Tumgik
Tumblr media Tumblr media Tumblr media Tumblr media
do u think he has a shot
1K notes · View notes
animatic i made in like a hour for fun ft my friend @demelly
679 notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
crumbfestation information!
crumbfestations ref
crumbfestations hero costume
1K notes · View notes
Tumblr media Tumblr media Tumblr media
mithan growing old together and comfortably retiring becuase of all of mias money from the connections
based offa this post
2K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media
circus AU i make with my friends :3
2K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media
my bnha sona with @heraxic jellyfish...
2K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media
im so glad people like crumbfestation! here is his hero costume!
prev post
2K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media
little resident riding hood, where ethan and rose go to collect apples to make a delicious pie for an ill mia, but in the shadows theres something big and bad lurking...
2K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media
it tried to register its quirk as "chat" but they thought it was crazy
bnha sona i made for a thing with friends
5K notes · View notes
Tumblr media Tumblr media
uuuuaaauauaagaahh
1K notes · View notes
Medusaberg first encounter pt3 (final) (cw eye-related gore, thanks miranda)
(pt2:)
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
something something xenia guest rules and handshakes to show you’re unarmed
imagine you get horribly mutated and kidnapped to an inescapable island where the only times you’re not completely isolated is when you’re getting hunted down and attacked by people who see your head as a glorious trophy. imagine begging for them to listen, begging for your life, but they only see it as trickery and weakness. eventually you give up trying to convince them and strike first cause you want to survive. now for the first time in 700 years you meet someone who isn’t taking orders from your abductor or an overconfident fool striving for legendary status. theyre like you but marked for death and old hopes reignite, but your amiability has rusted over from centuries of cruelty.
wouldn’t it be wild if they were the first to listen anyway.
1K notes · View notes
Tumblr media Tumblr media
uagauauaaaagaauagauauga
2K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media
more frames for my animation!
2K notes · View notes
Tumblr media
The past is so overwhelming
1K notes · View notes
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
working on a animation full of many colors! here r some of the snippets of the sequence of ethans life pre RE7
3K notes · View notes
Tumblr media Tumblr media
rewatching mha and drew my old faves
1K notes · View notes
Tumblr media Tumblr media Tumblr media
redraw of a old comic
2K notes · View notes