care if you find it embarrassing.
Given how the morning is starting off between you both, he isn’t going to let it go.
“The one who should be complaining is me, after all it is uncomfortable to be left with such thoughts.”
“No, what’s worse is knowing just how deep your mind travels to something like that!” You’d argue, blushing at the thought.
“You should be honored that you were in my thoughts, love.” He’d smirk, making you shocked as you’d throw a pillow at him.
“I would be if it was in the sense of sentiment!” You’d retort, looking away.
“But making love to you is sentimental, even in my dreams.” He’d tease leaning closer to you, leaving you to blush harder as he laughed.
Not being able to take it much longer, you’d try changing the subject, “Would you just clean up already?!”
569 notes
·
View notes
NARUTO OMEGAVERSE ☆
୨୧ alpha!naruto x omega!reader (f)
— how does he act around his omega s/o ?
MY MASTERLIST: ☆
this is my first time writing for anything other than tokyo rev. I've just entered another naruto brainrot and was baffled by the lack of naruto omegaverse content on tumblr, so I decided to diversify my blog and write for naruto too!
I'll post a headcanon about being team 7's omega later in the evening!
ALPHA!NARUTO
naruto truly is an energetic person, the reason why he approached you in the first place is because of your empathy for others.
you know him since childhood, while his personality and his curse might have driven others away, you never treated him differently.
you were kind and thoughtful, but you still stood your ground and never hesitated to speak up for others.
naruto was always by your side. he was a noisy kid and whenever you voiced something, he often felt the urge to say it even louder to make sure people heard you or to back you up. you did feel a bit embarrassed sometimes, but his clumsy actions were endearing in their own way.
you noticed how he always seemed to protect you without never overstepping your boundaries. he wanted you to know he would always defend you, but never overwhelm you with his presence.
he would always challenge the other kids whenever he saw them as threats, possibly taking your eyes away from him.
always your #1 defender, never letting any other kids treat you badly, especially since you hung out with him. he wasn't afraid to get mad and pick a fight if he considered that your pride or integrity was involved.
growing up, he still didn't stop following you like your shadow.. the only difference was the way he carried himself, he seemed so much more reliable you found yourself falling for him.
COURTING
his actions towards you were no longer clumsy attempts to impress you, instead, he started an enthusiastic pursuit, his determination was impressive and you knew he meant every words he ever said to you.
as mindless and forgetful as he might look, naruto is one to spoil you with thoughtful gestures.
during the courting process, he would gift you handwritten notes, try his best to carve a wooden necklace with your initials behind it.
his gifts are surprisingly delicate and he's paying extremely attention to your interests.
naruto is always so supportive of you, cheering you on, congratulating you for any reasons and ready to help you for anything as well.
he's so reassuring, affirming that everything will be fine whenever you're doubting.
if you're in trouble for example, he'll simply tell you to go rest. he'll take care of the rest, you don't have to worry about anything! he'll throw you a big smile and come back with his same happy face, and your problems are all gone in a minute!
even as a teenager, naruto still is pretty jealous, not in a possessive way, but he will get upset when other alphas are looking your way. once again, he will not hesitate to challenge anyone if it means keeping you for himself. yes, he will be the main reason why you don't have any alphas asking you out anymore.
naruto wants to seduce you by showing you how strong and reliable he is, always bragging about his strength and how his training will turn him into one of the best shinobi to ever exist.
he tells you about his ability to protect you, and that he'll never stop working out nor neglect his training. you can rest assured that you'll always be safe by his side!
he is protective of you, that's a fact, although it's not as intense as some other alphas. he trusts you and values your independence, he doesn't want to become a burden or a nuisance to your happiness.
that's why he learnt to take it easy and let you live a normal life most omegas don't even have access to.
but don't worry, naruto isn't scared to step in, in order to shield you from whatever he considers compromising to your safety. he wants you to be 100% comfortable, doing everything in his power to keep you away from harm.
you're his priority and he will offer you his unwavering support in times of distress and doubt.
even during the courting process, you both are comfortable enough to let him spread his scent around you. he'll shower you with his pheromones to calm you down and talk to you in a reassuring manner, so foreign to the naruto people usually have in mind.
