Wishing you a Magical and Blissful Holiday

Take a leap of faith and begin this wondrous new year by believing. Happy New Year!

Wishing you a Magical and Blissful Holiday

May this Christmas end the year on a cheerful note and make way for a fresh and bright New year. Wishing you a magical and blissful holiday.

Mipo - A Biological Method for Fixation of Complex Fractures of Tibia- Lupine Publishers

Surgery Open access journal| Lupine Publishers

Abstract

Introduction: Management of proximal and distal tibial fractures is challenging because of the complexity of injury, limited muscle coverage and poor vacularity. Surgical management of tibial fractures includes multiple options: external fixation, IM nailing, ORIF and minimally invasive plate osteosynthesis (MIPO). Open reduction and internal fixation with a plate may end in wide dissection and tissue devascularization. Fixation of tibial fractures with MIPO allows protection of soft tissue and blood supply. This is a report of a series of prospectively studied closed proximal and distal tibial fractures treated with MIPO.

Materials and Methods: A total of 20 patients with closed proximal or distal tibial or fractures were enrolled in the study between 2016 and 2017 and completed follow-up. Demographic characteristics, mechanism of injury, time required for union, range of motion and complications were recorded. Eleven patients had proximal tibial fractures and nine had distal tibial fractures. Patients were followed up to 2 and 6 weeks and then at intervals of 4 to 6 weeks until 12 months.

MResults: Mean age of the patients was 39.5 years (range 18-65 years). Thirteen cases were the consequence of high-energy trauma and seven were the result of low-energy trauma. The clinical and radiological outcome were excellent in 13 patients, good in 6 patients and fair in 1 patient. The average time for fracture union was 16.4 weeks, ranging from 16 to 20 weeks. None of our patients developed any complications.

Conclusion: MIPO is a reliable method of management for tibial fractures; it provides a high union rate and good functional outcome with minimal soft tissue problems.

Keywords: Tibial fractures, MIPO, Soft tissue, Locking plate, Osteointegration, Functional outcome, Clinical outcome

Abbreviations: MIPO: Minimally Invasive Plate Osteosynthesis, LCP: Locking Compression Plate

Introduction

Proximal tibial fractures are serious injuries and pose a treatment challenge. They usually result from high energy injuries, damage is usually extensive and open fractures, compartment syndromes, and vessel injuries are frequently related [1-4]. On the other hand, distal tibial fractures are typically the result of combined compressive and shear forces, and may end in instability of the metaphysis, with or without articular depression, and injury to the soft tissue [5]. The aim of fracture treatment is to obtain early fracture union in the most acceptable anatomical position with early and maximum functional return of activity. Conservative management of closed comminuted fractures with cast are associated with complications like prolonged immobilization, deformity, shortening, angulations, joint stiffness etc. Precise reduction by open reduction and internal fixation with conventional plate, frequently lead to complications like non-union, delayed union, infection, implant failure and need for bone grafting [6]. In addition, it also results in significant soft tissue stripping [3,7] The Minimally Invasive Plate Osteosynthesis (MIPO) is a technique which enables indirect reduction and stable fixation with minimal biological footprint and preserving vascular supply at the fracture site [3,8]. The aim of this prospective study was to evaluate clinical results and complications of MIPO in complex tibial fractures.

Materials and Methods

Case 1

Between 2016 and 2017, 20 patients with acute, closed proximal and distal tibial fractures were selected. Among them 11 had proximal tibial fractures and 9 had distal tibial fractures. The exclusion criteria included open fractures, tibial shaft fractures in which intramedullary nailing was done, fractures with neurovascular injury, and pathological fractures. There were 15 males and 5 females who consented to be a part of this study. Fractures were analysed preoperatively using radiographs and CT scans if there was any articular involvement (Figure 1). We prospectively gathered their data. Demographic characteristics, mechanism of injury, time required for union, range of motion and complications were recorded The Locking compression plate which are anatomically pre-contoured were used. Preoperative calculations were done on radiographs to ascertain the size of the plate, accurate size of locking, cortical and cancellous screws after subtraction of the magnification factor. Patients were operated on as soon as they were medically fit. Surgeries were performed under Spinal Anaesthesia. Patients were positioned supine on a radiolucent table. The involved leg was draped and a pneumatic tourniquet applied.

Figure 1:   X-Ray showing the fracture of tibia and fibula at junction of proximal two-third and distal one-third.

An incision of 2 to 3 cm over the proximal aspect of the tibia on the medial or lateral sides was made, according to the fracture site. For distal tibial fractures, a straight incision was made at the level of the medial malleolus or antero-laterally with preservation of the vessels and nerves depending on the fracture site. Fractures were reduced indirectly by a reduction forceps under fluoroscopic guidance and by ligamentotaxis using an external fixator. A sub muscular plane was made with a long hemostat and chisel without causing additional periosteal damage. The locking plate was applied sub muscularly to fix the fracture. The plate was fixed with screws, which were inserted percutaneously through the primary surgical incisions. Reduction and position of the plate was checked under a C-arm (Figure 2). Postoperatively, the limbs were protected using an above knee splint for 2 days. Active and passive range of motion exercises were permitted to avoid knee stiffness and to strengthen the quadriceps. Suture removal was done after 2 weeks and non-weight-bearing walking was allowed for 6 weeks. Partial weight bearing was allowed depending on fracture healing and patient compliance. At week 12, full weight bearing was permitted as tolerated. At each follow up patients was assessed for pain at the fracture site, tenderness, range of movement at knee and ankle, operative scar and radiological union at 6,10,14,18 and 22 weeks. Clinical and radiological assessments based on the criteria laid down by S.J.LAM9 were recorded using a proforma. The criteria are as follows:

Figure 2:   Post-operative AP and Lateral view showing the fracture with implant in situ.

a) Excellent: Range of movement of adjacent joints 80-100 % of normal. No pain in performing daily activities.

b) Good: Range of movement of adjacent joints 60-80% normal. Pain not enough to cause any modification of patient daily routine.

c) Fair: Range of movement of adjacent joints 30-60% normal. Pain enough to cause restriction patients daily activities.

d) Poor: Range of movement of adjacent joints less than 30% of normal. Pain enough to cause severe disability or non union.

Result

A total of 20 enrolled patients completed follow-up for one year and were included in the study; there were 15 males and 5 females. Mean age of the patients was 39.5 years (range 18-65 years). Thirteen cases were the consequence of high-energy trauma and seven were the result of low-energy trauma. Proximal tibial fracture was in eleven cases and distal tibial fractures in nine cases. Majority of the patients were operated within 3 days of injury. On S.J.LAM criteria, 13 patients showed excellent results, 6 patients had good results and 1 patient had fair result. The average time for fracture union was 16.4 weeks, ranging from 16 to 20 weeks (Figure 3). None of our patients developed any complications.

Figure 3:   X- Ray showing radiological union at the fracture site.

Discussion

MIPO allows indirect fracture reduction and percutaneous sub muscular implant placement [3]. The minimal-invasive method agrees in theory to combine the principles of a stable construct to a closed reduction with conservation of the haematoma [10]. Contrast to conventional plates, the locking compression plate (LCP) is anatomically pre-contoured; it does not depend on on friction and provides superior stability. Thus, it reduces the risk of loss of reduction through locking screws secured in the plate. The key aspect that led.com to use locking plates to treat fractures of the tibial shaft was the difficulty we would have faced in controlling the reduction of the proximal or distal fractures with intramedullary nailing. Indirect reduction and subcutaneously applied plates protects soft tissue and periosteal blood supply; hence, MIPO should provide undisturbed union and a low complication rate. In spite of the advantage of well-preserved blood supply, MIPO does not help in reduction. The fragments may not be anatomically reduced and interfragmentary compression may be inadequate, which consequences in delayed union. Barei DP et al. [11] demonstrated that after open reduction and internal fixation, 20% of the cases developed superficial or deep infections in spite of acceptable functional outcome. In this study, all patients had radiological union without any complications. In the present study, early surgical intervention was performed. Majority of patients were operated within 3 days because delay in intervention makes fracture reduction challenging. The time to consolidation reported in our study was to some extent less, when matched to the data known from the literature concerning plating osteosynthesis [4,5]. The average time for fracture union in our series was 16.4 weeks. MIPO decreases postoperative pain and aids early rehabilitation, which improves articular cartilage nutrition and healing. It is cosmetically more acceptable owing to less scar formation [3]. Uniqueness of this study was early mobilization, high mean time to fracture union, which was 16.4 weeks, no complications and majority of the patients having excellent outcome. The current study has some limitations. This is a non-randomized study with no control group. In addition, the sample size was small and the mean follow up was for 12 months. In conclusion, MIPO is a reliable method of treatment for distal tibial fractures; it provides a high union rate and good functional outcome with minimal soft tissue complications.

To know more about surgery open access journal click on https://lupinepublishers.com/surgery-case-studies-journal/index.php

To know more about lupine publishers indexing Journals click on https://lupinepublishers.us/

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Happy Thanksgiving Wishes For Everyone

Lupine Publishers | Should Reactive Oxygen Species (ROS) in Human Body be Controlled with Antioxidant Supplement?

Lupine Publishers | Journal of Food and Nutrition

Abstract

Oxidative stress in human body might cause degenerative disease which is trigger by reactive oxygen species (ROS). Antioxidant in foods or in supplements offers an ability to reduce detrimental effect of ROS and free radicals in human. However, it can only be used to maintain human health rather than to cure disease.

Abbreviations: ROS: Reactive Oxygen Species, RF: Redox Factor, PTP: Protein Tyrosine Phosphatases, ATM: Ataxia-Telangiectasia Mutated, IRP: Iron Regulatory Protein, SH: Sulfihidryl, NOXROS: NADPH Oxidase-Derived ROS

Introduction

Nutraceutical or functional food industry become fastdeveloped industry nowadays. It is likely that consumers not only looking for healthy and nutritious food, but also food with functional benefits to their health. Nutraceutical and functional food products are widely available in the market, for example, isolated nutrients, dietary supplements, herbal products, or processed foods enriched with antioxidants. One benefit that is offered from those products is an antioxidant capacity, which can help reduce the reactive oxygen species in our body.

From the biochemistry perspective, Reactive Oxygen Species (ROS) in the human body can act as double-edged sword. It plays an important role in signalling molecule reaction, but it is also responsible for the oxidative stress that can lead to degenerative disease. This essay will focus on recent studies related to the two faces role of ROS in the human body. This review also will highlight the use of antioxidant supplement in human health.

What is ROS?

Reactive Oxygen Species (ROS) are “a group of small oxygencontaining free radicals that are extremely reactive due to their unpaired valence electron” [1].There are three reactive oxygen species (ROS) form, i.e. superoxide radical, hydrogen peroxide and hydroxyl radical [2]. Reactive Oxygen Species (ROS) can cause oxidation of cells and tissues and they usually unstable, highly reactive, and energized molecule [3]. Moreover, ROS in biological systems can be formed by prooxidative enzyme systems, lipid oxidation, irradiation, inflammation, smoking, air pollutants, and glycoxidation [3].

ROS and Cell Signalling

ROS formation in the human body as a result of natural consequences of aerobic metabolism. In normal conditions, ROS can act as immune system modulation and can activate various signal transduction pathways[2]. Figure 1 showed the critical function of ROS in human metabolism. For example, PI3 kinase and Protein Tyrosine Phosphatases (PTP) play an important role in cells proliferation and survival to growth, hormone and cytokine stimulation; Redox Factor 1 (Rf1) and Nrf-2 responsible for the antioxidant and anti-inflammation regulation; Iron Regulatory Protein (IRP) can affect the iron homeostatis, and Ataxia-Telangiectasia Mutated (ATM) can regulate the DNA damage response. Additionally, ROS can influence a number of growth factors such as angiotensin in smooth muscle growth [4]. NADPH Oxidase-Derived ROS (noxROS) can kill foreign organism as part of the immune defense system in a low and intermediate concentration [1].

Figure 1:   Cellular signaling pathways regulated by ROS Source: Ray [8].

ROS and Diseases

ROS in the human body can cause detrimental effects such as alteration of membrane organization and functional loss of protein, enzymes and DNA, which eventually lead to various diseases and accelerated aging [5]. For instance, 8-hydroxydeoxuguanosine can oxidize DNA, protein oxidation might cause carbonyl modifications and loss of Sulfihidryl (SH) group from protein, ratio of redox couples such as glutathione: oxidized glutathione, NADPH:NADP+, and NADH:NAD+ will tend to shift to a more pro-oxidant value. It seems that the oxidation process is depending on age. Overload oxidative stress and abundant amounts of lipid peroxidation products can produce toxic and cause detrimental effects to biomolecules and generate pathogenesis oxidative stress-related disease such as, atherosclerosis, vasospasms, cancers, trauma, stroke, asthma, hyperoxia, arthritis, heart attack, age pigments, dermatitis, cataractogenesis, retinal damage, hepatitis, liver injury, and periondontis (Figure 2).

Figure 2:   Figure 2: Clinical conditions involving reactive oxygen species. Source: Lee [3].

<

ROS and Antioxidant

Antioxidant levels are important in promoting health [6]. Antioxidant nutraceutical with 3 to 5 servings from vegetable group and 2 to 4 servings from the fruit group (USDA/CNPP 2000) can lessen the harmful effect of ROS and free radicals; thus, it might slow the aging process [3]. However, the used of antioxidant supplement in human is much more complicated than the simple reaction of free radical scavengers. Naturally, cells are equipped with antioxidant enzymes i.e superoxide dismutase, catalase, glutathione peroxidase, glutathione disulfide reductase, glutathione-stransferase, methionine sulfoxide reductase, and peroxidase[7]. It is likely that the used dietary antioxidant supplementation might disturb the mechanism of other natural antioxidants in cell. Furthermore Lee et al. [3] reported that an antioxidant can prevent lipid oxidation if the reduction potential of a free radical scavenger is lower than a reduction of potential PUFA (600mV). For instance, ascorbic acid (vitamin C) and tocopherol (vitamin E) which have lower standard 1-electron potential (282 and 480 mV, respectively) than PUFA 600 mV, can donate a hydrogen atom to peroxyl radicals of PUFA before PUFA does it. Likewise, Hensley et al. [6] noted that the concentration of α-tocopherol by 50 to 1000mg/ day can give advantages to human; although, it has not shown on epidemiological statistics. Apparently, natural antioxidants are not sufficient to control the oxidative stress in the human body that is why antioxidant supplement can only be used to enhance the cellular antioxidant capacity. Nevertheless, at some point antioxidants supplements might be unfavorable since they could diminish the adaptive signals of ROS. Chen & Niki [5] suggested that to utilize the lipid peroxidation products so that it can have beneficial effects. They proposed that the time, amount and site of their formation should be well-controlled and programmed [5]. Thereby, the used of exogenous antioxidant should be based on the bioavailability of the products. “Bioavailability can be defined as the amount of the percentage of an ingested nutrient that is absorbed and thus available to the body for metabolic use” [3].

Conclusion

In conclusion, it seems that antioxidant supplements can be used to control reactive oxygen species in human body. This essay shows that despite the fact that reactive oxygen species can initiate cell signalling, it might be endangered human life if it available in exceeds amount. Future research into the relation between each disease with reactive oxygen mechanism and the use of antioxidant to control reactive oxygen species in human body should be performed widely. It is proposed that antioxidant supplement should be considered as an aid to maintain a health. However, the lifestyle and eating behavior is highly important factor in reducing the oxidative stress which related to reactive oxygen species. Eating fruits, vegetables, spices, herbs and beverages such as wine, tea and coffee might balance oxygen reactive species in the body. Ultimately, since it is related to human life extension, antioxidant supplement should be considered as an appropriate food supplement.

For more Lupine Publishers Open Access Journals Please visit our website: http://lupinepublishers.us/ For more journal of food technology articles Please Click Here: https://lupinepublishers.com/food-and-nutri-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Lupine Publishers | Induction of Systemic Acquired Resistance in Papaya by Foliar Application of HrpN Recombinant Protein for Increased Resistance against Papaya Dieback Pathogen

Lupine Publishers | Agriculture Open Access Journal

Abstract

Plants are continuously exposed to undesirable pest and pathogen threats. In response, plants have developed numerous mechanisms to protect themselves against the pathogens. Systemic acquired resistance (SAR) is an inducible disease resistance response in plant species. It is found in a large range of plant species including papaya and characterized by broad spectrum disease control and an associated coordinated expression of a set of pathogenesis related (PR) genes and proteins which are also known as SAR markers. Expression and purification of HrpN from Erwinia mallotivora, the causal agent of papaya dieback, was carried out. In this report, HrpN recombinant protein was tested and characterized for its effect and potential as elicitor that can increase papaya defence against E. mallotivora through the activation of SAR mechanism. Based on disease severity analysis, control plants which were untreated, showed faster disease infection rate and severity when compared to the recombinant protein treated plants. Increased resistance towards the papaya dieback pathogen was shown to be associated with increased expression of selected plant defined genes using quantitative Real Time analysis which were observed after the papaya was sprayed with the recombinant HrpN protein. Based on physiological and molecular analysis, the selected protein has induced SAR; increased selected SAR associated defence gene expression and increased the papaya resistance against the papaya dieback pathogen.

Keywords: Systemic acquired resistance; Recombinant protein; Erwinia mallotivora

Abbreviations: SAR: Systemic Acquired Resistance; E. mallotivora: Erwinia mallotivora; SA: Salicylic Acid; Hrp: Hairpin Proteins; PR: Pathogenesis-Related; MTI: MAMP-triggered immunity; ETI: effector-triggered immunity; SA: salicylic acid; BTH: Benzo Thiodiazole

Core Ideas

a) HrpN recombinant protein was tested and characterized for its effect and potential as elicitor that can increase papaya defence against E. mallotivora through the activation of SAR mechanism.

b) Increased selected SAR associated defence gene expression and increased papaya resistance against the papaya dieback pathogen observed.

