#intro post
Text
Hey all! Again!
It's ya boy, Tom. My other blog got fucked, so I made this new one. I'll slowly transfer over to this one as time goes on, let people follow again. Just wanna find my moots!!
I'm from England, I'm 28, I post a lot about my horny thoughts and of me, but this time I've learned my lesson and will hold off on posting nut vids and gifs of my cock.
Kinks are: cnc, somno, breeding, public play, kissing, dry grinding, choking, slapping, knife play, some blood, biting, choking, sharing etc
Send me asks! Keep it civil though and not too weird. Don't come into my dms expecting things from me so quickly.
25 notes
·
View notes
Text
Introduction post!
Hello there! I'm SMG4, but you probably already know that. Well, you know our adventures? Well, how do i say this... It was all acting. Yeah, that's right! And for those wondering, yes, that means some of our friends such as Axol or Desti are still alive. (Yay!) Well, i don't really have that much to say, so i guess i'll be off- Hm? Oh you also want me to tell... Blog rules..? Okay then, Meggy, i'll do it.
First off, MxM shippers DNI, as admin @hearts4mizu/Snowy headcanons them as siblings.
Second, you may see ships such as-
SMG34! Oooo yea they gay- (//ooc: snowy here, i'm srry for how mario's mouth is so damn bright, it's the effect i used-)
Goddamn it Mario.
Anyways, aside from... that, we'll also get Axol x Melony, Meggy x Desti, Saiko x Tari, Marware (Mario x Mr Puzzles), Bob x SMG1, and others, i think.
If you don't like these ships it's fine, just don't go cry about it in the reblogs os replies, keep your hating to yourself.
Now i think that's all, see ya!
//characters available for asks:
SMG4
SMG3
Mario
Meggy
Tari
Saiko
Melony
Bob
Boopkins
Luigi
Axol
Desti
Niles
SMG0
SMG1
SMG2
Karen
Kaizo
Swag
Chris
Mr Puzzles
#smg4#smg4 fanart#smg4 mario#smg4 au#smg4 rp#smg34#marware#axolony#megdesti#saitari#smg4 actor au!#intro post
30 notes
·
View notes
Text
#art#mush artz#digital art#artists on tumblr#dont actually add me in#meeee#persona art#intro post#legend of zelda#umtv#Undertale#deltarune#tmnt#send asks#art requests appreciated
34 notes
·
View notes
Text
Hai! Im Em and welcome to my blog!
You can find my art under #my art!
22 notes
·
View notes
Text
— 𝐖𝐞𝐥𝐜𝐨𝐦𝐞 𝐭𝐨 𝐎𝐥𝐢𝐯𝐞’𝐬 𝐰𝐢𝐧𝐭𝐞𝐫 𝐥𝐨𝐝𝐠𝐞 ⭑.ᐟ
𝐂𝐮𝐫𝐫𝐞𝐧𝐭 𝐡𝐨𝐮𝐫𝐬 𝐩𝐨𝐬𝐭𝐞𝐝…
mon-tues[3pm-8pm]
weds-thurs[10am-9pm]
fri-sun[3pm-8pm]
𝟏𝟖+ 𝐌𝐃𝐍𝐈/𝐀𝐆𝐄𝐋𝐄𝐒𝐒 𝐁𝐋𝐎𝐆𝐒⭑.ᐟ
— 𝐁𝐚𝐬𝐢𝐜 𝐢𝐧𝐟𝐨.
olive. twenty-one. afro-latina. she/her. bokuto’s girl. Kuroo’s brat .ᐟ sae’s lover. pieck’s wife. satoru’s mija.
— 𝐑𝐮𝐥𝐞𝐬 𝐚𝐧𝐝 𝐑𝐞𝐠𝐮𝐥𝐚𝐭𝐢𝐨𝐧𝐬
⤷ ⤷ ⤷ 𝐑𝐮𝐥𝐞-𝐁𝐨𝐨𝐤 ⭑.ᐟ ⤶ ⤶ ⤶
©2024 𝐄𝐖𝐓𝐇𝐀𝐓𝐒𝐇𝐎𝐓. all rights reserved. please do not copy, modify, or translate my works onto other social media platforms.
#blog intro#intro post#haikyuu x reader#jujutsu kaisen x reader#jjk x reader#aot x reader#bllk x reader#blue lock x reader#eren yeager x reader#toji fushiguro#suguru x reader#sae itoshi#nagi x reader#armin arlert#gojo satoru
30 notes
·
View notes
Text
What's this? An introduction so good it got a critically acclaimed sequel?? With New Content?!?!