RELATIONSHIP
once you get together, he's attached to you, more than before if that was even possible.
he's dragging you to surprise dates, gifting you everything that reminded him of you and kissing your forehead every chance he gets.
his nose is always buried in your neck : he's whipped for you and your sweet scent, and he's shameless about it too.
he takes deep breaths with his face pressed against your scent gland and doesn't stop until you push him away. once you look at him, he has the most satisfied grin ever and profusely kisses your whole face with love struck eyes.
he's crazy about pda and isn't embarrassed at all to initiate it, even in public. you're his omega, why would he restrain himself from showing you his love?
he is so proud to be your partner, everyone knows about it the second you start dating.
you're the prettiest omega he ever laid his eyes on and naruto knows how lucky he is that you have chosen him out of everyone.
that's why he's so desperate to show you that he's the right one for you, that he's trustworthy and that you can lean on him.
oh yes please, he's so devoted to you he'll do anything! especially during your most vulnerable moments, when he thinks he's blessed that you chose to trust him near you when you're in this state.
ask him to bring you this type of snacks and he's running outside to get it! ask him to give you more blankets or soft items for your nest and he'll go straight to your favourite shop to buy them.
he's delighted the first time you ask him to scent one of your clothe. sure, he had gifted you a couple of his shirts when you weren't dating, when he was still courting you, but it was always coming from him, and he didn't really know whether you accepted them or just politely threw them away without him knowing.
to have his beautiful omega, directly ask him to be scented by him is a dream come true and you swear he has heart eyes when he eagerly starts scenting all of your wardrobe.
being in your nest, cuddling with you is quality time he'll never neglect or refuse. he loves it so much! everything smells like the both of you, an intoxicating mix of your flowery scent and his own, which makes him soo dizzy.
he's even happier when you start cooking for him, always packing his lunch before a mission or any normal training.
food is one of the things he loves the most, and to have it prepared by his precious omega is such a blessing. you're the best cook and your food is so delicious he can't get enough!
but you're not the only one who can make him giddy, naruto has his ways when he wants to make you flustered.
he actually doesn't do it on purpose, but when he suddenly acts all serious and talks to you with his reassuring and soft voice, looking at you like you're the most beautiful and delicate thing he's ever seen, you can't help the blush from making its way to your cheeks, nor the rapid heartbeats his manly scent sparks.
he smells it in your scent, it's subtle but he's able to decipher such change in you. when you get shy or a bit more submissive than usual, you scent also gets sweeter and softer. it drives him crazy and he has to dig his nose closer.
he teases you a bit about it, but he doesn't want to ruin the romantic mood so he tones it down for now.
his omega needs his love and attention, and he'll give it to her!
188 notes
·
View notes
Batman Rogues Tumblr AU:
Jervis:
-Joined Tumblr in 2009, has had the same blog all this time
-Has a big follower count, but most of those blogs have long since been abandoned
-Is very active
-No sideblogs, everything from kink to cute animal pics is on the same blog
-Has witnessed or been involved in every single major event in this site's history
-Attended Dashcon (he was the one who pissed in the ball pit)
-Involved in some sort of petty drama on a daily basis
-Has a 20km long post of just going back and fort arguing with some random user. This argument started in 2016 and neither remembers what it even was about. He gets worried if the other person hasn't responded in a while.
-Gets at least 3 callout posts a week. Always makes sure to reblog them and adds an essay underneath defending himself no matter if the callout post was about liking the wrong pony in MLP or murdering someone in cold blood.
-Kinnie drama the likes of which you've never seen before
-And in general just discord you never thought anyone could ever come up with
-At this point you wonder if he's even having fun on this site, but he just keeps on reblogging bunny pics like it's nothing
-Has a Wacom drawing tablet
Jonathan:
-Joined in 2011 after Jervis introduced him to the site
-Has some really tacky theme he hasn't changed since 2013
-About a couple hundred followers, but they are very devoted. Lots of mutuals
-579257405547 blurry photos of Nightmare
-Post fics and essays on various topics he's been thinking about lately
-Of course reblogs every single spoopy art piece he finds
-Definitely does fic request
-The most fucked up smut you've ever read
-Like smut you don't even know is smut, because it's just that confusing
-Most of his post don't get past 50 notes, but he has made a couple of post, mainly of the: ”Here's how you write x, y and z...” and ”As a Professor of Psychology, I can tell you...” variety, that have about 10 000 notes
-Has a chill time on Tumblr
-Only uses Tumblr on desktop. Has never even seen the app.