Introduction

Papaya is a popular and commercially available fruit in the tropical and subtropical regions. It is highly known not only for its nutritious quality but also for its medicinal functions [1]. During its prime time, Eksotika, Sekaki and Solo were the Malaysia’s flagship varieties for export with an export value of about RM100–120 million per year, a total volume of 58,149 mt which accounted for 21% of the global trade in 2004 [2,3]. Papaya dieback disease caused by Erwinia mallotivora is the main cause for the rapid decline of Malaysian papaya production, amounting to 60% decrease in papaya production [4,5]. When attacked by pathogen, plants defend themselves through activation of plant defence mechanism which includes oxidative burst of cells, alteration in cell wall composition and de-novo synthesis of compounds like phytoalexin and elevated expression of pathogenesis-related (PR) proteins. The plant defence mechanisms include MAMP-triggered immunity (MTI), effectortriggered immunity (ETI) and systemic acquired resistance (SAR) signify different layers of active plant defence strategy [6]. Plants also have the ability to activate quantitative protection against extensive spectrum of microorganisms upon inoculation with a pathogen, exogenous application of proteins from microorganism or through application of chemicals [7].

The elevated resistance of the whole plant is known as SAR which is an inducible defence response present in a wide range of plant species including papaya [8]. Systemic plant resistance or Systemic acquired resistance involves a salicylic acid (SA)-mediated pathway of defence reactions within the plant [9,10]. During activation of SAR, induced plants showed an earlier boost of exogenous salicylic acid and activation of pathogenesis- related (PR) protein genes [11,12]. Production of PR genes/proteins can lead to increased resistance against pathogen attack [13,14]. Initiation and activation of PR proteins cascade can be produced by exposing the plant to a virulent, avirulent, and nonpathogenic microbe, or molecules with low molecular weight and sometimes volatile molecules such as salicylic acid and jasmonate [15- 17]. The inductions of SAR by using external inducers have been investigated in the past in plants such as tobacco [18] and Arabidopsis thaliana [19]. Incitation of defence reaction occurs not just at the establishment of pathogen recognition but additionally in distal regions of the plant and can last for weeks upon induction [20]. SAR is an effective innate immune response that offers protection against certain infection of pathogens. SAR may also be introduced by treating plants with salicylic acid (SA) and SA analogues; 2,6- dichloroisonicotinic acidity (INA) and benzothiodiazole (BTH) [21-23].

Phytopathogens are known to secrete proteins and virulence factors collectively known as effectors that are essential for pathogenesis and colonization of their host plants [24]. Pathogenicity of E. mallotivora depends on these effectors, which control the pathogen ability to cause disease and to elicit specific defence responses in papaya plants [25]. Erwinia mallotivora genome was already sequenced and bioinformatics tools were utilised to predict genes that potentially encode virulence factors and toxins along with other molecules that promote pathogenesis [26]. Like many other plant pathogenic bacteria, E. mallotivora contains type III secretion system (T3SS) that delivers effectors proteins into host plant. The T3SS apparatus is a key virulence determinant in many Gram-negative plant bacteria. Due to its importance, a lot of studies have been conducted to disable or block the function of T3SS by targeting known T3SS processes [27]. This could serve as a method to control plant microbial-associated diseases.

Effector proteins as virulence factors are known to suppress diverse signalling pathways required for plant innate immunity [28]. Apart from being effectors, some effectors proteins, known as hairpins, have been revealed to elicit plant defence and SAR responses [29]. Type III secreted hairpins are glycine-rich and also heat-stable proteins that are secreted from Gram-negative plantpathogenic bacteria. The hairpin proteins have been proven to elicit defence response and activate SAR for increased disease tolerance against diverse plant pathogens [23]. In selected cases, during fungial, oomycetal or plant pathogen attack, increased defence responses without the symptom exhibited by hypersensitive response cell death were recorded in plants treated with foliar application of hairpins proteins or genetically modified plants that constitutively expressed hairpins genes. This was observed in Arabidopsis after spray treatment with E. amylovora HrpN [30]. Activation of activated SAR in the plant conferred disease resistance to Hyaloperonospora sp. and Pseudomonas syringae pv. Tomato and in addition stimulated the expression of the pathogenesis-related (PR) 1 genes [31].

Another successful research finding includes reduced diseases caused by Phytophthora infestans and Botrytis cinerea in tomato through application of HrpN hairpin proteins [32]. Rice sprayed with Hpa1, another type of Hrp protein also showed strong resistance to X. oryzae pv. oryzae and Magnaporthe grisea [33]. Past studies have implied SAR strategy as another useful approach for controlling plant diseases through the activation of host plant defences by application of various agents or external inducers. Thus, this research aims to assess application of selected recombinant hairpin protein from the papaya dieback pathogen for SAR activation as an alternative new strategy to control papaya dieback disease. In an effort to develop recombinant proteins as potential SAR inducer, cloning and expression of HrpN from E mallotivora was carried out in a bacterial system. Our study is carried out to evaluate the effectiveness of HrpN recombinant protein in inducing Systemic Acquired Resistance (SAR) in papaya for enhanced disease resistance to papaya dieback pathogen.

Materials and Methods

Bacterial strains and growth conditions

Escherichia coli strains, Top10 (Invitrogen,USA) and BL21, were cultivated and grown in LB medium at 37°C respectively. Antibiotic ampicillin (Amp) was used at the concentration of 50μg/ml where required. Erwinia mallotivora was grown in LB broth at 28 °C.

Recombinant protein cloning, expression and purification

The HrpN gene was isolated from Erwinia mallotovora. Sets of primers, termed HrpN forward (ATGAGTCTGAATACGAGTCC) and reverse (GCCGCGTCAGTTTGCTTCGT) was designed to incorporate selected restriction enzymes sites to facilitate the cloning processes. Erwinia mallotivora DNA was isolated from E. mallotivora grown in LB broth at 28°C overnight using bacterial genomic extraction kit (Sigma Aldrich). Genomic extractions were carried out according to the manufacturer’s instruction. The polymerase chain reaction (PCR) was performed using the E. mallotivora DNA as the template and specific primers that target the HrpN region. Cycle parameters for PCR included an initial incubation time of 3 min at 95°C, 30 cycles of 30 sec at 94°C, 1 min at 55°C for annealing and 1 min at 72°C for extension, and followed by final elongation for 10 min at 72°C. The PCR products were visualised by agarose gel electrophoresis, gel-purified and cloned into pGEMT (Promega) according to the manufacturer’s instruction. Transformed cells were plated out on the LB plate supplemented with 100g/ml ampicillin and 20g/ ml X-gal to allow blue and white colonies selection. The gene was then subjected to sub clone into Pet-20b expression vector and transformed into BL21 E. coli expression strain. For expression of HrpN, the PET-20b/HrpN transformed bacteria were selected on LB agar plates containing 100g/ml ampicillin. A single colony of the transformed bacteria was inoculated in 5.0ml LB medium containing appropriate antibiotic for overnight cultivation at 37°C.

Aliquots of the culture were inoculated into 50ml LB medium with 50g/ml ampicillin at 37°C until the OD600 reached 0.5. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM to induce the expression. The expression was carried out for six hours at 37°C and the bacteria were harvested afterwards by centrifugation at 2500g for 15 minutes. The bacterial pellet was resuspended in 20mM Tris-HCl, pH 8.0, and lysed with a sonicator or treated with Bugbuster reagent (Novogen). For confirmation analysis, lysate, soluble and insoluble fractions (pellet) from each expression were analysed by SDSPAGE and Western Blotting using specific anti-His antibody. For large scale purification, the expressed HrpN cells were treated with Bugbuster reagent (Novogen) to be lysed then purified using Ni-NTA column (His tag protein purification) via the Acta Prime Chromatography System. The purified proteins were quantified using Bradford protein assay and also analyzed by SDS PAGE followed by Coomassie Brilliant Blue Staining. For Western Blot analysis, 20μg of protein from each samples were separated by 10% SDS PAGE and transferred to PVDF membrane before being probed using anti-His antibody with gentle agitation for 2h and further incubated for 2h with anti-mouse IgG alkaline phosphatase conjugate. The membrane was washed, added with the substrate solution (BCIP/NBT) and incubated until the bands appeared.

Plant Growth

Carica papaya (Eksotika I) seeds were germinated in small polystyrene cups containing potting soil. In addition to these, two months old papaya seedlings were obtained from MARDI Pontian. Johor, Malaysia. Soil rich in organic matter and nutrients with a mix of compost was used. Fertilisation and watering were conducted accordingly. The plants were continued to be grown in the greenhouse at the MARDI glasshouse house complex under glasshouse conditions.

Recombinant protein application and pathogen inoculation

A set of formulation treatments and controls were tested for their effectiveness in inducing SAR and protecting the plants against papaya dieback disease. Protein inducer treatments were carried out in 4-6 months old papaya seedling using foliar spray application solution for each seedling for three times at one week interval. Each seedling was inoculated (at the first three nodes) with 10ml of pathogen (E. mallotivora) at the concentration of 1x106 cfu one week after the third inducer treatments. Water treated plants were included as control.

Symptom evaluation

After treatments with recombinant protein and the pathogen inoculation, effects of the pathogen inoculation were evaluated through disease severity (DS) statistical analysis. After treatments with salicylic acid (SA), effects of the pathogen inoculation were evaluated for disease severity. For disease severity, index 5 (on 1 to 5 scales) on each plant was recorded according to stem blackening and the mean value was calculated. For evaluation of stem blackening, they were recorded according to the scale of 0=symptomless, 1=leaf vein blackening, 2=leaf vein blackening and slightly wilting, 3=leaf stalk wilting, 4=stem blackening and 5=plant died. Data was analysed using analysis of variance (ANOVA) followed by comparison of means using Duncan multiple range test (DMRT) [34].

Tissue collection, RNA extraction and pathogenesis-related gene analysis via RT qPCR

For molecular analysis, leaves were collected on day 20 after the first recombinant HrpN foliar application, frozen in liquid nitrogen, and stored at -80°C until further analysis. Leaf tissue was grounded to a fine powder, and RNA was extracted using GeneJet (Thermo Scientific) kit following the manufacturer’s instruction. For qPCR, 2ug of RNA was DNAse- treated to remove genomic DNA contamination and the transcripts were converted into cDNA using Biorad Reverse Transcription in accordance with the manufacturer’s protocol. The resulting cDNA was used as the template for qPCR using primers designed based on known pathogenesis-related proteins in papaya [35]. Two housekeeping genes-actin and 40SRNP-were used as the reference genes for normalization of the expression fold. SensiFast SYBR Hi-ROX kit (Bioline, USA) was used for the RT-qPCR following the manufacturer’s protocol. The experiment was carried out using Bio-RAD CFX96 real-time PCR system (Bio-Rad,USA ). The expression profiling graph was plotted using the Bio-RAD CFX96 Manager software (Bio-Rad, USA).

Results and Discussion

Cloning, expression and purification of selected recombinant protein

In this report, we attempted to look for the after-effect of foliar spraying of a T3SS protein termed HrpN from E. mallotivora, the causal agent of papaya dieback disease in Malaysia. The likelihood of activation of disease resistance mechanism via SAR against the pathogen in papaya was investigated. Formerly, Peng [36] showed that hpa1 gene of Xanthomonus oryzae pv. oryzae enhanced defence responses to diverse pathogens in tobacco. For this study, cloning of HrpN from E. mallotivora was carried out to produce recombinant HrpN. In an effort to develop a bacterial expression system for selected HrpN from E. mallotivora, gene encoding HrpN was inserted into the pET-20b(+) bacterial expression vector from Novagen. Based on the restriction enzyme digestion and sequencing analysis, we have successfully cloned HrpN gene into pET-20b(+) expression vector. Expression of the HrpN gene in pET-20b expression vector was induced in the presence of isopropyl-beta- D-thiogalactopyranoside (IPTG). The proteins of the uninduced lysates, induced lysates, the soluble fraction and the insoluble fraction were analyzed using SDS–PAGE, stained with Coomassie Blue and Western Blot analysis. The molecular weight of the expressed proteins was equivalent to the predicted molecular weight of the HrpN which was estimated to be approximately 30kDa.

Recombinant HrpN proteins were expressed as fusion proteins with an N-terminal His tag, enabling affinity purification of proteins using Nickel NTA column. To obtain larger amount of expressed HrpN, the expression was carried out in large scale (2 litre cultures) and purified 35kDa 25kDa using the Ni-NTA affinity column via Acta Prime Chromatography System. After purification, the major contaminating bands and impurities were eliminated during the affinity chromatography process. 20ug of proteins from each fraction were analyzed using SDS–PAGE, stained with Coomassie Blue and Western Blot using the anti-His antibody. Figure 1 shows the chromatogram of elution fractions of HrpN using Ni-NTA column. The fractions containing the intended HrpN recombinant proteins were either freeze-dried or stored at -80ºC for further usage. Approximately 50-100mg of pure recombinant protein was normally obtained from every 2 litre cultures of LBBroth expression culture, induced with 0.5mM IPTG, 37°C for 2 hours. The amount of pure HrpN protein was sufficient for the foliar application treatment of papaya seedlings to determine the effect of SAR inducement for increased tolerance to papaya dieback disease.

Figure 1:  SDS PAGE (a) and Western Blot (b) analysis of recombinant HrpN proteins obtained through large scale expression after purification via inclusion bodies prep and Ni- NTA affinity column.(M: Protein ladder, F1-F8 : Fractions collected after Ni-NTA affinity column).

Recombinant protein treatments and pathogen inoculation/ pathogen infection assay for SAR assessment

The HrpN recombinant protein was tested to evaluate its effectiveness in inducing SAR in papaya for elevated disease resistance response and to suppress the development of papaya dieback disease. The experiment consisted of 10 replicates for each treatment and control, and was conducted at MARDI’s Biotechnology & Nanotechnology infection house using 4 monthold papaya seedlings arranged in Randomized Completely Block Design (RCBD) with two control treatments. Tap water was used to water the plants daily. Standard fertilisation and pest control programs were applied for plant maintenance. Protein inducer treatments were carried out using foliar spray application solution for each seedling for three times at one week interval. Water treated plants were included as control. The effect of HrpN protein treatment on plant vigour was assessed beforehand for two months. However, no differences in plant height, stem diameter and root mass were observed between control and HrpN- treated plants indicating there was no effect of the treatments on the plant health. To assess the protein ability to increase papaya tolerance against the papaya dieback pathogen, inoculation of ~1x 108 E. mallativora was carried out on the treated seedlings three week after the first foliar spraying for the response to disease symptoms and inducer treatments. Disease development was supervised based on quantitative assessment by assessing percentage of Disease Severity (%DS). Disease severity treatment were computed based on the formulation below using the disease symptoms scoring of 0=symptomless, 1=leaf vein blackening, 2=leaf vein blackening and slightly wilting, 3=leaf stalk wilting, 4=stem blackening and 5=plant died. The disease severity index (DSI) was computed according to the formula described by Campbell and Madden [37] and Kim [34].

Where,

DSI=Disease Severity Index

Σab=Sum of the product of assessed plants with their corresponding score scale

N=Total number of assessed plants K=Highest score scale.

Three to four days after pathogen challenge, papaya dieback disease symptom was visually rated by assessing the percentage of disease progress for the disease severity assay until 25 days post infection. In general, the HrpN formulation showed a reduced degree of symptom compared to the water control in two repeated trials. Results presented here demonstrated that the formulation increased disease tolerance to papaya dieback as previously demonstrated. The disease severity assay (DS) measure was used to indicate the effectiveness of treatments in suppressing the disease. The disease symptom was shown to develop much slower in the seedlings treated papaya plants compared to positive control treatment. Both treated and control plants started showing the stage 1 symptoms of papaya dieback disease approximately on day 4. However, the disease severity percentages were observed more on control plants when compared to treated plants. Subsequently, the severities of disease in control plants increased rapidly with 70% severity on day 14 and continue to rise until day 24 where all controls were observed to succumb to the pathogen infection. Interestingly reverse effect was observed in treated plants. Although plants in both groups exhibited the stage 1 symptom approximately on the same day post infection, the disease severities were shown to decrease in treated plants post infection with the bacterial dieback pathogen. Although initial disease symptom of brown discoloration was observed at early days post infection, all of the leaves in treated plants that showed the early symptoms started to drop between day 6 to day 10 post infection, and new shoot continued to be produced. These resulted in the decreased of severity in treated plants as shown in Figure 2.

Figure 2:  Disease severity analysis for assessment of recombinant HrpN as SAR inducer.

The analysis of the disease severity demonstrated that the treated papaya plants showed significantly lower disease severity compared with positive control treatments. Based on statistical analysis, there was highly significant relationship between control and the HrpN-treated plants. The obtained result clearly revealed that the HrpN was effective in increasing resistance against papaya dieback pathogen. The use of hairpin proteins from pathogen has been shown to increase the host against the intended pathogen. Choi [38] reported enhanced disease resistance to both X. oryzae pv. oryzae and Magnaporthe grisea in rice and Arabidopsis plants that were highly expressed with hpa1 gene. An elicitor, pemG1, a hairpin gene which was isolated from M. grisea was also shown to increase disease resistance in transgenic rice containing the hairpin gene. The expression of defence related phenylalanine ammonia-lyase genes were also observed [8]. Similarly, the HrpN formulation showed promising results in inducing SAR in papaya after the papaya seedlings were applied with the protein. The development of the disease symptoms was much slower when compared to positive control treatment. The result suggests that application of SAR inducers certainly has the potential to suppress the development of papaya dieback disease.

Real Time qPCR validation analysis

Analysis of defence mechanism can provide valuable details for papaya dieback disease management strategies. This will offer valuable information for the development of durable, economical, and broad spectrum management approach for the disease. Accordingly, to determine the effect of the formulations on the expression of selected papaya defence genes expression, leaves from papayas that were applied with formulations and control plants were taken from each treatment and control replicates. Each sample has at least three biological replicates representing different individual trees. All samples were ground and stored in -80°C freezer. RNA extraction method was carried out using Plant RNA extraction kit (Thermo Scientific) following the manufacturer’s instruction. Through this method, RNAs extracted were shown to be intact and had a high concentration (Figure 3). The RNAs obtained were transcribed and used for Real Time PCR analysis. Previously, Norliza [35] showed that several pathogenesis related genes which include PR-1b, PR 1, PR1d and NPR1 have the potential to be used as SAR markers due to the increasing levels of genes expression levels few days post treatment with known SAR inducers. These genes were used to investigate the plant defence response after application with the inducers.

