Tumgik
#H☆S Award
yyh4ever · 6 months
Text
104th Hop Step Award - H☆S (October, 1993)
Togashi-sensei's Direct Instructions! The road to conquer all areas of manga! 
Mass Recruitment for the 104th (October 1993 Term) H☆S Award!! This month's judge is Yoshihiro Togashi-sensei!
Tumblr media
The Hop☆Step Award (H☆S Award) was a monthly recruitment project by Weekly Shonen Jump (Shueisha) that took place from March 1985 to July 1996.
I already translated Togashi's ten "4-koma" that he drew during the Yu Yu Hakusho serialization to give advice to the participants of the H☆S Award - October 1991 & 1992 Terms.
This time, I am translating the October 1993 Term, where he gives the newcomer manga artists more tips and advice on how to create different styes of manga. The winner of this edition was Eiichiro Oda with the one-shot "Ikki Yakō" (一鬼夜行). At the time, Yu Yu Hakusho was in the Black Chapter Arc.
Togashi gives instructions to help creating gag, love comedies, sports and fantasy manga. He used a little bit of all those elements in Yu Yu Hakusho.
Part 1. Gag Manga
Tumblr media
T/N: Chain letters (letters of misfortune) were popular in Japan during the Showa era. A ''letter'' or ''postcard'' was delivered to your home/work in the style of ''If you do not send it to a certain number of people, you will be unhappy.'' The sender is unknown. Chain letters were also a hot topic in magazines and manga, like Doraemon and a bunch of gag manga. 
Tumblr media
Source: Weekly Shounen Jump N°44, 1993. Shared by katsura_00
The funny versions of Yanagizawa, Kido and Kaito represent the editors in charge of:
Jungle King Tar-chan/DNA² (Kaoru Kushima);
Lucky Man/JoJo (KAITO Katsuhiko);
Yu Yu Hakusho/Monmonmon (Tomoyuki Shima)
Waiting for powerful works that will break these guys territories! !
Tumblr media
They were responsible for the screening, checking all the applications and eliminating the mediocre works before passing them on to Togashi. Inside their territories, works with "characters that are all very similar," "characters with no strong personality at all" or "just imitations of existing characters" were mercifully discarded. 
Part 2. Romantic Comedy
Tumblr media Tumblr media
Source: Weekly Shounen Jump N°45, 1993. Shared by katsura_00
Part 3. Sports Manga
Tumblr media Tumblr media
Source: Weekly Shounen Jump N°46, 1993. Shared by katsura_00
Part 4. Fantasy Manga
Tumblr media Tumblr media
Source: Weekly Shounen Jump N°47, 1993. Shared by katsura_00
T/N: The fantasy illustration of Botan, Keiko, Yukina, Shizuru and Atsuko in medieval clothes was designed to the opening page of Yu Yu Hakusho volume 11, tankobon edition.
Tumblr media
🏆 Winner: Eiichiro Oda
Oda-sensei was the inner of this edition! Togashi-sensei reviews his 31-page one-shot, "Ikki Yakou", that was published in the 1994 Shonen Jump Spring Special, and later reprinted in 1998 as part of Wanted!, a compilation of Oda's pre-One Piece stories.
Tumblr media Tumblr media
Source: Weekly Shounen Jump N°2, 1994
31 notes · View notes
k-wame · 4 months
Text
Tumblr media Tumblr media
BARRY KEOGHAN 📸 Nick Thompson | Wonderland Magazine | Winter 2023 Issue
1K notes · View notes
thebestestwinner · 2 months
Text
Tumblr media Tumblr media
143 notes · View notes
yodeleyewho · 2 months
Text
I wonder if the people working on Starsky and Hutch knew how much of an impact they would be making on the buddy cop genre. Many cop shows that came out after it had that S&H influence in them, though some might not have been as open/honest/loud about the intentions of the partnership(s) on their shows. But it’s kinda weird how these shows have kinda given me a new perspective on love stories or just love in general. I LATCHED onto these unconventional-ish relationships on screen, like I want to study them and take them apart and put them back together again 😭
14 notes · View notes
remyfire · 6 months
Text
Tumblr media
Them: Okay can we get Newsom's closeup?