-Completely unironically reblogs every cool skeleton on a motorcycle pic
Joker:
-Joined in 2013
-The only reason he joined is because he once came across a horny drawing of Batman and searching for the artist led him to Tumblr.
-Starts writing a post, gets distracted mid way though and starts doing something else. Comes back to Tumblr 3 hours later, notices he was making a post, doesn't even bother rereading it despite not remembering what it was about and just hits posts. His blog is full of completely incomprehensible post that just stop mid way through
-Makes a couple post that get so popular they are still making rounds today. They will always have additions like: ”I still can't believe this post was made by the fucking Joker” and ”Joker had a Tumblr?!”
-Forgot his password a month after joining and never visited the site again. Barely remembers he ever had an account
-Those true crime people still harvest his 20-post-pathetic-excuse-for-a-blog-blog for content to this day all the while completely ignoring all the rogues with still active (and better) blogs. They are saying things like: ”Ooohhhh, it's like a deep dive into his twisted mind :00” and are always trying to find some hidden symbolism and meaning behind all his ”just farted so loud it scared the neighbor's cat” kinda posts.
Eddie:
-Joined in 2011
-759752974576 sideblogs, 55425720752174838+1 sockpuppet accounts
-When he's really low he'll post a poll like: ”Be honest, am I cute? Yes/No” and then has his 55425720752174838+1 sockpuppet accounts hit ”Yes” and somehow ”No” still wins. He deletes the whole post.
-Posts the most obvious ”and everybody clapped” Tumblr fake stories you've seen. When he gets called out, he pretends you were supposed to figure out they were fake
-Has an awful time on Tumblr, but can't delete, because he's addicted to getting notes
-Always falls for every one of those post where OP pretends to be stupid on purpose (i.e. smooth sharks, putting fingers in guns etc.)
-Posts riddles everyday that even his biggest haters cannot help but try and solve
-Sends himself hatemail so he can post the witty comeback he just came up with. Forgot to hit anon once and people just won't let it go
Hugo:
-Banned for posting cock :/
83 notes
·
View notes
Tips For Vtubers
Howdy there, I’m Liv and I’m a vtuber much like you, but I’ve been here the whole time so I’m here to compile stuff for you to help make your transition less scary.
To start, here’s is a post with a lot of tips for general tumblr use and here’s one for giving your blog a custom theme.
Beyond that here’s other things that aren’t mentioned but are gonna be relevant for you:
If you’re coming back to tumblr know that you can’t follow from your sideblog, if you want to follow back it will be from your main, as will your likes, replies, asks. Decide what to do with this information now before you settle into a blog.
Fully explore the settings, there's a ton of stuff hiding in there. AND do it on PC at least once, some stuff is not in the app.
Blogs have individual block lists, no idk why either. So if you want someone banned from everything you need to do that manually.
Also enable tumblr Labs! It’s got reblog graphs which are rad (my beloved orbs) And alternate dashboards, the Blog Subscriptions one is my fave because it means all you have to do is turn on notifications to get all your fave guys in one dashboard.
Contrary to popular belief there is still a porn and adult content community here, if you want to get anywhere near them you have to have age in bio or they’ll smite you. EDIT: I posted more about how to navigate lewdposting here.
Tiktok embeds don't play nice with tumblr for some reason, if you also do tiktok then just reupload your videos and link your account there underneath.
The link post type will show up for your followers but there’s a chance it won’t show up in any tags, so don’t do going live posts like that.
BUT you can straight up embed your stream into your posts! As long as you're using the New Post Editor you should see this menu:
Click the video camera, link to your twitch and bam. There it is. You can also do this with the video post type! If you're ever worried about your post format getting bonked just go through the tags and see what posts that DO make it are doing. Together we can overcome spaghetti code.
General "tumblr culture" is to not comment on posts but its not one thats set in stone, your fellow small vtuber account is probably dying for interaction so comment on posts! scream in the tags! send funny asks! Getting interaction right now is going to be a big comfort during a weird time.
Oh yeah we have ask boxes built in, no marshmallow needed.
ALSO we have pinned posts just like twitter, but as long as you want! Put your ref & socials & art tag (yes you can keep your fanart tags) & your minors DNI & a picture of your cat if you want.