Figure 3:  RNA obtained from treated and control plants for validation with SAR markers via Real Time PCR. C1-C3 are control untreated plants while T1-T3 are plants treated with HrpN recombinant proteins.

Figure 4:  Normalized fold expression of PR1d and NPR1 in control plant (non-treated) and recombinant HrpN protein treated papaya leaf tissues.

The expression profile of two defence genes, PR1d and NPR1 that were correlated with SAR inducements in papaya in control plant (non-treated) and recombinant HrpN protein treated papaya leaves tissues was conducted with Actin and 40snp used as the reference gene for normalisation [39,40]. As shown in Figure 4, the normalised fold expression of recombinant HrpN treated papaya leaves tissues were higher than the expression in control plant tissues. By using ΔΔCT method, the increased in expression fold of ~10 to ~20 of PR1d gene in papaya plants treated with HrpN recombinant proteins in comparison of each control were observed. Seemingly, the fold increased expression of NPR1 gene was also observed in plants treated with HrpN recombinant proteins in comparison of each control with fold changes around 3-5 fold (Figure 4). Salicylic acid (SA) is a vital hormone in plant immunity and NPR1 is a gene that is triggered by SA. NPR1 is known to be involved in the SAR activation for the regulation of plant defence genes. NPR1 has been shown to induce pathogenesis related (PR) proteins after pathogen attack such as by bacteria and fungi [41]. NPR1 which contains conserved ankyrin repeat domain, a broad complex, tramtrack, and bric-à-brac/poxvirus and zinc finger (BTB/POZ) domain is the master regulator of salicylic acid mediated responses. In Arabidopsis, NPR1 was shown to control the beginning of SAR and other immune signaling pathways for basal defence and mediating crosstalk between SA along with other phytohormones. During genetic screens for mutants defective in SA responses; mutants with defects in NPR1 failed to resolve various SAR-inducing treatments, displaying little expression of pathogenesis related (PR) genes and exhibiting elevated the likelihood of infections [42,43].

Interestingly, NPR1 shares similar structural features with mammalian immune cofactor IκB, that engages in crucial roles in inflammation, immunity, cell proliferation, differentiation, and survival [44]. Norliza [40] showed that a set of PR defence related proteins were not significantly expressed in E. mallotivora infected plants through iTRAQ and quantitative Real Time PCR. These data indicated that the expression of the selected PR genes were not high enough to protect the papaya from the pathogen attack. However, upon application of recombinant HrpN, the expression fold of PR1d genes was increased to ~10 to ~20 in three different treated plants. SAR marker gene pathogenesis-related gene 1 (PR1) which was isolated from Brassica juncea and named as BjPR1 also demonstrated elevated expression in leaves of B. juncea after Alternaria brassicae infection via Quantitative real-time PCR (qRT-PCR) analysis. Furthermore, BjPR1 gene was shown to be strongly induced following SA treatments, suggesting its roles in SAR mediated plant defence [45]. From the quantitative Real Time PCR analysis, it was suggested that the application of recombinant HrpN increased the plant defence related gene expression that are related to the SAR. Furthermore, the expression pattern of the selected genes has the potential to be used in the development of molecular markers for the identification of resistant cultivars or donor varieties for molecular breeding of papaya for increased tolerance or resistance against the papaya dieback pathogen [46].

Conclusion

Erwinia mallotivora HrpN was successfully cloned and expressed in the E. coli system. Foliar application of the HrpN recombinant protein was tested to evaluate its effectiveness in inducing SAR in papaya for enhanced disease resistance to papaya dieback pathogen. Phenotypic data was taken to see if there was any effect of the recombinant protein to the papaya plants. It was concluded that recombinant protein is safe to be used as SAR chemical inducer. Control plants, which were untreated, showed faster disease infection rate when compared to treated plants as shown by the disease severity assay. It can be concluded that for positive SAR inducement, recombinant HrpN is sufficient to enhance the defence system of papaya to combat papaya dieback disease.

https://lupinepublishers.com/agriculture-journal/pdf/CIACR.MS.ID.000136.pdf

For more Agriculture Open Access Journal articles Please Click Here: https://www.lupinepublishers.com/agriculture-journal/

To Know More About Open Access Publishers Please Click on Lupine publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers

Lupine Publishers | Critical Analysis of the Definition of the Meter

Lupine Publishers | Journal of Forensic Sciences

Abstract

Defining the meter is an inavoidable step towards identifying the nature and properties of physical space. It turns out that the international definition of the meter raises some questionings, partly because of the vagueness and the inconsistency of the wordings.

Introduction

The Concept of Length

Given that length is a concept, we do not measure the length of an object, but we measure what separates its ends: the result of the measurement is called length of the object .

Origin of The Meter

The definition of the length unit is the object of an impressive diachrony, as it is testified in the Manuel des Poids et Mesures published by A. Tarbé in 1840.

The uniformity of weight and measures was wished since a long time. This whish of Charlemagne, Philippe-le-Long (1321), Louis XI, François I (1540), Henri II (1557), Henri III (1575) and Louis XV (1766) had found insurmountable obstacles, owing to provincial prejudices and mainly local habits. However, there are only few abuses as much inconvenient as the diversity of measures, because it introduces uncertainty and mistrust…

The Académie des Sciences has been mandated by the constituent assembly (France, 1789-1791) for determining the weights and measures units. The Academy used the quarter of the terrestrial meridian between the equator and the north pole for basis of the metric system […] the length of the quarter of the meridian was approximately 5,132,430 toises; and the ten millionth part of this arc was almost exactly equal to 3 feet 11 lines 44/100. The impatience to decide, pushed to decree that this would be the size of the provisional meter (Law of August First 1793).

The diachrony was not caused by time; instead, it was led by tenacious searchers.

A First Definition of The Meter

The law of 18 Germinal an III (April seventh 1795) stated:

Art. 2. There will have only one standard for Weights and Measures There will have only one standard for Weights and Measurements for the enter Republic; it will be a platinum rule on which will be inscribed the meter, which has been adopted as the fundamental unit for the whole system of measurements […] it will be registred at the legislature […].

Art. 3. A model in accordance with the reference prototype will be sent in each district capital […].

Art. 5. One will name: meter, the length measure equal to the ten-millionth part of the meridian arc between the north pole and the equator (Tarbé, p. 368).

The Law of 19 frimaire an VIII (December tenth 1799) retained the final value of the meter at 3 feet 11 lines 296 thousandths (Tarbé, p. 15). We can draft a first definition of the meter from these data: The meter is a concept which corresponds to the ten millionth part of the quarter of the meridian.

Proposal for a Speed Unit

In 1983, the Conférence Générale des poids et Mesures decided:

La vitesse de la lumière dans le vide c est égale à exactement 299.792.458 mètres par seconde .

The speed of light in the vacuum c is exactly 299,792, 458 meters per second.

The speed of ligth c is a fundamental constant which is currently expressed in meter per second, m s -1. We could replace m s-1 by cel, as international unit of celerity. Then the speed of light would read : c = 299,792s,458 cel.

Definition of the meter

The same Conference of 1983 gave the meter a new definition: Le mètre est la longueur du trajet parcourue dans le vide par la lumière pendant une durée de 1/299.792.458e de seconde.

The meter is the length travelled in the vacuum by the light during a duration of 1/299,792,458th of second.

This definition is questionable for three reasons :

a) In 1983, the words meter , length , duration and second had no consistent scientific definitions.

b) Use the meter to define the speed of light, then in the wake, use the speed of light to define the meter , is a truism There will have only one standard for Weights and Measurements for the enter Republic; it will be a platinum rule on which will be inscribed the meter, which has been adopted as the fundamental unit for the whole system of measurements […]it will be registred at the legislature […].

If we refer to definitions of time and space1, it’s a nonsense: Time is a concept corresponding to what separates two states of a system. Space is a concept corresponding to what separates two systems. According to these definitions, there is no relation between time and space. In 2011, the Conférence Générale des Poids et Mesures declared: Le mètre, symbole m, est l’unité de longueur ; son amplitude est déterminée en fixant la valeur numérique de la vitesse de la lumière dans le vide à exactement 299.792.458 lorsqu’elle est exprimée en unités SI m s-1.The meter, symbol m, is the length unit; it’s amplitude is determined by setting the numerical value of the speed of the light in the vacuum at exactly 299,792,458 when it’s expressed in m s-1 SI units. This definitions does not add any substantial information to the definition of 1983; space is still depending on time.The frequency of cesium is a constant of nature, une constante de la nature CGPM [1]; hence, the meter can be defined compared to the wavelenth of cesium, which is a fundamental constant : l = c/u = (299,792, 458 cel / (9,192,631,770 Hertz). cel/Hertz has the dimension of the international length unit, which is called meter : l = 0, 032612256 m. Therefore, 1m = 30, 663319 l. The meter is equal to 30, 663319 times the wave length of More serious, the wording makes the meter dependant on the second ; with an obvious consequence : space is forced to depend on time. If we refer to our definitions of time and space, it’s a nonsense:

Time is a concept corresponding to what separates two states of a system .

Space is a concept corresponding to what separates two systems .

According to these definitions, there is no relation between time and space.

In 2011, the Conférence Générale des Poids et Mesures declared:

Le mètre, symbole m, est l’unité de longueur; son amplitude est déterminée en fixant la valeur numérique de la vitesse de la lumière dans le vide à exactement 299.792.458 lorsqu’elle est exprimée en unités SI m s-1.

The meter, symbol m, is the lengthunit ; it’s amplitude is determined by setting the numerical value of the speed of the light in the vacuum at exactly 299,792,458when it’s expressed in m s-1SI units .

This definitions does not add any substantial information to the definition of 1983 ; spaceis still depending on time.

Next Paragraph “The frequency of cesium is a constant of nature, uneconstante de la nature (cf.CGPM – 2011) ; hence, the meter can be = c/ndefined compared to the wavelenth of cesium, which is nota fundamental constant :

= (299,792,458 cel / (9,192,631,770 Hertz)

cel/Hertz has the dimension of the international length unit, which is called meter :l# 0, 032612256 m.

Therefore, 1m # 30, 663319 l

The meter is approximatelyequal to 30, 663319 times the wavelength of cesium.

The Metric System

The law of July fourth 1837 made the metric system mandatory from January first 1840, in replacement of the traditional measures Tarbé [2].

Shortly before the end of World War II, an International Economic Conference was held between the 1st and the 10th of November 1944 in Rye in New York State: among various issues, it advocated the universal adoption of the metric system Céré [3] 6th part.

It is remarkable that Anglo-Saxon countries and the countries of their former areas of influence are still not willing to comply with these provisions: the two systems are still used, with the risk of serious confusions.

In this connection, let’s remind the decree of May 8th 1790 of the French National Assembly: […] the King (Louis XVI) will be begged to write to her British Majesty, and ask her Majesty to convince the Parliament of England to contribute with the national assembly in fixing the natural unit for measures and weights […] Tarbé [1].

For more Lupine Publishers Open Access Journals Please visit our website: http://lupinepublishers.us/ For more Peer Reviewed Journal of Forensic articles Please Click Here: https://lupinepublishers.com/forensic-and-genetics-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Lupine publishers | Mitigating Disaster using Secure Threshold-Cloud Architecture

Lupine Publishers | Current Trends in Computer Sciences & Applications 

Abstract

There are many risks in moving data into public cloud environments, along with an increasing threat around large-scale data leakage during cloud outages. This work aims to apply secret sharing methods as used in cryptography to create shares of cryptographic key, disperse and recover the key when needed in a multi-cloud environment. It also aims to prove that the combination of secret sharing scheme and multi-clouds can be used to provide a new direction in disaster management by using it to mitigate cloud outages rather than current designs of recovery after the outages. Experiments were performed using ten different cloud services providers at share policies of 2 from 5, 3 from 5, 4 from 5, 4 from 10, 6 from 10 and 8 from 10 for which at different times of cloud outages key recovery were still possible and even faster compared to normal situations. All the same, key recovery was impossible when the number of cloud outages exceeded secret sharing defined threshold. To ameliorate this scenario, we opined a resilient system using the concept of self-organization as proposed by Nojoumian et al in 2012 in improving resource availability but with some modifications to the original concept. The proposed architecture is as presented in our Poster: Improving Resilience in Multi-Cloud Architecture.

Keywords: Secret Shares; Disaster Mitigation; Thresholds Scheme; Cloud Service Providers

Introduction

With the introduction of cloud services for disaster management on a scalable rate, there appears to be the needed succour by small business owners to get a cheaper and more secure disaster recovery mechanism to provide business continuity and remain competitive with other large businesses. But that is not to be so, as cloud outages became a nightmare. Recent statistics by Ponemon Institute [1] on Cost of Data Centre Outages, shows an increasing rate of 38% from $505,502 in 2010 to $740,357 as at January 2016. Using activity-based costing they were able to capture direct and indirect cost to: Damage to mission-critical data; Impact of downtime on organizational productivity; Damages to equipment and other assets and so on. The statistics were derived from 63 data centres based in the United States of America. These events may have encouraged the adoption of multi-cloud services so as to divert customers traffic in the event of cloud outage. Some finegrained proposed solutions on these are focused on Redundancy and Backup such as: Local Backup by [2]; Geographical Redundancy and Backup [3]; The use of Inter-Private Cloud Storage [4]; Resource Management for data recovery in storage clouds [5], and so on. But in all these, cloud service providers see disaster recovery as a way of getting the system back online and making data available after a service disruption, and not on contending disaster by providing robustness that is capable of mitigating shocks and losses resulting from these disasters.

This work aims to apply secret sharing methods as used in cryptography [6,7] to create shares of cryptographic key, disperse and recover the key when needed in a multi-cloud environment. It also aims to prove that the combination of secret sharing scheme and multi-clouds can be used to provide a new direction in disaster management by using it to mitigate cloud outages rather than current deigns of recovery after the outages. Experiments were performed using ten different cloud services providers for storage services, which at different times of cloud outages, key recovery were still possible and even faster compared to normal situations. All the same, key recovery was impossible when the number of cloud outages exceeded secret sharing defined threshold. To ameliorate this scenario, we look forward to employ the concept of self-organisation as proposed by Nojoumian et al. [8] in improving resource availability but with some modifications as proposed. The rest of the work is organised into section II, Literature Review takes a closer look at current practices, use of secret sharing and cloudbased disaster recovery with much interest in the method used in design. III. Presents our approach, in section IV, present Results and Evaluations and Conclude in section V with future works and lessons learnt.

Literature Review

There are research solutions based on different variants of secret sharing schemes and multi-cloud architecture that give credence to its resilience in the face of failures, data security in keyless manner, such as: Ukwandu et al. [9] — RESCUE: Resilient Secret Sharing Cloud-based Architecture; Alsolami & Boult, [10], — CloudStash: Using Secret-Sharing Scheme to Secure Data, Not Keys, in Multi-Clouds. Others are: Fabian et al. [11] on Collaborative and secure sharing of healthcare data in multi-clouds and [12] on Secret Sharing for Health Data in Multi-Provider Clouds. While RESCUE provided an architecture for a resilient cloud-based storage with keyless data security capabilities using secret sharing scheme for data splitting, storage and recovery, Cloud Stash also relied on the above strengths to prove security of data using secret sharing schemes in a multi-cloud environment and Fabian et al proved resilience and robust sharing in the use of secret sharing scheme in a multi-cloud environment for data sharing. Because our approach is combining secret sharing and multi-clouds in developing a clouddisaster management the need therefore arise to review current method used in cloud-based disaster in a multi-cloud system and their shortcomings.

a) Remus: Cully et al. [13] described a system that provides software resilience in the face of hardware failure (VMs) in such a manner that an active system at such a time can continue execution on an alternative physical host while preserving the host configurations by using speculative execution. The strength lies on the preservation of system’s software independently during hardware failure.

b) Second Site: As proposed by Rajagopalan et al. [14] is built to extend the Remus high-availability system based on virtualization infrastructure by allowing very large VMs to be replicated across many data centres over the networks using internet. One main aim of this solution is to increase the availability of VMs across networks. Like every other DR systems discussed above, Second Site is not focused on contending downtime and security of data during cloud outages.

c) DR-Cloud: Yu et al. [15] relied on data backup and restore technology to build a system proposed to provide high data reliability, low backup cost and short recovery time using multiple optimisation scheduling as strategies. The system is built of multicloud architecture using Cumulus [16] as cloud storage interface. Thus providing the need for further studies on the elimination of system downtime during disaster, provide consistent data availability as there is no provision for such in this work.

Our Approach

Our approach is in combining secret sharing scheme with multi-clouds to achieve resilience with the aim of applying same in redefining cloud-based disaster management from recovery from cloud outages to mitigating cloud outages.

The Architecture

The architecture of as shown in Figure 1 shows key share creation, dispersal and storage, while that of Figures 2 & 3 is of shares retrieval and key recovery

Figure 1: Key Share Creation, Dispersal and Storage.

Figure 2: Share Retrievals and Key Recovery.

Figure 3: Cloud Service Providers at Different Scenarios.

Share creation and Secret recovery: The diagram above explains our design of key share creation, dispersal and storage using different cloud service providers (Figure 1). Share Creation: The dealer determines the number of hosts shares combination from which data recovery is possible known as threshold (t) and the degree of the polynomial, drived from subtracting 1 from the threshold. In this case, the threshold is 3 and the degree of polynomial is 2. He initiates a secret sharing scheme by generating the polynomial, the coefficients a and b are random values and c is the secret, the constant term of the polynomial as well as the intercept of the graph. He generates 5 shares for all the hosts H1… H5 and sends the shares to them for in an equal ratio and weights we, and thereafter leaves the scene [1].

Secret Recovery: Just as in Shamir [6] authorised participants following earlier stated rules are able to recover the secret using Lagrangian interpolation once the condition as stated earlier is met. The participants contribute their shares to recover the secret.

Results and Evaluations

Test: Cloud Outages against Normal situations. This test assumes that cloud outage prevents secret recovery.