Alan's nose:
8 notes · View notes
majestydeerakuma · 1 year
Text
GAMING AWARDS 2022 SPOILERS
-
-
-
-
HOLY-
AAAAAAAA
STRAY WON BEST INDIE GAAAAAAAAME
AAAAAAAAAAAAA
CAAAAAAAAAAAT
PALSKKALSKSKKSNDBEHJQODKFJQJKAKDJFJ💖💖💖💖💖💖💖
Tumblr media
kitty
catcatcatcat atcatcatcatcatcatcatcafcatcatcatcatcatcatactactcatcatcatcatkittykittykittykittykittykittykittymigthkittykittykittylgigukitttukitutscrunklyscrubklyscrunklyscrynklyscrubklydtuncllr
I cried during the ending
I wish I could own a cat
7 notes · View notes
hereliesbeetlejuice · 2 years
Text
okay gang the petition to save the show worked now time to start the petition to go back to the old makeup design because i’m sorry but i can’t look at this much longer
Tumblr media
16 notes · View notes
likesplatterpaint · 2 years
Text
Tumblr media
Way up in the water
I see it swimming
Where is my mind?
5 notes · View notes
belwoodmusic · 4 months
Text
Top Ten EPs of 2023
As fun as it is looking back on the past twelve months, reminiscing about all the music that captivated us, our EP list only has one foot in the past, while the other is firmly pointed towards the future. For while this part of out Listmas festivities always finds room to celebrate work from old favourites, EPs are the vehicle through which so much up and coming talent makes its presence known,…
Tumblr media
View On WordPress
0 notes
autisticlee · 6 months
Text
when you're so awkwardly autistic and bad at people and talking that no one will even trust you to do a thing that's a special interest/you are passionate about/work harder than anyone else at/are actually really good at 😔 i wish my skills and hard work woukd speak for themselves, but the undesirable autism traits seem to permeate through and overshadows everything.
does this happen to anyone else? is this a common autistic experience? or is this a me thing?
1 note · View note
hsmagazine254 · 7 months
Text
Ed Sheeran: Crafting Musical Magic Across Genres
H&S Magazine’s Best Artist Of The Week Ed Sheeran Album: Essentials, Genre: Pop Music Ed Sheeran, a name synonymous with musical brilliance and boundless creativity, has carved a unique niche in the world of pop music. Born in 1991 in Halifax, West Yorkshire, England, Sheeran’s journey to stardom is a testament to his unparalleled talent and unwavering passion. With a knack for crafting…
Tumblr media
View On WordPress
0 notes
crowdvscritic · 10 months
Text
crowd vs. critic single take // ONE FLEW OVER THE CUCKOO’S NEST (1975)
Tumblr media
Note: This is a modified version of a review originally written for ZekeFilm. Photo credits: IMDb.com.
Randall P. McMurphy’s (Jack Nicholson) latest run-in with the law has sent him to a mental hospital. At first, he breathes life into a sterile world built on schedules, routine, and negative reinforcement. For the first time in who knows how long, his fellow patients are living a little, but any hope the colorful Randall brings to this white and khaki world is challenged by the orderly (literally and figuratively) Nurse Ratched (Louise Fletcher). She sucks up the breeze Randall blew into the first half of the film and turns Cuckoo’s Nest into a tragedy born of her rigidity.
Tumblr media
CROWD // If you want to have fun at the movies, skip the 1970s! 
Yes, I’m well aware my take is in the minority for film fans. I’ll never deny the artistry and impact of movies like The Godfather, The Last Picture Show, M*A*S*H, Saturday Night Fever, and Taxi Driver, but I also can’t deny many of the decade’s essentials leave me feeling miserable thanks to dark themes, serious subject matter, and long runtimes. And thanks to this Best Picture Project, I get to add One Flew Over the Cuckoo’s Nest to that list!
While the first half of the film finds comedy in its quirky characters and the most dysfunctional boat heist of all time, it’s not long before McMurphy and his friends’ story turns bleak. We’ve made progress in how we talk about and treat people with mental health issues since Ken Kesey’s novel was published in 1962, but Cuckoo’s Nest is haunting because it speaks to more than its literal setting. Though most of us will never live through situations so extreme, we’ve all had to shed bits or our identities to conform for our own protection in one way or another. I put on 2002’s Best Picture nominee The Pianist while I wrote some of this, and I found the Holocaust drama put me in a mood similar to when I was watching the 1975 Best Picture winner. Both stories are built on authoritarian power structures surgically extracting undesirable people from a larger society, and the only hope for survival within them is falling in line and no longer thinking for yourself. Ratched stamps out individuality and punishes dissent with physical torture so upsetting I don’t even like looking at the pictures of her. 