OH I do suggest picking out tags for your personal content if you plan to also do reblogging, makes it easy for newcomers to find what you're doing.
#vtuber and #indie vtuber are full of fanart for the big guys. If you wanna find each other use #vtuber uprising
Okay this post is getting so long but final tip: check out custom pages. They're on the custom theme menu and they're basically mini webpages on your blog that can have their own coding. You can do Literally Whatever. Lore! Credit page! Ref sheets! I once put a choose your own adventure where you navigated by clicking specific parts of a picture on tumblr pages. I Mean Anything.
That's all for now, please add other tips if you want. And please reblog! Not just this post but other peoples too! This will all be way less of a drag if we can find each other. 💖
EDIT: One more thing, lolisho shit Does Not Fly here. They are some of the only tags that tumblr has actually shadowbanned and there is a reporting criteria for it to get taken down. It also doesn't fly on my blog! Begone!!
1K notes
·
View notes
As a fellow Beatles fan (I assume), how do you still love the boys despite some of the bad things they have done, allegedly done, and/or are tied to but we don’t know if they have actually done?
I love them and their antics, but this trips me up every now and then
oh anon.
you correctly assume my fellowship.
we perhaps need a master post to link people to all the answers every beatles blog has to this same anonymous worry.
but my thought pattern is:
a) everyone's terrible it's not just the beatles
and by 'everyone' I mean men. I do get where you're coming from, I have my days, but at the same time it almost surprises me what a big issue this is for people, because all men are awful*. Pretty much any man put in the beatles situation would have been at least as awful - and many worse - than the Beatles.
I'm not saying that to mean 'so they're not that bad!' I'm saying it to mean that every man around you is as bad as they are. Yes even the modern ones. So the thing you're actually dealing with is 'the awful nature of men'... so it's hardly even a question about liking the Beatles and coping with that. It's just about existing in a world where you know what men are like - and coping with that. So you cope with it however you generally make peace with the fact that men don't like women very much... and if you struggle with that you have to read the books where we keep actual feminism, not tumblr.
b) it doesn't matter that much
your enjoyment of the beatles isn't going to bring about world ruination, you don't need to be some pure moral absolute, you're not going to hurt anyone by finding joy in some dickhead from the sixties! you don't pick your favourite with your moral compass, y'know? turning away from them isn't going to change anything that happened, or make anyone feel better, or even make you a better person with more inner peace. you're fine.
it's just about not getting defensive or pretending things didn't happen, or somehow arguing like it doesn't even matter that they hurt people because they could have been worse, or pretending it's all blown up from nothing. that's when fandom becomes a bit shit and ridiculous. it's just very possible to be aware of the terrible things the beatles did and still feeling the thrill of the universe flood through you when Paul screams.
* The bots will find me! The bots will "not all men!" me. You don't have to worry about it or do it yourself, the bots will do it. I will be suitably told off for generalising about the terrible menfolk who are statistically + anecdotally + factually definitely worse than the womenfolk, and I'll be reminded that just because it's true doesn't mean you can just say it, because we're meant to pretend. So you can just scroll by and not worry that I might not get told.
82 notes
·
View notes
hey, have you heard that pillowfort has ✨ drafts ✨ now? (as in, the ability to save your posts as drafts.) they're still working on the queue feature (update: it's done!), but drafts are a big step forward!
in case you missed it so far, pillowfort is like a cross between tumblr and dreamwidth/livejournal, with a simplified dashboard reminiscent of old school tumblr and some classic livejournal features such as communities, threaded comments, and the ability to make individual posts followers-only or mutuals-only.
what are communities? basically, central hubs for posts about any subject you want that, unlike hashtags, can be moderated. they may have rules, such as "[subject matter] must be tagged" for example. you can post directly to a community or reblog existing posts to it!
since the site is currently experiencing some financial trouble, i thought i'd help out by spreading the word once again.
edit: the fundraiser was a success! crisis averted! i knew we could do it :D
why you should give pillowfort a chance:
no ads
no venture capitalist funding
no spying on the users
completely free to use except for optional premium features
nsfw is allowed except for sexual depictions of minors. if you're unsure what exactly that means, their tos may help
communities and the privacy controls mentioned above are excellent features
great community, low drama compared to other websites (so far)
the site's features themselves encourage genuine connection and good-faith conversation over endless "discourse"
every blog can automatically be filtered by original posts only or reblogs only
reasons not to join:
if you enjoy algorithmic social media. there is no algorithm at all
if you want to post or look at machine-generated art. they're still finalising the wording and personally i hope some exception will be made for models trained on ethically sourced images, but basically an anti-AI rule is in the works (update: finished!)