Discussions

The results above show that cloud outage has no negative effect on key recovery, rather reduces the overhead in comparison with normal situations. It shows the relationship between cloud outage and normal operational conditions. From available results at twenty percent (20%) failure rate using 3 from 5 share policy, the system becomes faster by sixteen percent (16.41%), but at forty percent (40%) failure rate using same share policy, the download speed is faster by a little above fifty one percent (51.80%). Looking at a higher share policy of 6 from 10, at thirty percent (30%) failure rate, the system download speed is higher by a little above thirtyseven percent (37.90%), while at forty percent (40%) failure rate, the system performed better by about forty-three percent (42.99%). The implications therefore are that in as much as failure rate is not equivalent or above the threshold, system performance improves as there was no result obtained when the cloud outage exceeds or equal to threshold. These therefore do not support the assumption as above that cloud outage has negative effect in key recovery. There is no significant evidence to show that the size of the share has effect on the key recovery during cloud outages because at forty percent (40%) failure rate using share of 10KB in 3 from 5 shows performance rate of above fifty-one percent while in 6 from 10 share policy approximately forty-three (42.99%) percent performance rate.

Conclusions, Lessons Learnt and Future Work

Current cloud-based disaster recovery systems have focused on faster recovery after an outage and the underlying issue has been the method applied, which centered in data backup and replicating the backed-up data to several hosts. This method has proved some major delays in providing a strong failover protection as there has to be a switch from one end to another during disaster in order to bring systems back online, the need thus arises for research to focus on method capable of mitigating this interruption by providing strong failover protection as well as stability during adverse failures to keep systems running. This method we have provided here using this paper. Because, secret sharing schemes are keyless method of encryption, data at rest and in transit are safe as it exists in meaningless format.

The recovery of key is done using system memory and share verification is usually carried out using an inbuilt share checksum mechanism using SHA-512, which validates shares before recovery. Else, share recovery returns error and halts. We have learnt that cloud outage rather than prevent key recovery, using our method proved that it hastens key recovery from results available. Also, understand that when cloud outage exceeds threshold of the share policy, key recovery becomes impossible and to ameliorate this situation, we propose as future work to use the concept of Self- Organization as proposed by Nojoumian et al. [8] to manage cloud resources though with some modifications so as to maintain share availability from cloud service providers.

For more Lupine Publishers Open Access Journals Please visit our website:

http://lupinepublishers.us/

For more Current Trends in Computer Sciences & Applications Please Click Here:

https://lupinepublishers.com/computer-science-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Anti-Synepthelichorial Placenta Scfv Library Construction_Lupine Publishers

Journal of veterinary Science| Lupine Publishers

Abstract

Hens were immunized with a macerate of goat and sheep placentomes. Immunizations were repeated every 15 days. Eggs were collected over a period of 03 immunizations, IgY isolated, and its concentration measured. After 45 days of the start of immunization, chickens were euthanized, their spleens isolated and fragmented for total RNA extraction by Trizol method. Performed the synthesis of cDNA, was amplified by PCR the fragments of immunoglobulin G avian variable light chain (VL) and heavy chain (VH). Fragments of VL and VH were used to constitute the final product by recombinant PCR-overlap process. The results present the feasibility of building a library of scFv anti goats and sheep placenta opening the possibility of manufacture diagnostic kits for various physiological situations of placental trophoblast cells belonging to these species.

Introduction

The developments of the techniques of molecular biology and genetic engineering have provided the emergence of recombinant DNA technology has enabled the production of several new molecules of immunoglobulin fragments Maranhão [1]. Such biomolecules are important for the development of studies in the fields molecular biology, medicine and pharmaceuticals, and also in developing treatments for various types of diseases and diagnoses Seo et al. [2],Lynch et al. [3], such as cancer and infectious diseases Baert et al. [4]; Rocha et al. [5];Bumrela [6]; Huber et al. [7],therapies to combat rheumatoid arthritis and osteoarthritis Hughes et al. [8], against smoking Bevins et al. [9]; Peterson et al.[10];fighting drugs like methamphetamine Peterson, et al. [10] and cocaine Dickerson &Janda [11]; combating the sequelae of alcoholism Bagasra et al. [12]; combating Alzheimer’s Boado et al. [13]; Nisbetet al. [14]; detecting myocardial injury related Marti et al. [15]; diagnosis of pregnancy Payne Jr et al. [16]. Antibodies resulting from manipulation and recombination of variable fragments single chain (scFv) immunoglobulin, have been used in therapeutics and diagnostics, offering advantages over conventional antibodies Malecki et al. [17]; Wilkinson et al. [18]; Monnier et al. [19].

In ruminant animals, possessing synepthelichorial placenta (Igwebuike [20]; Pinto et al. [21]), the activity of trophoblast cells, especially the trophoblast giant cells, are related to the process of implantation of the conceptus and training of the placentome Pinto et al. [21]; Ealyet al. [22] and directly related to the recognition of the fetus by the maternal organism Shi et al. [23]; Roberts, [24]. This cellular activity induces the production and secretion of various specific molecular structures that are temporarily expressed during pregnancy Miguez et al. [25]; Machado et al. [26], but not all are known or have been isolated. Detection of these antigens or chemical markers is of great importance for breeding ruminant animals and especially for a greater understanding of the physiology and gene expression of trophoblastcells synepthelichorial placenta Roberts, [24]; Roberts et al. [27].

It is presented in this context, this work has as objective aconstruction of gene libraries of single chain variable fragments (scFv) antibody chicken (Gallus gallusdomesticus) placentome anti-ruminant animals and also to contribute to the creation of new knowledge on trophoblastcells and their effects on reproduction in animals synepthelichorial. These gene libraries will be the basis for future work, we will focus on the expression of recombinant biomolecules, which can be selected by affinity for the specific trophoblast cells in goats and sheep placentomes molecular markers.

Materials and Methods

Immunization of animals and collection of samples

Used in this study were macerated placentomas of female goats and sheep consistent with the first third of gestational development. The immunization was performed via the deep pectoral muscles at three Lhomann brown laying hens of 28 weeks old. Immunizations took place every fortnight, the first immunization was performed with the filtrate 200 mg macerate placentome goats and sheep (GSP - Goat and Sheep Placentomes) plus complete Freud’s adjuvant, 1:1. Over two immunizations were performed with the use of incomplete Freud’s adjuvant, under the same conditions for the first immunization. In the process of construction of the gene library of goat and sheep placenta antiscFv mixture of macerated placentome of female goats and sheep was used, this procedure was done this way because of the great phylogenetic closeness existing between these two species. Fifteen days after the third and final immunization, totaling a trial period of 45 days, all chickens were anesthetized using a 5:1 ratio of Ketamine (100mg/ml or 50mg/kg)and Xylazine (20mg/ml or 10mg/kg ) following the animals were euthanized by ensanguinação. The spleens of these animals were isolated, identified, and stored at -20 °C for future total RNA extraction. During the immunization eggs were collected and separated to the extraction of Y (IgY) immunoglobulins performed by using the commercial kit EGGstract ®IgY Purification System (Promega Corporation, Madison, USA), with subsequent measurement of the concentration by the method of Bradforf Bradford[28] and purification of IgY by electrophoresis in polyacrylamide gel with sodium dodecyl sulfate (SDS-PAGE).

Extraction and isolation of total RNA

Three fragments of spleen, 50mg, referring to the three chickens were used for extraction of total RNA by methodology TRIZOL reagent (Invitrogen, USA). The quantification of the concentration was carried out in a spectrophotometer (Power Wave NS2 BioTek Instruments, Inc.) at a wavelength of 260nm.

Construction of cDNA molecules and the light chain (VL) and heavy chain (VH)

The cDNA of the immunoglobulin G (IgG) was synthesized by using kit SuperScriptTM III Reverse Transcriptase (Invitrogen, USA) and dNTP Set (Fermentas Life Sciences, Maryland, USA), according to the manufacturer’s instructions. Primers used for amplification of the variable regions VL and VH were prepared by BarbasIII et al. [29].VL regions of the immunoglobulins were amplified using the sense primer CSCVK-F (5’-GTG GCC CAG GCG GCC CTG ACT CAG CCG TCC TCG GTG TC-3’); and antisense CKJo-B (5’-GGA AGA TCT AGA GGA ACC CTG TAG GAC GGT CAG G -3’). For amplification of the VH region, we used the sense primer CSCVHo-F (5’-GGT CAG AGA TCC TCT TCC TCT GTG GCC TTG ACG GAC GAG -3’) and antisense CSCG-B (5’-GCC CTG GGC CTG GCC ACT AGT GGA GAT GGA GAC GGT GAC TTC CC-3’) (Eurofins MWG Operon, Alabama, USA). The cDNA samples were pretreated with RNase A 5U/μl (Thermo Fisher SCIENTIFIC, USA), and the PCR reactions were designed to 50ng of each sample Barbas III et al. [29]. Considering the final volume of 50μl per amplification reaction, this was performed using 5U/ μl Taq DNA polymerase (Fermentas LIFE SCIENCES, Maryland, USA); 1 mM MgCl2; 2 mMdNTP Mix (Fermentas LIFE SCIENCES, Maryland, USA), 10x Taq buffer with KCl (100 mMTris-HCl pH 8.80, 500 mMKCl/Fermentas Life Sciences, Maryland, USA), 30pmol/ μl of sense and antisense primer and free water RNA and DNA in order to complete the amplification reaction 50μl. The buildings of the fragments VL and VH were made separately and each using their specific primers.

The programming of the recommended thermocycler followed by Barbas III et al. [29] beginning with an incubation at 94°C for 2 minutes. Compounds followed by 30 cycles by denaturing at 94°C for 02 minutes, annealing at 56°C for 15 seconds and extension at 72°C for 90 seconds, and the completion of the reaction cycle at 72°C for 10 minutes was used. The control reaction was performed by electrophoresis in 1% agarose gel and the result was further documented by using photodocumentator.

Construction of single-chain variable fragments (scFv) by overlap-PCR

The bands of fragments VL and VH were extracted from the agarose gel and purified separately with the aid of MinElute Gel Extraction Kit (QIAGEN). Following extraction of these products were further purified by QIAquick PCR Purification Kit (QIAGEN) and stored at -20°C. The Overlap-PCR is define the connection (or overlap) between fragments of the chain light (VL) and heavy (VH), constructed by forming a flexible peptide linker (VL-linker-VH) comprising the complementary tails of the connection between the sense primer (CSCVHo-F) heavy chain and anti- sense primer light chain (CKJo-B) used for amplification of fragments. The primers for the construction of scFv molecule of this study followed the description Barbas III et al. [29]: sense primer CSC-F (5’-GAG GAGGAGGAGGAGGAGGTG GCC CAG GCG GCC CTG ACT CAG -3’) and antisense primer CSC-B (5’-GAG GAGGAGGAGGAGGAGGAG CTG GCC GGC CTG GCC ACT AGT GGA GG-3’) (Eurofins MWG Operon, Alabama, USA). The final product was characterized Overlap-PCR with approximately 750 base pairs (bp).

The Overlap-PCR reactions were drawn for each sample 50ng of fragment VL and VH Barbas III et al. [29]. The PCR fragments overlap VL and V H has been designed to use 5U/μl Taq DNA polymerase (Fermentas LIFE SCIENCES, Maryland, USA) 1 mM MgCl2, 2 mMdNTP Mix (Fermentas LIFE SCIENCES, Maryland, USA), 10XTaq buffer with KCl (100 mMTris-HCl pH 8.80, 500 mMKCl/Fermentas LIFE SCIENCES, Maryland, USA), 30pmol/μl of sense and antisense primer and free water RNA and DNA in order to complete the reaction 50μl Overlap-PCR.

The thermocycler was programmed for Overlap PCR reaction so that the activation reaction was carried out at 94°C for 60 seconds, following 30 cycles were performed 03 times with each cycle, the first time 2 minutes 94°C, the second at 56°C for 60 seconds and a third at 72°C for 90 seconds, and the completion of reaction was conducted by one cycle at 72°C for 10 minutes. The control reaction was performed by electrophoresis on a 1% agarose gel and the results were documented through the use of photodocumentator.

Statistical Analysis

To compare the means of IgY the mixture of macerated GSPTukey’s test at 5% significance level was applied, using the statistical program ASSISTAT, version 7.6 beta/2011.

Results

Measurement of immunization

Measuring the success of immunization with GSP mixture was performed by assessing the concentration (mg/mL) of purified IgY from the yolks of immunized hens. Immunization with GSP solution showed average concentrations of 2.89±0.12, 3.90±0.15 and 4.24±0.21 mg/mL, respectively for the 1st, 2nd and 3rd immunization. Immunizations performed with the mixture of macerated GSP showed the linear regression equation y = 0.195 x + 7.74 and a coefficient of determination (R2) equal to 0.9916 (99.16%), indicating an excellent fit for the relationship between immunizations and production of IgY performed, ie more than 99% of the production of IgY was established directly by increasing the number of immunizations with a mixture GSP.

Figure 1:  Purification results of immunoglobulin Y (IgY) anti-goat and sheep placentames in different stages of immunization. Polyacrylamide 6% acrilamide gel electrophoresis.MPM, molecular weight marker (kDa).

In the purification of IgY by electrophoresis on 6% polyacrylamide (SDS-PAGE) gel was identified IgY approximately 212 kDa (Figure 1). We can observe an increase in the thickness of the band related to immunoglobulins, thus confirming higher levels of concentration of IgY, which corroborates with the increased concentration of IgY.

Statistical Analysis

The data in (Table 1) corroborates the mixture homogenized with the GSP, in the course of three immunizations promoted increased immunogenicity and consequent increase in the production of IgY as a response. This analysis was provided by the use of the Tukey test at a significance level of 5%.

Table 1: Values followed by the same letter do not differ statistically among themselves. We have used the Tukey test at 5% significance level. (MSD = minimum significant difference; GM = general average; CV% = coefficient of variation in %).

Figure 2:  Amplification results of the light chain (VL) and heavy chain (VH) scFv fragments of chicken Immunoglobulin G (IgG), anti-goat and sheep placentome 1% agarose gel electrophoresis.

Amplification product of the cDNA of light chain (VL) and heavy chain (VH) scFv chicken immunoglobulin G

Referring to immunization with the macerated GSP after running on 1% agarose gel, the image was identified the presence of VL bands with 350pb and VH bands with 400bp (Figure 2).

Product overlapping sequences of scFv fragments by Overlap-PCR

Also referring to mixing with the mash GSP, after Overlap PCR reaction, the formation of fragments with approximately 750pb has been identified as a result of overlapping fragments and linearization VL and VH.

Discussion

In this study, chickens were immunized with homogenized in ruminant animals placentomas more Freund’s adjuvant. As expected result was a DNA library of monoclonal antibodies (goat/sheep anti-placental) scFv fragments of immunoglobulin G from total RNA extracted from leuocyte cells from the spleen of chickens. The methodology used in this study was efficient and effective in the development and construction of goat/sheep antiplacentomescFv library. The synthesis of the molecule overlapped scFv anti-placentome placenta caprine/sheep presented as result a band of 750 bp (Figure 3), equivalent to that described by Barbas III et al.[29], Roldanet al. [30].

Figure 3:  Overlap results of the light chain (VL) and heavy chain (VH) scFv fragments of chicken immunoglobulin G (IgG) anti-goat and sheep placentome (GSP). 1% agarose gel electrophoresis.

With respect to the effect of immunization and production of IgY, experimental procedures and similar results were reported by Gassmann et al. [31], in which chickens were immunized with 20 to 30 mg of mammalian protein added to Freud’s complete adjuvant. The results of 62 eggs extracted total amount of 4.0 grams of IgY and obtained as a final yield of approximately 130mg specific for a protein of mammalian cell cycle regulatory antibodies. Using the immunoblot technique identified that 20 days after immunization, IgY antibodies appeared, reaching a maximum production within 30 days after first immunization, maintaining a good level of production until 81 days, when the average was 72mg of IgY per yolk. These researchers obtained at the end of the experiment the mean concentration with standard deviation of7.44 ± 0.27 mg of IgY/mL of yolk. For Meenatchisundaram et al. [32], IgY concentrations ranged from 0.85 to 7.60 mg/mL of egg yolk, throughout the immunization period. Already to Pauly et al. [33] variations IgY were between 3.0 to 8.0 mg/ml of yolk. Chui et al. [34] reached a mean value of 5.75 mg of IgY per ml of egg yolk immunized as Barbas III et al. [29] had concentrations range from 55 to 80 mg/egg yolk and 75% purity using the same extraction kit used in this study. In this study, average concentrations of finals were obtained 3.68 ± .16 mg of IgY/mL in the yolk. One advantage of the IgY antibody production is that the required amount of antigen for high and long lasting for IgY yolk of immunized hens titration would be very low compared to immunization of other animals such as the rabbit Song et al.[35]; Hatta et al.[36]. When the result of IgY extract was applied to 6% polyacrylamide gel was characterized by bands at approximately 212kDa molecular weight. The literature describes this mass ranging from 180kDa immunoglobulin Meenatchisundaramet al. [32]; Warret al. [37]; Chalghoumiet al. [38] to 220 kDa Hamada et al. [39].

Andris-Widhopf et al. [40] have also obtained cDNA fragments of approximately 750pb as a result of Overlap PCR reaction scFv fragments. These researchers used chickens immunized with a conjugate of bovine serum albumin (BSA) plus fluorescent and hapten reported as a result of the joining VLand VH, comprising the formation of a linker sequence (VL-linker-VH). They also emphasized that the VL-linker-VHproduct, corresponds to the scFvregion of immunoglobulin, has good applicability for use as befits its use with vector transfection.

In the bursa of Fabricius, the level of the complementarity determining regions (CDRs) of scFv fragments (light and heavy chain) derived from immunoglobulin G (IgG) from chicken and poultry in general, such mechanisms occur: the gene rearrangement and gene conversion somatic hyper-mutation. These mechanisms promote increased variability in this gene fragments due to the incorporation of genes pseudo and direct, acting in the maturation cell of B lymphocytes McCormack & Thompson, [41]; Paramithiotis et al. [42]; Arakawa [43]. Thus the Overlap PCR allows the tool the final product, or the scFv fragment, a great increase in respect of gene variability, since it favors the increase of the combination of variable gene fragments, allowing the number of clones from a library of scFv generated by this method reaches to 1012units Barbas III et al. [29].

cDNA libraries are indispensable to analyze the expression and function of genes and also in the study of protein function, this expression products. Hese information can be of great importance in understanding when and how certain genes are expressed in an cell type or organism. The continuous progress in the development of constitutive techniques of scFvgene libraries and the interest in their applications suggest that these tools will continue to be an important factor for the development of new recombinant biomolecules.