POPCORN POTENTIAL: 5/10
Tumblr media
CRITIC // Even if Cuckoo’s Nest kept me up past my bedtime because it wouldn’t stop rattling around in my mind (if you’ll pardon the crude expression), I won’t attempt to discredit its Oscars legacy. The directing and screenplay are taut as the hospital cornered bed sheets, Nicholson is at the top of his game (winning his first Oscar), and Fletcher’s icy performance is subtler and more believable than I expected. Bonus: The supporting performances from Danny DeVito and Christopher Lloyd have only aged well as they’ve become more beloved performers since this release. Cuckoo’s Nest is also a member of the exclusive Big Five Winners club (Best Picture, Director, Actor, Actress, and Screenplay) with It Happened One Night and The Silence of the Lambs. Arguably more significant, it beat out a Best Picture nominee considerably more fun (and more important to the history of modern movies): Jaws. (The other contenders were Barry Lyndon, Dog Day Afternoon, and Nashville. What a year for you ‘70s cinema enthusiasts!) Though Jaws may be more top-of-mind half a century later, it didn’t need the Oscar win to cement its legacy—Cuckoo’s Nest is a powerful essential of the decade, and its Best Picture win ensures it won’t be forgotten to time.
ARTISTIC TASTE: 10/10
0 notes
thebestestwinner · 3 months
Text
Tumblr media Tumblr media
See pinned post for the full bracket!
13 notes · View notes
marlinspirkhall · 7 months
Text
Humans sending out signal after signal, message after message, space probes, emails, photos, light shows, intergalactic fireworks, all in the hope that they're not alone: Please reply, please reply, please reply, ple–
Aliens, screeching across the universe in a brand new FTL ship: CAN YOU SHUT UP? WE GOT YOUR FIRST ONE THOUSAND MESSAGES, DO YOU NOT UNDERSTAND HOW BIG SPACE IS?
Humans: oh my goooooosh, hi
Humans: Did you invent faster than light travel just for us? 🥺
Aliens: NO!!!
SETI: Radio message received.
Radio message: We are receiving you. We have decided to answer you in your own language, and–
SETI: New radio message received.
Aliens: Oh no.
Radio message: We have received your previous messages pertaining to life on Earth, and have included our own data packet about life on Big Tree in return. We named our planet before we learned it was only 30% arboreal. Thank you for the golden disc, it was extremely tasty. Haha. Just kidding.
SETI: Data packet downloaded. Decrypting...
SETI: New radio message received.
Radio message: As previously stated, we are receiving your messages and your gifts. We took a photo of our planet with our own photo-capture device, as we were unhappy with the one you provided.
SETI: Data packet update: Warning: Several terrabytes of information may be corrupted.
SETI: New radio message received.
Radio message: This is the Generation Ship Tree Hollow. My designation is Captain Root-Skygazer. Our people have instructed us to fly ahead and communicate with you when we reached the thirty-year marker, as these messages are likely to reach you faster. They request that you stop broadcasting messages with the subject line: 'Oh, how woeful it is to be alone in an uncaring universe (and other similar poems)' because it frightens the children and makes our scientists deeply existential. I, personally, am partial to episodes of M star A star S star H. It has been of great interest to learn historical facts about the longest Earth conflict of your common era. I miss my home, and I am saddened that I will never see yours. This ship has a self-sustaining ecosystem of plants native to our planet, and a crew manifest of one hundred and fifty-seven. The replacement generation currently numbers one hundred and seventeen.
Radio message: Hey, Ball Of Dirt, it's Big Tree again. Lose our number, would you? There must be some other semi-evolved space aemoba you can bother. (Several words untranslateable)
Aliens: Yeah, so your answering machine is going to be like that for a while–
Humans: What was that part about a Generation Ship?
Aliens: We were hoping you could tell us that, actually. We lost contact with them after the 200 year marker.
Radio message: This is the generation ship Tree Hollow. My designation is Captain Cradleroot. Captain Root-Skygazer was my grandfather. Inspired by the speeches of your contemporary leader, Ronald Reagan, I decided to restructure the existing system here which allowed crewmembers to eat as they required. Under this new system, we award tokens to whom we feel has done the most valuable work, and they can redistribute those to the hungry if they wish. But they do not. However, I believe that [...]