if you cannot live without reblog additions (reblogging with comment). all discussions on a pillowfort post take place in the comments section, and only your own followers see your tags. this has its pros and cons for sure! a similar feature to scratch that itch may be implemented in the future, but it will never be exactly like on tumblr.
if you need everything to be an app. the website works fine in a mobile browser and a progressive web app will hopefully be released soon (basically it's like an app in your browser and on mobile these can be added to the homescreen like real apps i think? they have push notifications!), but there's not going to be a native app available through official app stores due to the restrictions of those stores.
other factors to consider:
yes, the userbase is still small. depending on your interests, activity may be very slow. but we can change that! and on the plus side, reblogging your post to a community is a good way to easily get more eyes on it; way more effective than simply adding tags imo
the site culture is a bit different than on tumblr. many people read everything that's been posted since the last time they were online and don't follow more users/communities than they can keep up with. it's still somewhat lacking in shitposts and heavy on "essays" but don't be afraid to post whatever 😅
there are no blog themes like we have them on tumblr as yet, but you can customise your blog's colours and use html/insert links and images in your blog description
likes literally do nothing except to let OP know you enjoyed their post. you can't look at a list of all your likes. beware!
the staff is small and development is slow. some highly anticipated planned features other than the aforementioned queue include:
- multi-account management
- dashboard filters/reading lists
- post bookmarking (since likes don't work that way)
but we don't know how soon any of those will be implemented.
there is a user-developed browser extension (well, a userscript) called tassel available that adds additional features much like tumblr's beloved xkit :)
✨ okay, so how do i sign up? ✨
if you're interested but confused by the sign-up process or still under the impression that you need to pay to sign up (false), i'll put some clarifications and invite codes under the read more below. plus a note on donating, premium features, the paypal issue etc.
in a nutshell:
it's free
signing up without an invite code is possible, but you may have to wait a short while - supposedly less than an hour atm. just submit your email to the waitlist
if you don't feel like waiting, you can either use an invite code from an existing user or pay $5 to sign up instantly
every user gets plenty of invite codes and we're all willing to hand them out at the drop of a hat. they're really not hard to come by
some invites to get you started (just click the link):
invite 1 ▪ invite 2 ▪ invite 3 ▪ invite 4 ▪ invite 5
invite 6 ▪ invite 7 ▪ invite 8 ▪ invite 9 ▪ invite 10
invite 11 ▪ invite 12 ▪ invite 13 ▪ invite 14 ▪ invite 15
invite 16 ▪ invite 17 ▪ invite 18 ▪ invite 19 ▪ invite 20
i'll try to periodically check if any have been used and cross those out.
...paypal issue?
ok so paypal doesn't like working with sites that allow nsfw. as a result, you need a credit card in order to donate to pillowfort, buy one of those insta-registration keys, or subscribe to premium features*. i personally happen to have a credit card and would be willing to help out anyone who trusts me enough to send the money to me via paypal, but i realise chances are only my friends will do this.
some users are currently organising various activities for the purpose of letting people who only have paypal contribute to the site's survival. it's not super relevant for new users and won't get you access to premium features, but i thought i'd mention it anyway in case someone loves the concept of the site so much they want to support it immediately. a fundraising community has been created to collect posts of that nature!
*premium features are strictly limited to two categories of things:
fun little extras that no one truly needs
higher image upload limits, because obviously big images take up bandwidth and are therefore a reason for increased costs
you will never need to pay for vital accessibility features or anything of the sort. :)
244 notes
·
View notes
Your bio says proud Indian but then why only hindu lives matter?? There are so many other religions living in India as well. You seriously should be in school right now instead of being toxic on tumblr.
Reading comprehension fails people yet again. Sad.
I am a proud Indian, yes. My bio says ॐ and proud. That being said, this blog is exclusively to discuss Hinduphobia and violence against Hindus. Does that make you uncomfortable?