Hi there! Welcome to my Stanley Parable Side Blog!
My name is Oswin, though you can call me Ozzie or Oz. My pronouns are He/Him, I am 19, and I am Filipino!
I draw, animate, act, and play video games. I stream on Twitch occasionally, as well as post on Youtube, and Instagram. I also have a Carrd too if you're interested.
This is my TSP sideblog! I have other interests that I post about on my main @oswinunknown if you ever want to check those out, but this blog will contain all TSP related stuff (and Narrator Adjacent)
[The Narrator (Virgil) Design Iterations]
3.0 (Most Recent!)
2.0
1.0
[Other Designs]
Timekeeper/432
Curator
Adventure Line (Lynne)
[IMPORTANT]
If you're wondering why my inbox, mentions, and replies are disabled at the moment. Please read this post for full information. (Its not long, I promise. It is very important however so I would encourage you to read it.)
[For more information on tags, F/Os, RP sideblogs, and More, Check under the cut!]
[Active Tags]
#artswin is all art. including animation
#animswin is animations specifically
#oz rambles is just for words.
#ozzie plays games is for video game stuff.
#narry blog is for when i interact with my RP narrator blog.
#tsproadtrip is all posts relating to the TSP roadtrip thread.
#narry takeover & #narry takeover 2 is for the old narrator-blog-takeovers pre!RP blog.
[F/O's]
[I ship these F/Os with my Self-Insert Sona/OC more than myself IRL. They are all platonic F/Os / Close Friends*]
The Narrator (The Stanley Parable) [BFF/QPR]
Mayor Damien (Who Killed Markiplier) [Platonic]
Gordon Freeman (Half Life) [Platonic]
Wheatley (Portal) [Platonic]
[* The Narrator is my primary F/O, specifically my Narrator who acts as my Best Friend/QPR Bestie. I also pretend like he is real sometimes as comfort. If you wish to ship yourself/an oc/your sona with him, please let me know beforehand!]
[RP Sideblogs] (ALL UNDER HIATUS)
@mrthenarrator my TSP Narrator blog. (ON HIATUS)
@theadventurelynne my teen!Adventure Line blog. (WIP/ON HIATUS)
My main blog is @oswinunknown. For more information, as well as my other interests, check there!
[Also, here's the original Intro Post if you want to see what the Sequel is building up from here askjhd]
#intro post#blog intro#pinned post#introduction post#remaking this post with more information#plus a meet the artist bc ive never made one of these before!#meet the artist#artswin#im organizing this blog sdkjfh
19 notes
·
View notes
Text
Welcome to tumblr's own AITA!
The askbox is currently: OPEN
Please submit your own stories to be judged by the court of tumblr! Each story will come with a poll, judgements are as follows:
YTA=You're the asshole
NTA=Not the asshole (the other party is)
JAH=Justified asshole (you’re an asshole, but like, I get it)
NAH=No assholes here (everyone is some level of justified)
ESH=Everyone sucks here (you're all assholes)
INFO=Not enough information to judge (answer questions via reblog or reply, NOT my askbox please!)
Ready to submit yours? Read the FAQ first! (If it doesn't open for you on mobile, try opening it in your mobile browser instead of the app)
I've been talked into making a ko-fi, no pressure but if you want to throw me a couple bucks for keeping this train running, feel free to buy me a coffee! Never expected, always appreciated
20K notes
·
View notes
Text
This early 2010s tweet is an eternal mood
1K notes
·
View notes
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
#hellsitegenetics#faq#intro post#flowers#plants#requests#birds of paradise#asks#remember to keep checking back!
1K notes
·
View notes
Text
Hi, New People?
For some unfathomable reason, Tumblr has decided to suggest my blog to brand-new accounts to follow, so I've had a crazy influx of followers who, of the ones that are genuine accounts, probably have no idea what they've signed up for. (sorry.)
Oh, and I also have some new bittern-loving followers who have a slightly better idea but might not know the whole story!
So, here's your chance to escape, if you so choose.
Anyway, I'm Bob! I've been here since like 2012. I mostly make comics, but I also do some prose writing, game dev, and general shitposting. Should you choose to continue following me, you will be subjected to such content as
Canada geese.
Like... a LOT of Canada geese.
Also ferrets, the love of my life. And other art and general musings about my favorite animals, including but not limited to bitterns, grebes, pheasants, parrots, crayfish, eels, every single other type of mustelid, alpacas, etc.
But, because I can't be bothered to make myself a consistent "brand," I also make
Very Gay Comics.
I can't emphasize this enough, because I kinda suspect all those plumbing company blogs didn't know this before following me. I make very gay comics.