Humans:
Aliens:
Humans:
Aliens: This is all your fault, by the way.
1K notes · View notes
hannieehaee · 3 months
Note
so about the dk thing... hold my beer, luna! I have some things for you:
- him being the biggest advocate for princess treatment™ 24/7, but becoming mean one specific night out of stress (due to work or anything you want), the outcome can be angsty or smutty >> this one can be a little tricky, because I swear I never saw seokmin mad...
- seokmin with an extremely shy s/o who makes him endeared every time, especially if she struggles when asking for any type of ffection
- dk in his mingyu era... also known as the scenario where seokmin gets constantly teased by his s/o about everything he does (which I can see happening, since he's such a sweet soul), but there's a turn 🤨☝️: dk gets his bite back by domming the f out of her 🫶
this is the result of being extremely dk obsessed.
I don't know if any of these were able to spark anything in your pretty brain, but I love anything you write anyway so...
kisses ♡
18+ / mdi
Tumblr media Tumblr media
content: mean!seokmin, sub-ish reader, afab reader, smut, established relationship, angst, fluff, penetrative sex, etc.
wc: 2813
a/n: thank u for the suggestions anonie i loved them 🫡 i decided to do the first one hehe (mostly bc i live for princess treatment in fics but thats a subject for another day) hope u enjoy, fellow dk obsessed individual <3
masterlist
if there was an award for best boyfriend, seokmin would easily get first place.
he was always known to be the sweetest, most caring boy around. he had even gotten teased in front of millions over the extremely long texts he had a tendency to send to showcase how deeply he cared for the people in his life. seokmin just happened to be an overly affectionate guy, but who could blame him when he had so much love to give?
however, no one had truly scratched the surface of his affections. no one, but you. you bore the brunt of the most passionate and emotional aspects of his love. there was no one in this world seokmin knew how to love better than you. it was almost as if being your boyfriend had been the one task he had been sent to do on this earth. and he did it damn well.
to sum it up, you were his everything. seokmin had always craved romantic love; to have someone who he could give all his affections to without any type of filter or judgement. you happily received his love and gave yours right back, making you one of the most envied couples around due to the love that very clearly radiated out of the two of you.
every single one of your days was met by endless affection from your boyfriend, affections which he adored to give to you. you never had to ask for anything from seokmin. he just always knew the perfect ways in which to take care of you, always insisting on tending to your every need. however, everyone has off days. even seokmin.
the day had started like any other. you'd gone to sleep in each other's arms, waking up equally as tangled up as the previous night. seokmin woke up first, quickly getting ready before kissing you goodbye with the promise of coming back in time to have a dinner with you. the prospect always made him giddy. his whole life he'd always wanted a domestic routine to share with the love of his life day by day and now it was his reality.
like always, he departed home with a smile on his face, knowing he was about to arrive to his dream job that he shared with his best friends only to go back home at the end of the day and fall into your arms all over again. life was good; far too good to seokmin.
it seemed like those were the last few good moments seokmin was meant to have that day, as absolutely everything went wrong after that.
it first began with him embarrassingly tripping on his way out of the car that had driven him to the company, cutting up one of his favorite designer tops (one that had been a limited edition by the way!!). only a few people had seen, so the fall on its own hadnt been too embarrassing. however, as he fell he also happened to drop and smash his phone screen. upon trying to turn his phone back on, he failed, now being stuck with a useless phone for the rest of the day (or even all the way until he had a chance to get it fixed).
the shitty day did not end there. it was just starting.
the next awful predicament occurred just as he walked into the practice room. he hadnt known it until stepping foot inside, but he had just walked into a fight. a few of the members had been fighting about some stupid and unimportant thing, which made at least half of them far too irritable for their own good. on days in which members were irritated at each other, their coordination had a tendency to lack, which only caused more irritation. members snapped at each other throughout the day, making the hours of practice almost unbearable for seokmin. on top of that, he had developed a huge headache just an hour into leaving home. he was also nursing an old ankle injury he had neglected to get treated, which was now acting up due to his fall earlier that day.
his ankle injury led to a few performance team members snapping at him due to his lack in performance. he knew in his heart of hearts that it was just a stressful day for them all (and that his own attitude had been snappy thus far), but he couldnt bring himself to reason this, making him snap right back at his members. even upon going out to eat with his manager he bumped into some rude fans who had been a bit careless with his personal space, except this time he coupdnt react since he knew itd become a scandal.