Why do you have such a big issue if I take a space and make it solely to discuss issues affecting Hindus? Why are you coming to MY blog and getting upset that I'm only talking about Hindus? If it's affecting you that much, start your own blog, by all means. Record the violence against all communities in India, you have my full support. Go on, do it.
Also, I'm so offended that you think I can't do both, being in school and toxic on Tumblr. I'm a very capable woman, I can multitask <3
You keep crying, I'll keep being ✨toxic✨ on Tumblr. Mwah.
78 notes
·
View notes
hi there chris! since the new year is approaching rapidly, i wanted to ask my favorite creators (that includes you! i love your art!) how they look back on their 2023 tumblr year and which blogs made them happy to be here. i am very happy to follow you and hope you'll have a great 2024! 💘
Hiiii omg this is so sweet and means a lot to me, thank you! 🥺💕
I've been meaning to do a little end-of-the-year shoutout/love post for some of my favorite blogs, so I hope you don't mind if I use your ask as the perfect excuse!
I've had many fun years on tumblr, but this one has been extra special. Falling into the Good Omens fandom and meeting all of you amazing people has made this year so so SO much better than it otherwise would have been, so here are some special shoutouts (apologies, I'm sure this will get long, things like this tend to get away from me, so I'll put it under a read-more)
@majortomyourcurcuitsdead SASHA can you believe I was going to just send you an anon telling you that I think you're cool and leave it at that. Can you believe it. WELL thank Somebody you had your anon turned off and I had to expose myself in your dms because it feels like we just instantly connected about like 20 different things and haven't stopped talking since sskjdfhs anyway I'm so happy I met you you're so fun and so clever and so talented and so enthusiastic and I've only known you for like. What 2 months?? Ish? But I already love you so much <3
@lineffability !!! Line you are so *struggles to find words* you're just great is what you are okay. I feel like you are what happens when somebody takes a big cup and puts six shots of love, chaos, sunshine, talent, fun, and enthusiasm into it, generously sprinkles intelligence on top and gives it a good stir. I don't even remember how or when or why we started talking tbh? But your creativity is so inspiring, and some of my favorite tumblr-moments of this year have been 'yes-and'ing with you about one thing or another in a very >:3 manner hahah so! my point is! i love you lots <3
@dontbotheraziraphale Teeeedddd you're wonderful, I vented at you one time and then we talked for like 2 hours and at the end of that 1 conversation I already considered you a friend - and not just in that "tumblr mutuals who talk 1 time are my friends" kind of way but like. Genuinely. You're so kind and so fun and every time we talk it's such a good time ily a lot my bro my buddy my man <3
@crikey01 Tallulah HI I also completely forgot how we started talking but I remember connecting the dots that you were the one who painted those INSANE black and white and gold oil paintings and the way my jaw dropped like?? BRO you're so talented I admire you so much! And I love that we bonded over stopping each other from masochistically checking certain peoples' blogs... 😂 Anyway you're so sweet and fun and ily lots <3
---
The list could probably go on but you four are the people I've talked to most on here and you're the tumblr chat boxes I never close but always just minimize and y'all better see this as the ultimate internet declaration of affection that it Clearly is >:D 💕
---
And here are some more shout-outs because I just HAVE to.
Apologies, I know I've already tagged a bunch of you recently in a mutuals appreciation post but. This is my official thank-you-for-2023 post and I just have a lot of love for you all okay sorry feel free to ignore this <3
@rowan-ashtree (i'll text you back soon I promise I'm sorry I just haven't had the brain-space recently ssjkdfh) @crawley-fell (we've never talked but i love you from afar :')) @ineffabildaddy @llokilaufeyson @actual-changeling @saryasy @hyperfocusthusly @beccibarnes @rainbowcrowley @thesherrinfordfacility @goodoldfashionednightingale @wibbly-wobbly-blog @highlyillogicalandroid (i see your data obsession and i agree <3) @tortugay @foolishlovers @stargazing-crowley @gingiekittycat @weasleywrinkles @bildads-shoes @finleycannotdraw @bowtiepastabitch @heytherefluffy @samwwise @nocturnal-birb @athousandyearstime @angelsdiningattheritz @most-normal-eccles-cake-ignorer @jedthesecretdreamer @wraithee @hydrangeadangea @southfarthing @frodo-baggins @mobius-m-mobius
95 notes
·
View notes