Conclusion

This study was consolidated construction of gene library as a viable method for the construction of scFv recombinant biomolecules. The construction of gene libraries of recombinant scFv fragments of immunoglobulin G (IgG) chicken has great potential for use due to its high genetic variability, promoted by the mechanisms of gene rearrangement, gene conversion and somatic hyper-mutation occurring in fragments of varying chain light (VL) and heavy (VH). Thus, scFv fragments may be linked chicken techniques of molecular biology generation of biomolecules with high target-binding affinity. Caprine and ovine anti-placenta obtained by Overlap-PCR in this study biomolecules can be used to identify physiological aspects of trophoblast cells of caprine and ovine placenta, thus developing the function of these cell typespecific molecular markers.

To know more about our Journal of veterinary science click on https://lupinepublishers.com/dairy-veterinary-science-journal/index.php

For more Lupine Publishers Open Access Journals Please visit our website:

http://lupinepublishers.us/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Lupine Publishers | Genetic Variability Studies for Economically Important Traits in Sunflower (Helianthus Annuus L.)

Lupine Publishers | Agriculture Open Access Journal

Abstract

The research was conducted in the research area of Department of Plant Breeding and Genetics (PB&G), University of Agriculture Faisalabad (UAF), Pakistan during spring 2014. The triplicated research trial was laid out following randomized complete block design (RCBD). Fifteen lines of sunflower were studied for genetic variability and association of economic traits with seed yield. The data were recorded on quantitative traits i.e. days to 50% flowering (DFF), plant height (PH), number of leaves per plant (NOL), head diameter (HD), leaf area (LA), filled achene (FA), 100 achene weight (100AW), oil contents (OC), achene yield per plant (AY/P) and qualitative traits i.e. head angle at maturity (HA), achene color(AC). The recorded data were subjected to analysis of variance, correlation and path coefficient analysis. The accessions were highly significant for all traits under study. The accessions A-2.2 showed good performance for most of studied traits. The accession B-3.1 also show better performance followed by A-4.3 and A-7.10. Genotypic correlations are higher than phenotypic correlations. 100AW, NOL, LA and HD had positive and highly significant genotypic correlations with AY/P. Genotypic correlation of AY/P was significantly negative with PH, DFF and oil contents. LA, NOL, 100AWand OC showed direct positive effect on AY/P. DFF, PH, HD and FA had negative direct effect on AY/P.

Keywords: Variability; Correlation; Path coefficient; Quantitative; Quality related traits

Abbreviations: PB&G: Plant Breeding and Genetics; RCBD: Randomized Complete Block Design; PH: Plant Height; NOL: Number of Leaves; HD: Head Diameter; LA: Leaf Area; FA: Filled Achene; AW: Achene Weight; OC: Oil Contents; AY/P: Achene Yield per Plant; HA: Head Angle; AC: Achene Color

Introduction

Oil and fats are major part of human diet, important source of energy and also play role in carrying different vitamins in body. Due to the rapid growth in population of Pakistan, requirement of edible oil has also been raised. So a gap is produced between utilization and production in Pakistan. Although the country is making huge improvement in agriculture sector but still there exist extreme shortage of edible oil. During 2015-2016 Pakistan fulfilled 17% its requirement of edible oil by domestic oil and 83% by imported oil. Both conventional and non-conventional oilseed crops are important to fill the space between utilization and production.

Sunflower (Helianthus annuus L.) belongs to non-conventional oilseed crops in Pakistan and has great ability to increase oil yield per hectare in Pakistan [1,2]. Sunflower being the 2nd most important oilseed crop of the world was introduced in Pakistan during 1960’s. Sunflower is growing twice a year in Pakistan as a major edible oilseed crop. It is grown on 0.214 million acre with 0.92 million tons seed production and 0.035 oil production. Government of Pakistan 2015-2016 [3]. Sunflower seed contains 40-50% oil contents [4]. Sunflowers commercially available varieties contain 39 to 49% oil in their seeds.

The major part of oil comprises of unsaturated fatty acids (oleic acid 20% and linoleic acid 69%), with the remainder 11% are saturated fatty acids (palmitic and stearic fatty acids) Mirza [5]. Sunflower oil is considered as premium quality oil because of its taste, high smoke point, beam colour, good nutritional quality, elevated level of unsaturated fatty acids and lack of harmful/ unstable components like erusic acid and linolenic acid. It has the sturdy oxidative stability and alpha-tocopheroles are the source of vitamin E which is anti-inflammatory agent [6]. Variations are very precious for any breeding programs [7,8]. Genetic variations existing in the genotypes can be exploited efficiently as genetic resources in breeding programs [9] Success of breeding program rely upon the extent of variation present in a germplasm for yield and yield contributing traits [10]. Correlation analysis demonstrates the association of the economically important traits with achene yield. Path coefficient analysis facilitates the division of correlation coefficients into its direct and indirect effects of economic traits on achene yield [11]. It quantifies the association of different yield components and direct or indirect effects on seed yield [12, 13].

The ultimate objective of the sunflower breeders are to increase quantity and improve quality of the oil.

Materials and Methods

The research work was performed in the research fields of Department of Plant Breeding & Genetics, University of Agriculture Faisalabad, Pakistan. Fifteen accessions of sunflower were studied as listed in Table 1. The experiment was conducted in RCBD with three replications in spring 2014. Dibbler method was used for sowing of these accessions. Row to row distance was kept 0.75m and plant to plant 0.25m. Agronomic practices were kept constant during the experiment. The data was recorded on five randomly selected guarded plants per replication of each accession for DFF, PH, NOL, HD, LA, FA, AY/P, 100AW, OC and qualitative traits i.e. HA, AC. The recorded data were analyzed for variance following the method by Steel [14]. Correlation analysis proposed by Kwon [15] and path coefficient analysis by Dewey and Lu 1957 [16] were performed for determining the association among different morphological characters and their direct and indirect effects on seed yield.

Table 1:  Sunflower accessions used in the present study.

Results and Discussion

Genetic variability studies for quantitative and quality related traits

Presence of genetic variability is prerequisite for the development of new hybrids and varieties. ANOVA of different characters is presented in Table 2. Mean squares of different characters showed that accessions had noticeable differences for all the traits under study. The mean comparisons of accessions for different characters are presented in Table 3. DFF, PH,NOL, HD, LA, FA, AY/P, 100AW and OC ranges from 75-90 days, 158.17- 182.56cm, 15-32 leaves, 7.76-15.94cm, 20.04-37.15cm², 497-677 achene, 20.29-38.96g, 1.50-6.58g and 41.20-34.33% respectively. Noticeable differences were present in the accessions and selection of various economic traits may be helpful in the development of new hybrid combinations.

Table 2:  Mean squares of sunflower accessions for various plant characters.

Table 3:  Mean comparisons of sunflower accessions for various plant characters.

The observed results were in agreement with the results observed by different researchers [5,7,10,17-20]. Among studied accessions, A-2.2 showed good performance for NOL, HD, FA, 100AW, OC and AY/P. The accession B 3.1 showed good performance for NOL, LA, OC and AY/P. A-4.3 can be incorporate in breeding program to develop short duration, short stature high yielding hybrid. So, this breeding material can be used in breeding program for the development of short duration high yielding hybrids with short stature. Short heighted accessions may be helpful in the breeding of lodging resistant hybrids as lodging is one of the major issues of this crop. Accession A-7.10 has highest OC with good seed yield and 100AW. This accession may also be the source in production of high oil yielding hybrids.

Quality Determine Traits

Head angles of sunflower accessions are presented in the Figure 1. All the accessions showed different percentages of HA i.e. 135°, 180°, 45° and 225°. Most of the lines had three types of angles i.e. 180°, 135° and 45°. Only line A-14.13 had 180°and 135° head angle. But lines C-2.11, A-2 .5, A-4.3, B-3.1, A-7.10, A-10.1.2, A-11.1.2 and A-2.2 also showed head angle of 225°. The observed achene color for the accessions is presented in Figure 2. All the accessions possessed different percentages of achene color. All the accessions had maximum percentage of grey, black and light grey achene colour. Only line B-3.1 had black and grey achene colour. But accessions C-2.11, A-14.13, A-7.10, A-10.1.2, A-2.19 and C-2.17.1 showed a little percentage of white color achene.

Figure 1:  Percentage of plants sunflower accessions for head angle.

Figure 2:  Percentage of plants sunflower accessions for Achene colour.

Correlation and path coefficient analysis

Genotypic and Phenotypic correlation coefficients among quantitative traits in 15 genotypes of sunflower are showed in Tables 4 & 5 respectively. Phenotypic correlation was lesser than the genotypic correlation. This showed that expressions of traits are mainly governed by the genetics of accessions and environment had little influence on them and selection can be fruitful for the improvement of breeding program [5,10,19,21-23]. Also discussed in their results that genotypic correlation is higher than the phenotypic correlation. 100AW (0.6879), NOL (0.501), LA (0.580) and HD (0.0603) had positive and highly significant genotypic correlations with AY/P. Genotypic (-0.634) and phenotypic (-0.45) correlation of AY/P was significantly negative with oil content. Phenotypic correlation coefficients of most of the traits were nonsignificant with AY/P. Genotypic correlations of DFF (-0.363), PH (-0.53) and FA (-0.527) were negative and highly significant with achene weight [5,12,23-32] also discussed the similar results in literature. Path analyses among quantitative traits are presented in Table 6. Results of correlation and path analysis can be helpful in the direct and indirect selection of valuable traits to improve the genetic potential of breeding material. Path analysis presented direct and indirect effects of different characters on AY/P.NOL, LA(0.083), 100AW(1.8979) and OC (1.5936) showed direct positive effect on AY/P [5, 33- 35]. Also discussed that 100AW showed positive direct effect on AY/P.

Table 4:  Genotypic correlation coefficients of various characters among the sunflower accessions.

Table 5:  Phenotypic correlation coefficients of various characters among the sunflower accessions.

Table 6:  Direct (bold diagonal) and indirect effects of various characters on achene yield per plant of sunflower accessions.

Achene yield can be increased by considering these traits. DFF (-0.1302), PH(-0.413), HD(-0.589) and FA(-0.057) had negative direct effect on AY/P. PH showed positive indirect effects through HD, NOL and DFF. HD had positive indirect effect through PH(0.157), NOL(0.1109), LA(0.034), FA(1.4132), 100AW (0.0091) and OC(2.414) [18] also reported that HD had indirect positive effect on achene yield through 100AW. NOL had positive indirect effect through LA(1.3429) and 100AW(0.953) [5,7,36,37] also discussed the indirect effect of NOL on achene yield. LA showed positive indirect effects through PH (0.2523), NOL(0.031), FA(0.0057), 100AW(1.105), DFF(0.3025) and OC(0.0348). FA showed positive indirect effect through HD (0.093) and NOL (0.074). Hundred achene weights showed positive indirect effects through PH(0.2214), NOL(0.042) and LA(2.0896) [21,38,26] also reported that 100AWs had positive indirect effect through PH, LA and NOL. OC had positive indirect effects through HD(0.055), FA(0.0028), 100AW(1.3098) and DFF (0.9848). DFF had positive indirect effects through PH(0.0841). So a criterion may be developed for the selection of economic traits [39].

Conclusion

Significant genetic variability was present in the studied breeding material which may be exploited in hybridization programs to develop high seed and oil yielding, short duration and short stature hybrids of sunflower. Accessions A2.2, B-3.1, A 4.3 and A-7.10 showed best expression of economically important traits so they might be used in the future breeding programs for the improvement of achene yield. Correlation studies explained the direction of relationship between important traits. Direct and indirect association of PH, HD, NOL, LA, FA, 100AW and OC with AY/P recommended that these traits may be used as criteria for selection of sunflower types with good yield potential [40-42]

https://lupinepublishers.com/agriculture-journal/pdf/CIACR.MS.ID.000135.pdf

For more Agriculture Open Access Journal articles Please Click Here: https://www.lupinepublishers.com/agriculture-journal/

To Know More About Open Access Publishers Please Click on Lupine publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers

Double Malignancies: A Rare Entity- Lupine publishers

Surgery open access journal| Lupine publishers

Abbreviations: MPM: Multiple Primary Malignancies, SEER: Surveillance Epidemiology and End Results Programme, SPT: Second Primary Tumor, TT: Third Tumor, QT: Quadrant Tumor, SPM: Second Primary Malignancies, NAACCR: North American Association of Central Cancer Registries

Introduction

Patients which have diagnosed with a cancer, have a life time risk for developing another de novo malignancy depending on various inherited environmental and iatrogenic risk factors. Cancer victims could survive longer due to settling treatment modalities, and then would likely develop a new metachronous malignancy [1]. The incidence of multiple primary malignancies has not been rare at all. Screening procedures have especially been useful for the early detection of associated tumors, whereas careful monitoring of patients has treated for primary cancer, and then a good communication between patients and medical care team would certify not only an early detection for secondary tumors, but only finally & subsequently, an appropriate management [2]. Differentiation between multiple primary and multicentric cancers was addressed in the classification by Moertel CG [3]:

I. MPMNs of Multicentric Origin

a) The same tissue and organ.

b) A common, contiguous tissue shared by different organs.

c) The same tissue in bilaterally paired organs.

II. MPMNs of Different Tissues or Organs

III. MPMNs of Multicentric Origin Plus a Lesion (s) of a Different Tissue or Organ

In 2002, However in ‘A review of the definition for multiple primary cancers in the United States’ classified the association of different cancers in two categories depending on the timing of their discovery [4];

a) Synchronous in which the cancers occur at the same time or within two months and

b) Metachronous in which the cancers follow in sequence of more than two months apart.

Vaamonde [5]. reckoned the time factor as six months. In 2005, International Agency for Research on Cancer working Group has come out with International Rules for Multiple Primary Cancers [6].

Although the mechanism involved in the development of multiple primary cancers has not been clarified, some factors such as heredity, constitution, environmental and immunological factors, oncogenic viruses, radiological and chemical treatments have been implicated. Hereditary susceptibility explains only a small proportion of all second cancers though many hereditary cancer syndromes have been described. MPMNs can occur at any age. However, from the reviewed series, patients with MPMNs tend to be older than those with a single primary malignant neoplasm. In many autopsy series and clinical reports, the median age of 50- 94% of MPMN patients was over 50 years [7]. Multiple Primary Malignancies (MPM) were first described in 1879 by Billroth [8]. The neoplasms may be limited to a single organ or may involve multiple separate anatomical organs. The North American Association of Central Cancer Registries (NAACCR) classifies MPM into two categories:

a) Synchronous, in which the cancers occur at the same time (The Surveillance Epidemiology and End Results Programme (SEER) definition is within two months) and

b) Metachronous, in which the cancers follow in sequence, that is, more than six months apart [9].

According to Warren Gates criteria a diagnosis of MPM require the following criterias to be fulfilled

a) Each tumor should present a definite picture of malignancy

b) Each tumor should be histologically distinct

c) The possibility that one is metastasis of the other must be excluded [10].

Meta-analyses show the frequency of Second Primary Tumor (SPT) as 3-5%, Third Tumor (TT) as 0.5%, and fourth tumor, that is, Quadrant Tumor (QT), as 0.3%, in different organs and of different histogenesis. Metachronous primary malignancies are becoming increasingly common because of an increase in the number of elderly cancer survivors, greater awareness and improved diagnostic modalities [1]. The exact pathophysiology for MPM remains unknown. However certain factors have been postulated which includes the common carcinogen induced multiple cancers in a exposed epithelial surface, called as “Field-Cancerization” as seen in head-neck tumors. In addition other causative factors includes ionizing radiation, increased use of organ transplant, and the increasing use of newer treatment modalities like hormonal manipulation, target therapies, genetic manipulation, and immunomodulators [2]. In a study conducted by Chakrabarti [11] it has been reported that the over a period of 2 years, 12 cases of MPM were detected against a total of 1255 cases. Of these, five cases were synchronous malignancies and seven cases were metachronous. Head and neck was the commonest site of index malignancies with seven cases followed by the breast cancer with three cases and next gynaecological malignancies with two cases. Most common sites for Second Primary Malignancies (SPM) were head and neck with (four cases).