halfway through his day seokmin realized how rude and unlike himself he had been acting. usually he'd be the mediator in any arguments among members, but today he had even joined in and worsened the situation. he also never really minded if fans were a little overexcited upon meeting him, simply chalking it up to the shock they felt at seeing him. except this time he found himself feeling annoyed? at it. this was very unlike him, but his mood simply continued to worsen throughout the day.
by the time he was heading back home, the final nail was hammered into the coffin. the van that usually drove him back and forth had broken down, causing seokmin, his driver and manager to have to stop on the side of a busy street to check on the issue. seokmin, of course, had to stay inside the van and not make his presence known, knowing he'd easily be recognized in the busy street. this was a fact that irritated him too for some reason.
by the end of it, it had taken over an hour to get the problem fixed, and he had no access to his phone to contact you and let you know that he'd be arriving home way later than usual.
that was the moment in which you entered his mind again. the thought of you instantly made him sigh in relief, knowing that soon enough he'd get to fall asleep in your arms and wake up to a better day.
it was 10:47 when he finally arrived back to your shared home, two hours after the usual time in which he'd reunite with you every day. upon walking in he was met with something he had not wanted to deal with after such an stressful day. you were there to greet him as per usual, but did not seem too happy to see him.
you opened your mouth before he could say anything.
"seokmin, what the hell? i called you twelve times. i even asked the members to call you and no response? what was so important that you ignored me all day?", you seemed very frustrated as you said it, clearly oblivious to the terrible day he'd just had.
"baby– "
"you said you'd be here for dinner by 8! what was so important you couldnt even give me a heads up? we rarely ever get to have dinner together. i spent hours cooking and getting ready and you just ditch me, and for what?", you continued to ramble, giving him no space to answer.
now, any other day seokmin wouldve maybe assumed that your outburst mightve been due to you having a bad day of your own. but today he was just too angry. there was no space in his mind for him to rationalize your lack of sympathy to him in this moment. despite knowing there was no way for you to know that his day had sucked, he also reasoned that you were not even giving him a chance to explain himself. this fact on its own finally did him in. you were going to be unreasonable? fine, then he was going to be mean. all frustrations from the day suddenly came together and manifested into the angry words that were about to leave his mouth.
"and– "
"god, can you please shut up?", he suddenly interrupted you with a tone so icy he even surprised himself, but he kept going regardless, "ive had such a horrible day, i dont appreciate coming home to your nagging. do you even care that maybe i had a reason for being late? i dont have to be here at eight on the dot every single night. nor do i have to keep you updated all day. god, please just leave me alone for today. i cant deal with you on top of everything else."
upon finishing his rambles, seokmin was out of breath. he hadnt said much, but the venom behind his words was enough to render him speechless. the moment the words left his mouth he felt the utmost regret. your face had gone from shocked to dejected to simply sad as he spoke. his went from frustrated to angry to regretful. the two of you stared at each other for a few seconds before seokmin tried to go and rectify himself.
"fuck, baby ... im so sorry, i dont know where that came from. i– i didnt mean any of that. i had a horrible day and– "
"is that it? it seemed like something you'd already thought about", it was now your turn to be angry, it seemed.
"no, baby, i swear! i was just trying to ... trying to be mean. i was trying to hurt your feelings. im so sorry. everything went wrong today and i was just so angry all day. i couldnt even call you because i broke my phone. see!", he pulled his phone out to show you, taking the opportunity to get closer to you, "i know its no justification, but i did not mean a single word i said. i love our nightly routine. i love coming home to you every day more than anything. please dont doubt that. i shouldntve taken out my anger on you. it will never happen again. please, please forgive me?", his endless ramble finally came to an end, puppy eyes staring into yours as he hoped you saw the sincerity in them.
halfway through his speech he had managed to make you give into him and let him hold you as he spoke. this simple act made him glad.
"minnie ... im sorry you had a bad day. but you should never speak to me like that. i love you, but i wont tolerate that. if something bothers you, you have to tell me, not blow up on me like– "
"no! nothing about you ever bothers me! i adore absolutely everything about our relationship and our routine. im so sorry. i shouldve told you when i came home that my day had put me in a mood instead of snapping at you like that."
you chuckled, "i cant really blame you. i threw accusations at you the moment you walked in. im sorry. can we call it even?"