Male to Female ratio was 1:1.5 in the synchronous primary group and 1:1.3 in the metachronous group. Median age of presentation of the primary tumour was 52 years and 6 months. The age range for the SPM was 17-72 years with the highest incidence in the 6th decade of life. Studies have reported that that the relative risks of SPM ranges from 1.08 to 1.3. SPM are often missed during follow-up and are detected accidentally. According to various series, the onset of SPTs decreases the 5-year survival by 18-30% as compared to those with only a single tumor. The controversy between the lateral spread of clones vs multiple foci of independent alterations does not currently affect the surgical and medical management of theses premalignant and malignant lesions. In the future, the presence of altered clones at mucosal margins may be an indication for aggressive therapy, including chemoprevention or radiotherapy to treat altered clonal patches that are unable to be detected grossly and are beyond the initial scope of surgical excision [3]. The issue of whether those with an extensive visible mucosal field defect is more likely to benefit from chemotherapy, radiotherapy or chemoprevention is a complex one. Current management is often site specific: Recurrent oral premalignant disease is often treated by surgical excision, whereas diffuse high grade premalignant changes in the laryngeal mucosa are frequently treated with radiotherapy. Determination of the role for these and other treatment modalities for clinically occult, clonally altered patches of epithelium is likely to be a difficult issue, since treatment of mucosa with widespread visible alteration is already challenging [4]. The paucity of awareness about SPM has also prevented the formulation of population-based screening protocol. Multiple tumors that have been pathologically confirmed at the time of presentation should be evaluated and staged as independent tumors. The treatment plan should be decided after staging of both the primary and secondary tumors in view to attain maximum clinical response. Proper counselling and patient’s understanding of magnitude of the disease is paramount. Operable synchronous SPM can be operated in a single setting with minimal morbidity with better survival and is less taxing on the patient and his/her relative both psychologically and financially. A regular follow-up on the patient by the clinician increases the chances of early detection of metachronous SPM and the formulation of the treatment plan at the earliest with better overall survival

Conclusion

MPMNs are still elusive for want of proper guidelines regarding correct terminology and classification encompassing varying presentations of chronological, aetiological, clinical and histopathological combinations. Our case adds up to literature for further research. The possibility of occurrence of synchronous multiple primary malignancies should be considered during workup for any malignant condition to institute early intervention to achieve good outcome [12]. The possibility of multiple primary malignancies existence should always be considered during pretreatment evaluation. Screening procedures were especially useful for the early detection of associated tumors, preferably before clinical manifestations occurrence [12]. There were some evidences that screening would improve outcomes among patients who might develop second malignancies, although the data were limited. The optimal screening modalities and strategies for reducing mortality from second malignancies remained to be defined for most tumor sites [13]. The early diagnosis of secondary malignancies should not be neglected in patients treated for a primary malignancy, especially when the long clinical period before the diagnosis of subsequent tumors has been taken for management. With careful monitoring, secondary tumors could be detected earlier, and, with appropriate intervention, might be better managed, without compromising survival. Our data could guide oncologists towards a closer follow-up strategy in the management of patients treated for common tumors. Availability of data regarding incidence of MPM, particularly those from developing countries is very limited and hence further studies are needed. SEER is working in this direction with an aim to define and develop appropriate and reliable criteria’s for synchronous and metachronous cancers. It is imperative that patient with a primary malignant tumors should be thoroughly closely, and regularly followed. Genetic counselling, risk estimation, cancer screening and chemoprevention must be emphasized. Appropriate cancer prevention strategy in with proper emphasis on synchronous and metachronous cancer needs to be designed and incorporated in the National Control Programme as multiple primary cancers have unique, biological behaviour requiring specific diagnostic and therapeutic interpretation [14].

To know more about our surgery open access journal click on https://lupinepublishers.com/surgery-case-studies-journal/index.php

To know more about our website click on open access journals publishers

https://lupinepublishers.us/

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Lupine Publishers | Can Bio-fertilizers Produced from Agricultural Residues Be Used In Hydroponics as an Alternative to Synthetic Fertilizers?

Lupine Publishers | Agriculture Open Access Journal

Abstract

Biofertilizer is the liquid effluent obtained from aerobic or anaerobic decomposition of organic matter in the presence of water, or to be more specific, it is the remaining matter left from the decomposition of organic compounds containing both single celled or multi cellular organisms (bacteria, yeasts, filamentous fungi and algae) and the metabolites they generate. Some of the statistics relating to Brazil’s increasing dependence on the use of pesticides in agriculture are quite concerning. For example, in the last 15 years, within the state of Ceará, incidences of rare types of cancer arose to 38% above the national average. Likewise, the sale of agrochemicals in Brazil grew 190% over the last 10 years, which is more than twice the world average. Of the 50 most commonly used pesticides in the Brazil, 15 of them are actually banned in Europe. According to the last Brazilian Health Regulatory Agency (Anvisa) survey, agrochemicals have been found in 67% of the foods analyzed (25% of which were banned). In view of this alarming reality, a change of attitude is not just necessary, it is mandatory. We need to change our philosophy regarding agricultural management on a national level, one that promotes viable agricultural methodologies to produce crops and livestock, which result in a more healthful humanity and a balanced, sustainable environment.

Introduction

In the last two decades, the production of food, which requires less synthetic inputs, has attracted the attention of both research and industry. A productive and relatively inexpensive process is the use of biofertilizers prepared from the aerobic or anaerobic digestion of organic materials as a substitute for mineral-based fertilizers, in order to contribute to reduced consumption of the natural reserves of nutrients on the planet. Our goal is to reduce our nation’s dependence on agrochemicals including pesticides and synthetic, inorganic and mineral-based fertilizers. In keeping with this thinking, we have cultivated lettuces (Lactuca sativa L.) inside a greenhouse using a self-contained hydroponic system, and have successfully utilized reused agricultural matter as a substantive growth promoting solution without the need for the addition of agrochemicals (pesticides or fertilizers). The herbaceous lettuce species we chose is one of the most cultivated vegetables in the country and is of great economic importance, generating quick profitability to the producer due to its short cycle from seeding to harvest [1]. We also selected this crop as it exhibits a wide adaptability to diverse climatic conditions and is one of the most produced crops via hydroponics and thus can be grown year round.

Case Report

For the production of our specific biofertilizer, poultry litter, orange bagasse and cattle manure were combined and mixed in several concentrations. The pH, electric conductivity, salt concentration, lactic acid content, total organic carbon, nutrients (N, P, K, Ca, Mg, Cu, Fe, Mn and Zn), organic matter content, humic substances, and health quality attributes (total thermotolerant coliforms, E. coli, etc.) were assessed for each of the biofertilizer blends. Phenol, carbohydrate and amino acid concentrations were evaluated as well. Phenols are derived from plant lignins, which are cross-linked phenolic polymers and are important for plant structure and rigidity. Carbohydrates are important for the soil organic matter cycle, and are easily hydrolyzed by microorganisms - representing 10-30% of the organic carbon in the soil. Amino acids are an essential nitrogen source and are generated by the aerobic decomposition process due to the hydrolysis of various proteins. Amino acids are also very beneficial throughout the plant life cycle and are essential to numerous physiological and biochemical processes (protein synthesis, phytohormone formation, water balance regulation, ion-chelation required for plant sustenance, etc.). Urease activity was also evaluated in order to evaluate the dynamics of agricultural material transformation in biofertilizers.

After 60 days of decomposition, the biofertilizers were filtered using a tow and stored in barrels. For application in hydroponics, the biofertilizers were diluted until the electrical conductivity remained around 2500μS cm-1. The most successful results were obtained using a mixture of poultry and cattle manure in equal parts as 20% (v/v) of the total composition (80% water). It can be concluded, based upon the quantitative analysis and characterization we conducted for all of the biofertilizer formulations we produced, are all in accord with the Ministry of Agriculture, Livestock and Supply, specifications, which requires determination of the properties of all potential commercial products. The biometric results we generated for the lettuce we grew under hydroponic cultivation show that use of biofertilizers contributed positively to the productivity of the crop. When the poultry and cattle biofertilizer, which showed the best agronomic potential, was applied to the crop, lettuces were produced which exhibited the best biometric results in terms of agronomic potential [2].

After 30 days of cultivation (see illustration) lettuces grew to 28cm (12 inches) of height and fresh shoot mass reached (24.26±2.87)cm and (150.70±9.94) g, respectively (Figure 1). Recycling of organic matter has the advantage of reducing costs when compared to synthetic fertilizers, it maintains the Organic Matter (OM) cycle, and is a supplementary source of nutrients. It is noteworthy that the poultry and cattle manure mixture did not produce coliforms on the lettuces when cultivated under specified conditions.

Figure 1:  

Discussion

However, at this time, these potential products would have to be further analyzed, tested and characterized to determine expiration dates, and currently there is no regulation or laws, which can be applied to the production of biofertilizers. Achieving these goals will require continued research and movement within the national legislative arena

https://lupinepublishers.com/agriculture-journal/pdf/CIACR.MS.ID.000134.pdf

For more Agriculture Open Access Journal articles Please Click Here: https://www.lupinepublishers.com/agriculture-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers

Lupine Publishers | Mineral Supplements of Soils

Lupine Publishers | Earth and Environment Journals

Abstract

Improving soil quality results in increased yields and benefits for farmers. Research has been carried out on the use of selected mineral waste collected in heaps to improve the quality of poor soils. The natural soil supplements obtained in this way will not only improve their quality and increase polonies but will also allow the liquidation of some of the heaps. This will contribute to the reclamation of the landscape and the environment.

Introduction

Soil and agricultural crops have been the object of multidirectional interests since ancient times. This is documented in scientific literature. Among other publications, a large part deals with those that concern soil as a source of nutrients for plants [1-5]. Another important field of research is publications on the role of soil fauna in improving soil quality [6-18]. Another research complex is geochemical research on the relationship of chemical fertilizers - improving the performance of soil with particular regard to the toxicity of additives, in particular those containing radioactive elements [19-24]. A lot of publications address the problem of the relation of fauna, and soil flora and its mineral composition [25-28] as well as the influence of mineral factors on the development of individual plant elements [4,5,29]. There are also publications on the use of organic waste for fertilization glkeb [30-33], the role of soil sun exposure in stabilizing its beneficial properties [34,35] and the use of the so-called. antagonistic plants [36,37].

A separate section is soil relations - geology [30,38-40], mineralogy - regulation of physical soil parameters including its water retention capacity [41]. Quite extensive literature concerns the use of natural minerals and rocks to improve the quality of soil and increase the size of crops from it [18,38-50]. It is in this trend that the presented publication is included, bearing in mind the impact of the proposed proceedings on possible environmental modifications [41,51-54].

Material and Methods of Research

The material for the research was taken from the profile of sediments found in the Devonian dolomite deposit exploited in the “Józefka” mine near Kielce (Figure 1). In addition, material from local heaps and granulates made from materials stored in heaps were collected for testing. In order to determine the mineralogical and petrographic characteristics of the obtained rocks, the following tests were carried out:

A. Microscopic examination in transmitted and reflected light. The Chinese production of Menij was used. The observed phenomena were documented with micrographs.

B. The analysis of the mineral composition of natural samples was made using the XRD method

C. In order to recognize the content of silty fractions and the clay minerals present in it, samples were sludged.

D. The analysis of the chemical composition of the obtained clay fraction was made using the XRD method

E. Analysis of the degree of quartz grain overlaying and SEM morphology of siliceous minerals as well as the non-standard qualitative analysis of the EDS spectrum (Figure 2.a & 2.b).

Microscopic Tests in Polarized Saint Lighting

Sand Muck

Structure: aurytowo-psamitowa, texture: compact, random Composition: quartz, min. clay, min. heavy, among which tourmaline was recognized (Figure 3). Degree of sorting of quartz grain on average sorted.

Figure 3: Microscopic photos of sandy silt. A: picture of rock at 1 polaroid, B: picture of rocks in polarized light. Visible quartz grains and brown tourmaline grain. Minerals are located in intergranular spaces.

Kaolinite Heel

Structure of silty claystone, texture, texture in places parallel, disturbed. The rock background is a very low birefringent kaolinite mass (Figure 4). In the background of the rocks there are almost exclusively clay minerals, accompanied by single quartz grains with a size of up to 20μm of quartz grain, columnar aggregates of kaolinite in places with a wormlike habit.

Figure 4: Photographs of microscopic kaolinite claystone. A: picture of the rock at 1 polaroid, B: picture of the rock in polarized light. Visible different orientation of kaolinite microaggregates manifested in the variable polarization blanking mode.

Molecular Muscovite Heel

The clay is a parallel texture made of kaolinite, smectite and muscovite (Figure 5). They are accompanied by single quartz grains.

Figure 5: Microscopic photos for kaolinite-muscovite claystone. A: picture in a non-polarized light, B: A photo in polarized light.

Figure 5.a: A: water columns

Kaolinite-Illitic Heel

Pellet structure, random texture, disturbed (flow processes) Mineral composition is a mixture of smectite and kaolinite (Figure 6). The microscopic examination shows that the overburden mainly consists of siltstones, sandy mudstones and claystone’s. The sediments are present next to quartz and clay minerals such as kaolinite and smectite also mica. Thanks to microscopic observations, several generations of quartz can be distinguished, as well as iron oxides and hydroxides responsible for the red color of the sediments.

Figure 6: Microscopic images of kaolinite-illite claystone. A: Image in natural light, B: Image in polarized light. in which the granulometric composition was determined. B: granulometric curve of the tested samples.

Analysis of the External Matrix of Natural Tests Used by the XRD Method

Due to the uncertainty of the clay components, the polarizing microscopy method was used to test the X-ray diffraction method. Analyzes of natural samples, clayey, prażed and glycolated fractions were performed (Graphs 1,1a,2, 2a,3, 3a,4,4a,5). They allowed to state that beside the detritus components in the overburden samples and heaps there are clay minerals represented by kaolinite and illite. X-ray examinations indicate that all overburden sediments and heaps occurring in the heap contain minerals beneficial for agriculture. They do not contain toxic minerals (Figure 5.a).

Graph 1: X-ray diffraction pattern of sandy silt.

Graph 1a: X-ray diffraction pattern for silt sand grain fractions. From the top: raw, roasted and glycolated preparation.

Graph 2: A diffractogram of kaolinite claystone.

Graph 2.a: X-ray diffractogram of clay fraction of kaolinite claystone. From the top: raw, roasted and glycolated preparation.

Graph 3: X-ray diffractogram of kaolinite-muscovite claystone.

Graph 3.a: X-ray diffractogram for clay fraction of clay-muscovite clay. From the top: raw, roasted and glycolated preparation.

Graph 4: X-ray diffractogram of kaolinite – illite.

Graph 4.a: X-ray diffractogram for clay fraction of clay-illite clay. From the top: raw, glycolated and roasted preparation.

Graph 5: X-ray diffraction pattern of dolomite-clay pellets containing quartz crystals.

Results Designated by Content of The Content of the Cross-Fraction on a Standing Water Post

In the case of two samples, the content of clay minerals (fraction <2 μm) in selected samples with extremely small and extremely high clay minerals were tested. They showed that the amount varies both in the overburden material and material from the heap from 3 to 64% by weight (Table 1).

Table 1.

Results of the Analysis of the Quarter of Quartz Grassing and Distribution of Minerals of Chlorine Minerals in Granulates SEM

SEM observations were made for both overburden and granulate deposits. Their distribution in pellets is of great importance as they favor the disintegration of granules and thus the dispersion of granulated material in the enriched soil. Clay minerals in overburden scales are present as aggregates of kaolinite or illite microcells (Figure 7). On the other hand, both on the heap and in the granulate, clay aggregates are degraded by micrometry (Figure 8), which means that in the process of stripping off, staying on heaps and in the granulation process, the clay aggregates disintegrate. This is a favorable phenomenon conducive to material granulation. After pouring on granules, thanks to such a construction, they undergo a faster process of foresting. thanks to which the ingredients of the granules combine with the glaze more quickly.

Figure 7: Kaolinite doline from the dolomite overburden. A: characteristic aggregates made of kaolinite tiles. B: one of the aggregates under magnification.

Figure 8: Granules, visible quartz grains (blue arrows) and dolomite (orange arrow) stuck together with clay minerals. SEM image.

SEM Images (Figures 9-11)

Figure 9: The heap of Józefek quarry. containing overburden rocks collected from the Devonian dolomites.

Figure 10: Granules with different granulation of soil supplements with different grain size, which were made from sediments accumulated in heaps.

Figure 11: Granular structure observed in the cross-section of granules. Visible dolomite grains in the clay anchor. A: magnification 10 x, B: magnification 20 x.

Summary

The performed research indicates that in the dolomite deposit of the Józefka deposit, rocks containing clay minerals from the kaolinite and illite groups as well as quartz, dolomite and calcite are present. The origin of these rocks is not fixed, but for raw material reasons, these rocks are suitable for enriching class IV-VI soils with clay minerals that can provide many ions and promote water retention in soil. Natural granules made from overburden rocks deposited on heaps and small dolomite fractions (waste) can be used as soil supplements enriching it with many elements, including magnesium. It is a beneficial stimulator of biological processes in plants. The use of the described granulates as soil supplements will increase yields, biologically strengthen growing plants and contribute to increasing harvests, and thus will increase the profits of agricultural producers. Both magnesium and other elements that will be delivered to the soil with granules will naturally become the building blocks of plant tissues. In the production and processing cycle, they will then be transferred to organisms using the bred plants. These soil supplements are completely natural and do not contain synthetic toxic substances. They are therefore environmentally friendly and human. The use of granules in the described form will not only strengthen the soil, but will also help to eliminate mineral heaps, favoring the reclamation of mining areas and restoring them to natural conditions.

For more Lupine Publishers Open Access Journals Please visit our website: http://lupinepublishers.us/ For more open access environment journals articles Please Click Here: https://lupinepublishers.com/environmental-soil-science-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Surgical Management of Multiple Nevus Lipomatosis Superficialis: A Case Report

Lupine Publishers| lupine publishers impact factor

Abstract

Nevus lipomatosis superficialis is a rare skin lesion characterized by the ectopic dermal deposition of adipose tissue. While benign, it typically presents in the second to third decade of life as regional discomfort. We present the case of multiple lesions requiring serial surgical management.

Presentation of Case: The patient was a 22-year-old male who presented with multiple, soft, warty lesions histologically consistent with nevus lipomatosis superficialis. He underwent excision of the largest mass and is undergoing multiple excisions for adjacent masses.

Discussion: Nevus lipomatosis superficialis is a rare connective tissue hamartoma of unclear etiology and multiple clinical subtypes. While management is typically surgical, efficacy of treatment options for multiple nearby lesions is not well characterized.

Conclusion: We review the literature for nevus lipomatosis superficialis and describe a case with multiple lesions of varying chronicity. Treatment must be chosen to optimize wound healing and cosmetic outcomes.

Keywords: Nevus lipomatosis superficialis; Multiple; Surgery; Skin; Excision

Introduction

Nevus lipomatosis superficialis (NLS) is a rare, benign hamartoma of the skin that was first described by Hoffmann and Zurhelle [1]. It is characterized by mature, ectopic adipose deposition in the dermis [2]. The classical form of NLS as described in 1921, is found on the buttocks, trunk, and thighs and described as multiple collections of soft, cerebriform, non-tender papules or nodules that are yellowish in color and may be pedunculated [3]. Solitary lesions have also been reported on the arms or scalp and are typically dome-shaped or sessile papules [4]. We report the surgical management in a young, otherwise healthy male with multiple pedunculated and sessile NLS lesions. Currently, there is no standardized surgical treatment for multiple nearby lesions.

Case Report

A 22-year-old white male presented to outpatient General Surgery with a 9-year history of a painless mass in the perianal region and left buttock. The mass gradually increased in size and was not associated with any skin changes over the surrounding areas. The mass had never been associated with bleeding, discharge, or itching. The patient reported a second mid-sized mass that had progressively increased in size over the past 4 years. Several smaller satellite masses had emerged in the past year. While the patient did have cosmetic concerns, the largest of the lesions was causing discomfort when sitting and requested the mass be surgically removed. Patients past medical history were unremarkable. Laboratory testing was wholly unremarkable and standard sexually transmitted infection screens were negative. He was not previously vaccinated against human papilloma virus. On physical examination, there was a 5.9 x 4 x 3.5 cm, fleshy, tanpink polypoid lesion arising at the 4 o’clock position approximately 2cm from the anal verge and extending 5cm along the radial axis of the left buttock. The largest lesion had a relatively narrow, pedunculated base and multiple papulo-nodules with a warty surface. Another, mid-sized sessile lesion similar in appearance was present 4cm lateral to the largest mass. Several smaller lesions were also present further lateral. All lesions were soft to palpation and nontender. There was no bleeding or discharge with manipulation. Differential diagnosis included anogenital warts and neurofibromatosis. The patient was offered surgical excision of the largest of the masses. Linear incision was made at the base of the mass, 2cm away from the anal margin radially out. Postoperative recovery was uncomplicated. Patient’s two-week post-operative check showed an appropriately healing wound (Figure 1). Pathology revealed nevus lipomatosis superficialis. There was no atypia or malignancy identified (Figure 2). Patient was subsequently offered serial-excisions for the remaining masses.

Figure 1:   (A) Post-excision of largest (5.9 x 4 x 3.5cm) polypoid lesion (B) Sessile, cerebriform masses of varying chronicity including a 4-year-old medium-sized mass. And © Multiple 1-year-old smaller, satellite masses

Figure 2:   Spotty Involvement of Dermal Adipose Deposition (Arrow) Creating an Irregular Zone of Fat Splaying Apart Dermal Collagen.

Discussion

NLS is a rare connective tissue hamartoma with altered epithelial elements with no sex predilection or familial trend [5]. While its incidence has not been reported, NLS descriptions are mostly limited to case reports. NLS may be congenitally present or develop later in life. There are two primary forms of NLS: the classical/multiple form and the solitary form. The lesions of the classical form are either congenital or fully form by the second or third decade of life [6], thought it has been reported to arise in the fifth decade as well [7]. Classical NLS is described as skin-colored papules that coalesce into plaques with cluster-like or linear distribution. Lesions are asymptomatic, unilateral, slow-growing over many years and may have smooth or cerebriform surface that is nontender [8]. Classical lesions most frequently distribute over the lower abdomen, the pelvic girdle, thigh, and gluteal surface. The second NLS subtype is the solitary form (pedunculated lipofibroma [9]) that may appear at any body surface and tends to affect older patients in the third to sixth decade of life [10,11]. The largest study of solitary form NLS is a retrospective case study of 13 cases in Tunisia [12]. A third, much less reported form of NLS is described as “Michelin tire baby syndrome,” an autosomal dominant deletion on chromosome 11 characterized by symmetric circumferential skin folds. These folds harbor underlying NLS and may affect the neck, legs, and arms; they are self-limited and resolve during childhood [13,14]. This is the first reported case of NLS with both sessile and pedunculated features with multiple lesions requiring serial surgery for optimal would healing and cosmetic outcome. Histologically, NLS lesions are classically characterized by ectopic mature adipocytes in the reticular dermis surrounded by dermal collagen fibers. Fat cells may extend to the papillary layer as larger fat lobules blur the boundary between dermis and hypodermis. Adipocytes may be either entirely mature or incomplete. The density of collagen, fibroblasts, and vasculature in the dermis is increased [15]. The epidermis can show acanthosis, elongation, rete ridge obliteration, hyperkeratosis, and hyper basilar pigmentation [16]. On electron microscopy, young adipocytes are of perivascular pericyte origin [17].

The etiology of NLS remains unclear. Originally, Hoffman and Zurhelle theorized that connective tissue degeneration incited dermal fat deposition [1]. In 1955, Holtz postulated that pericapillary lipoblast differentiated into mononuclear cells that grew into preadipose tissues. Others argue that focal heterotropic growths of aberrant adipose tissue occur during embryonic development [18]. Thus far, there have been no studies describing any cytogenic alterations in those with classical or solitary NLS, though Cardot-Leccia et al. [19] report a case of NLS with a 2p24 deletion. As in our case, NLS is typically asymptomatic. Ulceration has been reported secondary to external trauma or ischemia,11as well as café-au-lait macules, hypopigmented spots, leukodermic macules, and comedo-like changes may be present [15]. As such, the differential diagnosis for NLS includes condyloma acuminata, neurofibroma, lymphangioma, skin tag, Fordyce spots, granuloma annulare, and nevus sebaceous. Treatment for NLS is typically cosmetic, as malignant transformation is extremely rare [20]. Surgical excision, as in our patient, is the mainstay of treatment, as recurrence rate are low. Cryotherapy, ultrapulse CO2 laser ablation [21], topical fludroxycortide corticosteroids [7], and intralesional injections of phosphatidylcholine and sodium deoxycholate. Kim HS [22] have been reported as non-surgical options with positive clinical response. For optimal cosmetic results, patients with multiple, separated masses should be serially managed with adequate time for healing and scare formation after each excision.

Conclusion

NLS is a rare, benign skin tumor characterized by aberrant adipocyte deposition. While NLS is typically asymptomatic, lesions can cause discomfort and require surgical management. We report the case of a 22 year-old with multiple large lesions requiring serial surgery for optimal wound and cosmetic outcomes.

To know more about our Journal of Surgery click on https://lupinepublishers.com/surgery-case-studies-journal/index.php

To know more about our website click on lupine publishers impact factor

https://lupinepublishers.us/

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Lupine Publishers | Environmental Impacts of Hydropower and Alternative Mitigation Measures

Lupine Publishers | Agriculture Open Access Journal

Abstract

Hydropower is an important renewable energy resource worldwide. However, its development is accompanied with environmental drawbacks. The paper has reviewed the environmental drawbacks associated with hydropower projects. Change in hydrological flow regimes, deteriorating water quality, migration corridors barriers, sedimentation, greenhouse gas emission and biodiversity loss are environmental impacts of hydropower projects. Appropriate mitigation measures are required to sustainably generate hydropower. These are also discussed in the paper

Keywords: Environmental impacts; Hydropower; Mitigation measures

Introduction

There is no doubt about that the agricultural industry is the most essential one for humanity [1]. It also employs a great number of people, providing economic means to them. But it is not easy to answer whether the agricultural industry is an effective one. On the quite contrary, the industry is perhaps the least effectively managed one for the last several thousand years. As people in the world are enjoying longevity, the world consumes more and more food. Can the world’s agricultural industry feed all the people on earth? It is a vital question. If the earth capacity is limited and the crops are not produced enough, the only possible solution is to increase the productivity of the agricultural industry. In order to find ways to increase such productivity, we first have to understand why the productivity of the agricultural industry is so low. Then we can suggest how the agricultural industry changes itself to be more productive and effective. In this paper, we endeavor to answer the question from a value chain perspective.Hydropower is one of the most efficient power generation technologies, which are carbon free and use inexhaustible resources to produce the energy. The prime driver is the force of gravity and the water used to drive this power is non-destructive [1]. According to Yüksel [2] hydropower do not pollute the air we breathe in the way that the energy source does not produce any air pollutants. Unlike thermal power plants for example, there are no gaseous of fly ash emissions emitted during the production. The fact that hydropower often replace fossil-fired generation, it can therefore also be said that it is reducing the problem with acid rain and smog [1,2]. Despite all these advantages hydropower plants have, there may also be negative impacts. Lately the impact on the ecological aspects from the power plants has received attention. In the report from World Commission on Dams [3], it is stated that dams will have effects e.g. on the terrestrial ecosystem and biodiversity, the flow regime, migration of aquatic organisms, and can cause emissions of greenhouse gases. Bratrich [4] states that hydropower affects the flow regime, migration of organisms and transport of nutrients and sediments.

Abbasi [1] claim that hydropower plants causes major ecological impacts in all of the four different habitats, which are associated with the projects; the estuary into which the river flows, the downstream reaches of the dammed river, the reservoir catchment and the artificially created lake. Different research works from all corner of the world’s reported considering the negative effects of hydropower on the environments and calls for the importance of adopting of appropriate mitigation measures [5,6]. Therefore, to ensure sustainable development, various mitigation and enhancement measures have to be integrated at the early stages of project planning. Furthermore, appropriate mitigation measures not only for hydropower development that is newly planned and implemented in future, but also for the refurbishment and upgrading of hydropower plants which are currently in operation, need to be devised. The purpose of this paper is to review the impacts of hydropower on the environment and alternative mitigation measures.

Impacts of Hydropower

The hydropower projects have several impacts on the environment. Water quality decline is one of the impacts of hydropower and water quality may be affected around a hydropower plant [7]. Water discharged from a reservoir can be of a different composition to the water that is flowing into a reservoir [8]. The other impacts of hydropower plant are migrations barriers. Hydropower dams impede the flows of rivers and thereby affect the habitat of various aquatic lives [9]. Migratory animals require different environments for their different phases of their life cycle. Different stages are reproduction, production of juveniles, growth and sexual maturation. These different stages take place in different environments for different fishes [6]. Even if hydropower is a renewable energy source it is not an energy source without GHG emissions [5]. Greenhouse gas emissions can occur at three different phases hydropower plant (the construction, the operation and maintenance and the decommissioning of the plant). During the construction phase the emissions comes from the production and transport of the materials needed for the construction and from the work equipment.

In the second phase, the operation and maintenance, the emissions can come from e.g. heating or cooling systems and transportation for maintenance work [5]. Hydropower project also leads to sedimentation [10]. The natural carried sediment from the usual natural flow will be negatively affected [5,10]. Bergengren [6] states in their report that when constructing a dam or hydropower plant, changes in the hydrological regime will follow. IPCC suggest the same thing and claim in their report that changes in the hydrological regime is a significant impact from the hydropower plant. They argue that due to a hydropower plant there will be changes in water level, timing and temperature, which will affect the surrounding terrestrial and aquatic ecosystem [8]. The other biggest threats from hydropower projects are the loss of biodiversity and ecosystems that provides services that we cannot live without. The loss of valuable vegetative community types and loss of wildlife and habitats are resulted from land clearance and removal of natural vegetation [11].

Mitigation Actions

The purpose of environmental mitigation requirements at hydroelectric projects is to avoid or minimize the adverse effects of development and operation. Among the mitigation actions dam removal is becoming a more frequently used management option all around the world. Dam removal is taking into consideration for old dams in need of renovation or small dams that are no longer used or have lost most of their reservoir capacity. Another point of view is that dams and the reservoirs have many ecological effects; the disruption of the movement of different organisms is probably the most important reason for dam restoration. Thereby, dam removal makes it possible for fish migration and fish species to shift from lentic to lotic, which in turn have the ability to migrate and reproduce in free-flowing water [12]. Flow Regulations is also one the promising action for mitigating negative impacts of hydropower projects. In order to make the use of hydropower plants more compatible with the natural life of rivers, a minimum flow must be released so as to assure the preservation of the hydrological continuity of the river and the consequent conservation of natural habitat and ecological life [13]. Minimum flow release means that you allow some flow below a hydropower plant with the dual aim of maintaining current water ecological conditions and partly also for aesthetic or recreational purposes on a watercourse distance, which would mostly had remained drained otherwise [13].

The problem with sedimentation in the surroundings of the hydropower plant can be mitigated by constructing sedimentation measures such as the construction of small-scale weirs to trap the sands and the particles that later can be manually removed [14]. A direct approach to reduce the accumulation of sediment is to mechanically remove the sediments by periodic dredging [7]. Biotope Adjustments is also other migration action. Adjusting the biotope through the creation of greater environmental heterogeneity, by using such as habitat adjusting measures, the biological diversity of the benthic fauna will be strengthened [15]. Constructing migratory corridors are other mitigation actions for migrating animals. To facilitate for the migration of the species in the streams it is therefore desirable to construct corridors [11]. Fish friendly turbine technology is an emerging technology that provides a safe approach for fish passing though the turbines by minimizing the risk of injury or even death [8]. Aquatic animal Plantations is also other mitigation measures to reduce the negative effects of hydropower projects on the aquatic animals. Artificially manage the fertilization, hatching, growth and release of aquatic animal’s especially salmonid fish [16]. To introduce planted fish to protect endangered species or reintroduce species that have disappeared may be of great benefit to the environment and the biodiversity [16].

Discussion

From the above review, it is known that hydropower project have impacts on the environment. Change in hydrological flow regimes, deteriorating water quality, migration corridors barriers, sedimentation, greenhouse gas emission and biodiversity loss are environmental impacts of hydropower projects. Dam removal, flow regulations, biotope adjustment, fish plantation, sedimentation measures, constructing migration corridors and fish friendly turbine are alternative action for mitigating the negative impacts of hydropower projects on the environment [17]. Therefore, to meet the increasing demands energy and ensure sustainable development, various mitigation and enhancement measures have to be integrated at the early stages of project planning. Furthermore, appropriate mitigation measures not only for hydropower development that is newly planned and implemented in future, but also for the refurbishment and upgrading of hydropower plants which are currently in operation, need to be devised.

https://lupinepublishers.com/agriculture-journal/pdf/CIACR.MS.ID.000133.pdf

For more Agriculture Open Access Journal articles Please Click Here: https://www.lupinepublishers.com/agriculture-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   : https://twitter.com/lupine_online

Effect of Thermal Stress on Dairy Animal| Lupine Publishers

Lupine Publishers| Journal of veterinary science impact factor

Introduction

Thermal stress or heat stress can be defined as the sum of external forces to a homoeothermic animal that acts to displace body temperature from the resting state. Such a stress can disrupt the physiologic and productive performance of an animal. The increase in body temperature caused by heat stress has direct, adverse consequences on cellular functions. The livestock’s by homeotherms to the stabilize body temperature within fairly narrow limits is essential to control biochemical reactions and physiological processes within normal metabolism [1]. In order to maintain homeothermy, an animal must be in thermal equilibrium with its environment, which includes radiation, air temperature, air movement and humidity. Body temperature is regulated by modulation of metabolic heat production and heat loss from the body through sensible and insensible means. The deviation in ambient temperature below or above the thermoneutral zone (5- 250C) causes thermal stress to the animals. Cattle and buffaloes can maintain their physiological processes within the normal limits in an ambient temperature of 5-250C [2]. Hot humid season is more stressful to livestock species compared to hot dry season mainly due to lower evaporate and heat loss from the animal body. The evaporate heat loss takes place through respiratory tract (panting) and skin surface (sweating) in animals. Nonevaporate heat exchange occurs through conduction, convection and radiation and depends on temperature gradients between animal and surrounding environment and vice versa. Heat stress causes behavioral and metabolic changes and thereby reduces feed intake and metabolic activity and ultimately decline in animal’s productivity

Physiological effects of heat stress

Numerous physiological changes occurs in the digestive system, acid-base chemistry, and blood hormones during heat stress that leads to reduced nutrient intake, but many changes occurs as a result of strain in the animals. The temperature sensitive neurons which are located throughout the animal’s body and send information to the hypothalamus, which invokes numerous physiological, anatomical or behavioral changes in the attempt to maintain heat balance. During heat stress cows exhibit reduces feed intake, decreased activity, seek, shade and wind, increase respiratory rate, and increase both peripheral blood flow and sweating. These responses have deleterious effect on both production and physiologic status of the animal. Cows that were fed ad libitum in a thermal comfort environment, fed ad libitum in a thermal stress environment, or feed restricted intake in a thermal comfort environment had similar milk yields for both restricted intake and thermal stress treatments, and mammary blood flow tended to be lower compared with ad libitum feed cows in thermal comfort, suggesting blood flow was responsive to level of dry matter intake (DMI). The negative effects of heat stress on milk production is due to decreased nutrient intake and decreased nutrient uptake by the portal drained viscera of the cow. Which leads to blood flow shifted to peripheral tissues for cooling purposes may alter nutrient metabolism and contribute to lower milk yield during heat weather.

Metabolic effect

Heat stress causes reduced metabolism in cattle leads to reduced thyroid hormone secretion and gut motility, resulting in increased gut fill. Higher blood plasma content of epinephrine and norephinephrine with high ambient temperatures is an indicator of stress response and reduces rate of passage in the digestive tract. Slower passage rate can lead to greater gut fill and limited intake but improved digestibility because of greater residence time in the gut.

Effect on electrolytes and minerals

With increased respiration during heat stress, the expiration of CO2 exceeds the rate of its formation in the body. The partial pressure of CO2 of blood declines, creating a deficit of blood carbonic acid and resulting in respiratory alkalosis. This leads to elevated blood and urine PH and net acid excretion rate. The cow compensates for high blood PH by excreting HCO3 ions into the urine. Alkalemia depresses the rate of renal secretion of hydrogen ions, but increases the excretion of filtered HCO3, which subsequently leads to reduction in blood HCO3 concentration. Metabolic acidosis may occur if available Na in these regions is reduced, possibly increasing chloride absorption, draining HCO3 and increasing Cl in the plasma. Metabolic alkalosis may result from a reciprocal process.

During hot weather, declining DMI and high lactation demand requires increased dietary mineral concentration. However, alterations in mineral metabolism also effect the electrolyte status of the cow during hot weather. The primary cation in bovine sweat is potassium (K) and sharp increases in the secretion of K through sweat occur during hot climatic conditions. The absorption of macro-minerals, including Ca, P, and K, declined during hot temperatures and also the trace element requirements may increase with elevated environment temperature. Lactating cows subjected to hot climatic conditions and supplemented with K well above minimum NRC recommendations (NRC, 1989) responded with greater milk yields.

Effect on Reproductive system

Heat stress reduces the length and intensity of estrus through the involvement of hypothalamus-hypophyseal-gonodal axis. Heat stress can cause an increase cortisol secretion and block estradiol induced sexual behavior. There is an altered secrection of LH and FSH at the hypophyseal level and steroids (androstenedione, progesterone and estradiol) at ovarian level in heat stressed animals. However in certain experiments it has been observed that circulatory cortisol concentration were transitatory during heat stress animal. The major effect of heat stress are, decreases the expression of estrus behavior, because of the physical lethargy produced by heat stress.