"yes, angel. of course. im sorry i spoiled the dinner. wish i couldve seen how pretty you dressed up for me," he pouted at you.
"it's okay, minnie. there's always tomorrow. are you still feeling angry? did your ramble help you at least?", he winced at the mention of the disrespectful words he had just spoken mere minutes ago, but you seemed already unaffected by them.
to be quite honest, seokmin still felt peeved off at his day. from his fall, to his phone, to his members being mean and unreasonable, to then having his car fail and keep him from you, to then finally getting home and picking a fight with you, it was safe to say he was still dissatisfied. he needed something to relieve his stress, but he didnt want to put that onto you again.
"honestly? i still feel frustrated. it was just such a shitty day, i ... i dont know," he sighed, "i kinda feel like breaking something."
"how about me?", you sounded so genuine as you asked.
"huh?"
"yeah. you could use me to destress. right, minnie?", there wasnt even any lust behind your words. he could tell that it was simply you trying to help out your stressed boyfriend.
"d– do you mean be mean to you?"
you nodded, leaning closer to him as you smiled.
"yes, minnie. would that help? taking your frustrations out on me?"
he groaned with no response, choosing instead to pull you into a greedy and wanton kiss.
his hands were immediately rough as they desperately kneaded at every curve in your body, so harsh in their movements he was already sure he'd leave a bruise or two in his wake.
suddenly he pulled away to inquire at you.
"wait, baby. are you sure? i don't want to hurt you."
"you won't. you never would. do your worst, seokmin," and with that, you pulled him back to you to continue kissing.
surprisingly enough, the simple kissing on its own had begun to alleviate his mood a bit. being able to feel your whines as he fondled your body as he saw fit was already making him forget about his shitty day.
it didnt take long for him to drag you to your shared room and throw you on the bed, immediately going to rip your skimpy pajamas off so that he could have a full view of the body he was about to ram into the bed.
"oh, angel. you're so fucking beautiful ... gonna be so fucking mean to you, angel, im sorry," except he wasnt sorry. and both his tone of voice and devilish grin let you know of that fact.
you lay limp for him to take action, something which made him groan internally, knowing you were putting yourself fully at his disposition. he took advantage of this, choosing to undress himself and finally begin to hover over you.
immediately he flipped you around roughly, forcing you onto your elbow and knees as you gasped at the sudden movement. he fondled you some more and made it so you'd arch your back for him as much as physically possible.
he had no need to prepare neither you nor himself, as he was hard the moment you asked him to use you, and you were practically dripping at his rough attitude.
"baby, gonna fuck you now, yeah? let me know if it's too much."
you gave him the green light, leading him to immediately ramming into you with no further warning.
"f– fuck!"
"oh, fuck. feel so fucking good, beautiful. gonna fuck you so good ... gonna atone for every shitty thing that happened today ...", with that he began slamming into you with no mercy, drinking in every single scream you let out. he knew his neighbors might mind, but he didnt care for that right now. all he wanted was for you to crumble under him.
"you're such a good toy for me, angel. my pretty girl, letting me use her– fuck! ... however i see fit."
"m– minnie!"
"i know, beautiful, i know. such a pretty toy ..."
his movements only became harsher as he grew closer and closer to his end. he knew yours was coming too, based on the heightened pitch of your moans and the way you tried to push yourself back on him despite the sheer strength of his thrusts. it was impossible for him not to fall in love with how good you were for him. it was also impossible for him to be actually mean to you, choosing instead to praise you as your orgasm came to be.
"c– cum for me, beautiful. let me fill up your pretty cunt ..."
"yes, minnie! yours, all yours ..."
he didnt need more than that to fill you up, ramming against you one last time as he winced at the loud sound of his hips slamming against your ass. he swore he almost lost consciousness at the inexplicable pleasure he felt from cumming so deep inside you, hearing you slump over due to lack of energy.
your orgasms subsided together, leading seokmin to do quick work of your clean up and settling with you in the still half-messy bed, rushing to hold you in his arms, which was what he'd wanted since leaving home that morning.
"feel better?", you broke the silence.
"yeah, thanks angel," he grinned at you, giving you a quick peck.
"you weren't even mean to me!", you whined.
"it was hard, okay? i love you!"
"yeah, whatever ..."
"say it back!"
"ill think about it."