Reduced physical activity its probably an adaptive response that limits heat production. The uterine and oviductal tissues may be compromised during heat stress for several reasons first, heat stress lead to a redistribution of blood from viscera organs to peripheral this result decreased perfusion of nutrients and hormone could compromise endometrial functions. Recent experiments suggest that heat stress can cause increase peripheral concentration of estradiol-17β between 1 and 4 days of estrus cycle and 11-12 of the cycle.

There are variation of hormonal responses to heat stress probably reflects the fact that ovarian steroid concentrations are depended not only rate to secretion from ovarian tissue but also On rate  of vascular perfusion of ovary or on metabolism in liver’s other organ. During heat stress the action of steroid hormone on reproductive tract become reduced because of increased synthesis of heat shock protein. Heat shock can lead to increased synthesis of HSP70 and heat shock protein 90 in endometrium. These protein are part of the complex of protein associating with progesterone and estrogen receptor. Increased synthesis of heats and protein might alter assembly, transport or binding of steroid receptor.

Conclusion

The effect of heat stress includes reduction in feed intake and estrus symptoms, suppression of rumination, alteration of reduction of Na and K level in rumen fluid of dairy animals, because of increased loss of Na in urine and K in the sweat. High environmental temperature may also affect the rumen microorganisms that synthesize B- vitamins, amino acids and fatty acids. Extensive research efforts made in past decades to mitigate the effect of heat stress in dairy animals. Generally, there are three fundamental managemental practices namely physical protection, genetic development and nutritional management have been proposed to alleviate the extent and severity of thermal stress in animals. Alteration of the dairy animal’s environment, genetic selection of more heat tolerance breed of heifers, nutritional management like grazing, balancing of ration, supplementation of bypass protein and bypass fat, antioxidant, use of neutraceuticals have been directed to reduce effect of heat stress in dairy animals and to improve the efficiency.

To know more about our website click on Lupine Publishers

https://lupinepublishers.us/

To know more about our veterinary science journal click on

https://lupinepublishers.com/dairy-veterinary-science-journal/index.php

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

Lupine Publishers | Pre-cochlear Implantation Aural/Oral Rehabilitation, Is it Mandatory?

Lupine Publishers | Journal of Otolaryngology

Abstract

Background: The use of cochlear implantation (CI) can fully restore hearing. Consequently, speech production can improve over time and enters the normal rang when traditional amplification Devices (hearing aids) are unable to restore access to the full range of phonemic components of speech, a cochlear implant (CI) is a widely used treatment option for children with sensorineural        hearing loss (SNHL).

Purpose: The aim of this study is to compare the functional benefit of the communicative skills of children with CI without pre-implantation aural/oral rehabilitation in relation to those with CI with pre-implantation 6 months aural/oral rehabilitation in order to compare the role of pre-implantation aural/oral rehabilitation on the communicative abilities of severe to profound and        profound sensorineural hearing impaired children.

Method: This study has a prospective design. It started after final diagnosis and decision that all children are candidates for CI but half of them are fitted with behind the ear hearing aids and the other half of children are immediately implanted provided that the primary language assessment before rehabilitation is present in the medical files of these children. A 2nd language assessment was done after 12 months of language therapy to detect the progress of the language development. These sixty patients were        divided into two groups:

a) Group A: Thirty children, who have used behind the ear hearing aids for one year before CI and attended regular language        therapy.

b) Group B: Thirty children, who shifted immediately to cochlear implantation, and were enrolled in auditory training and        language therapy for one year.

Results: Total language age of children using cochlear implant without pre-implantation aural/oral rehabilitation is significantly higher than that in the children while using hearing aids for one year before CI. Also, there is highly significant difference between        frontal and back speech sounds in the children after immediate implantation with positive correlation.

Conclusion: Cochlear implant is safe & reliable technique. The fact that many profoundly hearing impaired children using immediate cochlear implant without pre-implantation aural/oral rehabilitation can develop functional levels of speech perception & production, develop competency level in a language other than their primary language and continuation of language therapy        together with proper mapping accordingly is a must to enroll these children in main stream education.

Keywords: Hearing Aids; Cochlear Implant; Language; Speech Intelligibility Pre-implantation Rehabilitation

Abbreviations: SNHL: Sensorineural Hearing Loss; HA: Hearing Aids; CI: Cochlear Implantation

Introduction

Language in children begins to develop since birth and is nearly complete by the age of 6 years. Language skills, speech quality, expressive and receptive vocabulary are enhanced by exposure to aural language since as early an age as possible [1]. Children spend many hours in acoustic environments where target speech signals are embedded in competing sounds from multiple sources. In these environments, perception of target speech is assisted by a listener’s a listener’s ability to segregate the multitude of sounds into separate auditory streams, one cue to which is the angle of incidence of different sounds [2]. Children with profound sensorineural hearing loss (SNHL) experience delays in learning to understand the speech of others and to produce intelligible speech. There is solid evidence that moderate (or more severe) hearing impairment exerts a negative impact on speech, language, cognitive development, and early identification and management may be of great benefit to these children, through improved language, communication, mental health, and employment prospects [3]. The use of Hearing Aids (HA) or Cochlear Implantation (CI) can partially or fully restore hearing. Consequently, speech production can improve over time and enters the normal range. After hearing is restored, hearing impaired individuals use auditory feedback to adjust voice features such as voice intensity, intonation and vowel duration [4]. When traditional amplification devices (hearing aids) are unable to restore access to the full range of phonemic components of speech, a cochlear implant (CI) is a widely used treatment option for children with SNHL [5]. Cochlear Implants (CI) which are called as bionic ears are effective in trans- mitting salient features of speech, especially in quiet [6]. Because the goal of restored hearing in a deaf child is to enable useful hearing, a key measure of outcome should reflect how a deaf child’s experience with a CI develops into the effective use of spoken language. Parental surveys indicate that the outcome of their greatest concern after surgical intervention in children with SNHL is the level of spoken language achieved [7]. Cochlear implants have become a popular option for children with profound hearing loss. Evidence supporting the benefits of early implantation is found in experimental [1], developmental [2], and clinical cochlear implant studies [3]. The consensus is that children have the best opportunity to learn language during their first 5 years of life. According to [2], this critical period for language learning is particularly important in deaf and hearing-impaired children. Providing cochlear implants to deaf children at a young age may enable them to take advantage of this critical period for learning language and is likely to increase their chances for developing speech and language skills like those of normal-hearing children. Early implantation would also result in a decrease in the duration of auditory deprivation, a decrease considered to positively influence performance with a cochlear implant [4].

Objectives

The aim of this study is to compare the functional benefit of the communicative skills of children with immediate CI without preimplantation aural/oral rehabilitation in relation to those using hearing aid with pre-implantation aural/oral rehabilitation in order to compare the role of each amplification device and the effect of pre-implantation aural/oral rehabilitation on the communicative abilities of severe to profound and profound sensorineural hearing impaired children.

Subjects & Methods

This research was conducted during the period between the years 2017 and 2018. The study protocol was approved by the Otolaryngology Department Council of Beni-Suef University and Otolaryngology Department Council of King Abd Elaziz specialized hospital Jouf, Saudi Arabia. Consent to participate in this research was obtained from the subjects’ parents before commencement of the study. This study employed a comprehensive design to examine outcomes in multiple domains of communication in children who used either bilateral behind the ear hearing aids and preimplantation aural/oral rehabilitation or an immediate unilateral cochlear implant without pre-implantation rehabilitation for a period of one year. These were selected from children seeking language rehabilitation in Phoniatrics Unit, Beni-Suef University Hospital and children seeking language rehabilitation in Phoniatrics Clinic, King Abd Elaziz specialized hospital Jouf, Saudi Arabia. Shortly after confirmation of bilateral permanent hearing loss, thirty children were typically fitted with bilateral behind the ear hearing aids using the desired sensation level (DSL) prescription method and regularly attend aural/oral rehabilitation sessions. Thirty children underwent a comprehensive team evaluation for cochlear implant candidacy and received immediate unilateral cochlear implants without pre-implant aural/oral rehabilitation. All children received audiologic management and preschool rehabilitation and all children were enrolled in rehabilitation programs with a focus on the development of receptive &expressive language. Children were regular in Phoniatrics clinic, were asked to follow up auditory rehabilitation & language therapy program twice per week. Children with cochlear implants were followed every month for mapping of their speech processor and speech recognition testing. The study received ethical approval from the Hospital of Beni-Suef University and from King Abd Elaziz specialized hospital and written informed consent was obtained from all their parents. Collaboration between ENT clinic, Audiology clinic& Phoniatrics clinic was done in the form of ENT examination, audiological assessment, and language assessment and rehabilitation for all children. This study has a prospective design. It started after fitting half of the children with bilateral behind the ear hearing aids with aural/oral rehabilitation sessions and the other half of the children are immediately implanted, mapped, and regularly attended aural rehabilitation sessions provided that the primary language assessment before rehabilitate- ton is present in the medical files of all children. A 2nd language assessment was done after 12 months of language therapy to detect the progress of the language and the efficacy of pre-implantation aural/oral rehabilitation. These sixty        patients were divided into two groups:

a) Group A: Thirty children, who have used behind the ear hearing aids for one year and attended regular language therapy    despite those children, are candidates for cochlear implants.

b) Group B: Thirty children, who shifted immediately to cochlear implantation and had regular language therapy and were       enrolled in auditory training.

Half patients were fitted with bilateral powerful digital signal processing BEHAs and used them for at least a 12-months period before CI. Hearing aid use was determined by parental and therapist reports. After surgical implantation of the device and an adequate healing period for the other half of the patients, the implants were activated (usually 4 weeks after surgery). The children were fitted with one of the two brands of speech processors using a behind the ear controller. Speech processors used in this study were OPUS 2 with standard Sonata electrode & Cochlear Freedom Processor    with nucleus 24 k straight electrode.

In this study using Modified Preschool Language Scale & Subjective Speech Intelligibility Test gave us a summary of the improvement of these children. This is matched with other studies which focused that both comprehension and expression of spoken language are important markers of parent-perceived success of a    CI (Figure 1).

Language Improvement Quotient: The language improvement quotient [8] was used to compare between the rates of progress in language in order to overcome the bias of age        matching between the individuals in the study.

Language Improvement = 2nd language age -1st language age     divided by duration of language rehabilitation.

a) A1 refers to language development of group (A) after using bilateral behind the ear hearing aids for 12 months which is     calculated by this equation:

A1= 2nd language age -1st language age divided by 12(duration     of rehabilitation)

b) B1 refers to language development of group (B) after using unilateral CI for 12 months which is calculated by this equation: B1= 2nd language age -1st language age divided by 12(duration     of rehabilitation).

Speech analysis was performed using the Ain Shams assessment protocol which includes analysis of supra-segmental phonology (rate, stress and tonality), segmental phonology (consonants and vowels), nasal resonance and general intelligibility of speech. Assessment of auditory perception skills was performed evaluating a hierarchy of listening skills ranging from detection, to discrimination, identification, recognition and comprehension. Assessment of speech reading abilities was done and expressed as     percent change over time.

   Statistical Studies

Data was analyzed using SPSS, Statistical Package for the Social Sciences version 17 (SPSS Inc., Chicago, IL). Numerical data were expressed as mean, standard deviation, and range. For quantitative data, comparison was done using Mann-Whitney test (non-parametric t-test). A p-value < 0.05 was considered significant. Spearman-rho method was used to test correlation between numerical variables (r > 0.3 = no correlation, r = 0.3-0.5 =     fair correlation, r = 0.5-0.1 = good correlation).

Results

Group (A) are hearing aids users for one year, Group (B) are CI        users for 1 year. Demographic data of the 2 groups:

a) Age

b) Gender.

c) Incidence of hearing loss.

d) Psychometric evaluation.

e) Pure tone Audiometry.

f) First language age.

g) Radiology.

a) Age Distribution: Both groups are matched according to age. In group (A) the age of the children ranged between 3     years and 7years. In group (B). The age of the children ranged Between 3 years & 7 years, provided that all children were implanted before the age of 6 years.

b) Gender: No significant difference was noted in gender of        both groups.

c) Incidence of Hearing Loss: In group (A) there were 24 children (80%) with congenital hearing impairment and 6 children (20%) with acquired hearing loss, while in group (B) there were 18 children (60%) with congenital hearing    impairment and 12 children (40%) With acquired hearing loss.

d) Psychometric Evaluation: All children in group (A) had normal psychometric evaluation with a mean Value 87.5± 4.6; also, in group (B) all children had normal psychometric    Evaluation with a mean value 86.4±5.1.

e) Pure Tone Results: Pure tone results of group (A) maintained a mean value of 27.9 dB HL. Group (B). Decreased in mean values from 65.7±8.2 dB HL. There was a highly significant difference (P=0.001) between group (A) and group    (B) in favor of group (B).

f) First Language Age: Before start of therapy, both groups had no passive vocabulary and were Nonverbal. They used    either babbling or vocal play.

g) Radiology: All Children both in groups (A) and (B) were        having normal CT and MRI of Petrous bone.

Tables 1-3 demonstrate the progress of the language abilities, the auditory abilities and the speeding reading abilities of both groups, respectively, from the time just prior to the rehabilitation (either oral\ aural in group A or aural in group B) as compared to    the evaluation done one year the rehabilitation (Table 4).

Discussion

The primary purpose of this study was to obtain comprehensive data on the development of language and speech skills in a group of permanent hearing impaired children. This group shared the common degree of bilateral hearing impairment (severe to profound or profound hearing impairment), they all sought amplification, and they all sought language rehabilitation after receiving amplification using primarily auditory-based cues. The study aimed also to investigate the difference between the language and speech development under two amplification conditions; bilateral behind the ear hearing aids and unilateral cochlear implants. The choice of language age deficit to compare language skills development among the studied groups is justified by the fact that three variables usually co-vary when language results are analyzed in children; age of use of the amplification device whether hearing aid (HAs) or cochlear implant (CI), the language age before start of rehabilitation, and the language age of children after the time of rehabilitation. The difference in ages at evaluation places the younger children at a maturational and developmental disadvantage in comparison with their older peers. Thus, analyzing the results in terms of language age scores might put the younger group at a disadvantage. At the same time, analyzing the results in terms of language age deficits, although more reasonable, but still, in theory, puts the older group at a disadvantage because of the impact of their ages giving higher values for the deficit from the scored language age. That’s why the hypotheses of using the language improvement quotient [8] after determining the exact language age, may be more realistic and less biased by the chronological age differences at the time of evaluation. In this study using Modified Preschool Language Scale & Subjective Speech Intelligibility Test gave us a summary of the improvement of these children. A perfect model for comparing the results of both devices may be practically impossible, given the current indications of cochlear implant use. In this study, which was applied on two groups with comparable ages, a comparison was made between the outcomes of the 2 devices along a period of (re)habilitation of one year in their course of therapy. If the CI group were doing better than the HA group, it would indicate that the selection criteria were too conservative and some of the HA users might be better off with a CI. This raises the suspicion of the fact that HA users plateau after a period of little progress or at least their progress continue at a less pace. Cochlear implants may have a superior effect on the acoustic environment of children more than hearing aids. During the 90s of the last centuries, and using the early models of speech processes, studies proved that CI users gained better results than HA users in language and perception skills [9-14]. The minimum age for implantation has progressively reduced [15]. Advantages of cochlear implants over hearing aids extended also the adult population [15]. In a study by [16], they found CIs and children with HAs, aged 4 to 5 years, differ significantly on language abilities and there were differences in articulation skills in favor of the CI users. Advances in sound processors and related software have enhanced the fidelity with which complex sounds are processed into physiologically meaningful codes [17]. This study pointed to the importance of conducting comprehensive assessments when evaluating whether a child with severe to profound sensory neural hearing loss would likely derive greater benefit from a cochlear implant compared to a hearing aid. To date, only a few systematic studies have involved large numbers of children who received implants at various ages and have investigated both the effects of age at implantation and the amount of experience with an implant. Most of such studies were concerned with the speech perception skills after cochlear implantation with a clear evidence of the effect of early implantation on rate of acquisition of such perception skills when they are implanted at 2 – 4 years of age [18]. Concerning the auditory abilities, the progress imposed by the effect of cochlear implantation group produced better abilities than the hearing aids group in the auditory abilities. This may be explained by the fact that the hearing aids group were more rigid to their habits of relying on their visual cues making the children less efficient in acquiring the training proficiency provided to them during therapy sessions. In an explanation of this, [19] described recruitment of the auditory cortex by the visual and somatosensory systems in congenitally deaf humans. They reported that the extent of crossmodal recruitment of the auditory cortex increases as the duration of deafness increases, deterring the restoration of auditory processing in the auditory cortex of long-term deafened individuals after cochlear implantation. They also suggested that the age beyond which the effects of cross-modal plasticity in the auditory cortex are more difficult to reverse is about 6.5 years. It has also been documented that there is a change in the cochlear place code during development [20]. This may be necessary for the formation of normal and effective connections between auditory centers and for the proper development of elements within the central auditory pathways. Early cochlear implantation may contribute to the maintenance of these important developmental milestones.

Conclusion

CI children showed better rate of language acquisition skills along a one-year use of the implant compared to a similar period of HA group of HA users. The implanted group demonstrated significantly better auditory abilities, better speech production skills, and better speech intelligibility one year after implantation and with aural rehabilitation - than the aided group with oral\aural rehabilitation. The implanted group also ended with significantly less or no speech reading abilities than the aided group one year after implantation. These results indicate the favorable effect implantation over the previous parameters. Language skills shows a significant difference between the two groups. Consequently, oral\aural rehabilitation with hearing aids – even for few monthsis not mandatory.

For more Lupine Publishers Open Access Journals Please visit our website: h http://lupinepublishers.us/ For more Journal of Otolaryngology-ENT Research articles Please Click Here: https://lupinepublishers.com/otolaryngology-journal/

To Know More About Open Access Publishers Please Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online