"baby!", this time he unglued your bodies, hovering over you as he tried to give you his, "you dont be mean!"
you giggled at him, giving in upon his sudden attack of kisses all over your face, "fine! i love you!"
he finally stopped, opting to cuddle into your side once more, "that's what i thought."
a/n: sorry the smut was too short idk how to write seokmin as mean 💔
626 notes · View notes
is-nini · 4 months
Text
Tumblr media
"I have finished doing my duties. Now, it's time to work on my cute wife's pussy"
- Kamisato Ayato
Warning: Small bondage, overstimulation, praise, ayato being extremely patient that he doesn't mind you being wet and messy while he works.
NSFW under the cut
Tumblr media
Ayato is soo fucking mean.
He will always make sure your pussy is sopping wet. Tears running down your face and whimpering begging for forgiveness and he will do it in the most elegant way possible.
While he is working, he will make sure that your leg are spread open in his line of vision, he will set up the most comfortable and spacious sofa that act as a bed on the corner of the room near him just so that he can control you however he like.
"Princess, keep your leg open okay? I'll be busy for the next minute so you will have to be patient" He will stick in a small vibrator, tie the both of your hand up with a silk red ribbon and watch as you unravel the tight knot in your stomach over and over again.
Ayato's rule is if he is busy with work, you have to be busy with something too. So, if he ever get's overwhelmed, he will make sure you are sat on that sofa prettily while waiting for him to finish. If Ayato is busy, then your pussy will be busy too.
You have now ripple out your fourth orgasm. Your brain are fried, your moans are turning into whine's instead because it is so draining. Your vision are blurry, your hand are aching. Your legs? You can't even feel them but the worst part is, Ayato's cock in not inside you.
"Ay-Ayato- hng!" you jolt again when you felt a hand rubbing your thigh. "Shh, I am almost done princess, wait just a bit longer" he hushed you. Despite that, you whine and wiggle around, helplessly trying to gain his attention. "C-Cock-! A-Ayato ah!" You cry out when his hand touches your stomach, pushing it down as a breaking orgasm splurt out of you again.
"Ah did you cum again princess? That is very adorable" he cooed. He did listen to your adorable moans and beg but now is not the time. Afterall, his work is not done yet so you won't be getting his cock until he is done working.
Despite the tightness on his pants, and despite the bulge that you have been eyeing on, he will finish his work first. To him, you are like a present, an award after he finishes his duties as a husband and as the leader of Kamisato Clan.
The sofa has been long soaked, your cream just kept dribling out of you. At this point, you are drooling stupidly all the while occasion whimper of "A-Ayato co-cock!" and a whole lot of "Please" also drips out of your mouth.
When Ayato feels like it's enough, he will pull out the vibrator out of you, letting your pussy rest as he also takes a small break. "Such a cute pussy, clenching around nothing" The smell of your pussy almost gave him the exact determination he need to finish off his work.
When he is finished, you have been reduced to nothing but a dumb wife for him to simply just fuck. "Ahh, finally filling up this hole- Ahh princess your pussy are too eager" he feels your pussy just sucking him in as he enter his cock inside you. At first you have almost no energy left but when his cock entered your body, your back arches and you let out the most sinful moan. "C-Cock! Ah S-Sho ghood" you babble.
He thrust in and out, in and out but faster and faster. Your sopping pussy are eagerly taking him in as if they are also happy to be filled with his warm cock.
Ayato's cock gets just a tad bigger in size as he feels the need to cum. When he cums, he doesn't hold back. All the white and warm semen fills your up. Your tongue are lolled out as he took the chance to suck and kiss your lips, he pulled down your upper clothing and played with your nipple.
As he played woth your nipple, he realize that your pussy are clenching around his cock again which makes him emits a chuckle. "Like your pretty nipple being played princess?" he teases. It's not a real question of course because the answer is very obvious. The way your leg tremble and your breath hitched gave him all the answer he need.
You can still feel his cock hard deep inside you so you know that it is not finish yet when he pulled out and a sudden hard thrust makes your body jolt. "Don't relax yet princess, we still have the whole night" he whisper.
The silk that has been keeping your hands together are unknotting. you hand fell as you look at Ayato with glazed and lustful eye. "Well, I have finished my work. It's time to work on my cute little wife".
Moans and whimper can be through out the room and maybe even the Kamisato hall way, but no one would dare to speak a thing- afterall as long as the leader of the Kamisato is in a good mood, every staff that works around the house seems to do a great job for the day.
314 notes · View notes