I'm working on a new webcomic called Into the Smoke that's gonna launch soon. It's about a gay medium who binds himself to a killer ghost, and I think my new follower with the car financing blog is gonna love it.
Lots more on that soon.
Anyway, I don't want to make a super long post. I just want to make sure y'all understand that if you follow me, you will get
Canada geese
and
Very Gay Comics.
Cool? Cool.
#huh maybe i have a brand after all#artists on tumblr#intro post#I thought they were ALL spambots till I made a new test account and was prompted to follow myself before I could even set a user pic#so I’m sorry if I blocked any actual accounts before that#but not sorry to the ones that clearly were spambots
869 notes
·
View notes
Text
Stardoomed is an 18+ drama/romance interactive fiction novel set in Los Angeles. Focus on relationships and avoid falling into bad habits; the road to fame is more filled with pitfalls than you ever imagined.
When destiny leads you, a newcomer to the world of K-pop, to become the last member selected for the most anticipated new group, Next Gen, the journey to fame seems like a dream come true. But behind the bright lights and smiles on stage, dark secrets and overwhelming challenges lurk.
Each member of Next Gen faces their own demons as they struggle to stay afloat in a world that loves and hates them in equal measure, a world to which you now belong. You'll be drawn into a whirlwind of drama, romance, and friendship as you navigate the complexities of life as a new idol.
With the fate of the group and your own career at stake, you'll have to make tough decisions, face your deepest fears, and discover what it truly means to achieve greatness in a world where success can be as fleeting as a star.
Are you ready to live the dream?
CW: explicit language, sexual themes, discrimination (homophobia, transphobia, racism), substance abuse, non explicit violence.
✦ Play as a male, female, straight or queer, question your gender, and challenge the world for something you didn't choose.
✦ Full customization: personality, appearance, style, nationality, and just like in real life, be judged by how you look.
✦ Choose your role in the group, are you a dancer or a rapper? perhaps a talented singer? or maybe... nothing.
✦ Become part of one of the most promising K-pop groups of the decade.
✦ Face the true face of the industry.
✦ Succeed as an idol or pursue your true dream, be a painter, an actor, a CEO—the choice is yours.
✦ Fight against your projective mother to regain control of your life or give in to her whims for a bit of her affection.
✦ Embark on a forbidden romance with one of your three group mates or the company staff, either way, they'll fire you when they find out.
✦ Meaningful decisions. Here, everything matters, even your weight, unfortunately.
✦ Choose between your mental health or stardom.
✦ THE MAIN CHARACTER
The fourth and final member of Next Gen seems to be more about luck than talent. Insecure, repressed, and with questionable mental health, they will need to learn to put themselves first and take control of their own life, even if it means destroying the almost nonexistent relationship with their mother.
✦ NIKO / NIKA ROMANOV [ro; m/f] see more
One of the choreographers at HYPE. Contrasting with their rough appearance and tattoos, they are a kind and warm person who, although their smile never fades, carries the weight of their past with them.
"Leave it all behind."
✦ HANNY / HANNAH SONG [ro; m/f] see more
Talented beauty blogger and one of the main makeup artists at HYPE. Cheerful, shy, introverted, and full of colors, they are as beautiful on the inside as they are on the outside. It's a pity they don't think the same.
"There's always a reason to be grateful."
✦ DEVON DILLARD [ro; non-binary] see more
A music producer at HYPE, with a distinctive style and incomparable talent, they have broken barriers and more than a dozen hearts. A free soul is what they are, and all they want is to have fun. Although you are increasingly convinced that everything is a facade.
"I'm too sober for this shit."
✦ JIHOON / JIWOO CHO [ro; mcs gender] see more
The charming vocalist and center of Next Gen. Charismatic and with an incredible sense of fashion, they have risen and made a mark in the industry. However, fame has its price, and forgetting who they are was what they had to pay.
"I dress to impress me."
✦ NIRA [ro; mcs gender] see more
Perfectionist is an understatement. Leader of Next Gen and main dancer, Nira is as demanding as they are talented. Some call them a prodigy, and yet it has never been enough. Perfection doesn't exist; that's something they soon have to face.
"My only competition is my potential."
✦ DANIEL / DANIELLE HAN [ro; mcs gender] see more
As outgoing and affectionate as a Husky, Dani is the main rapper of Next Gen. A streamer and gamer turned idol, not a bad combination… right? Well, it seems that things aren't so fun with a contract involved.
"My life is full of exciting possibilities."
DEMO [TBD August-September] | COG FORUM TBA |
#interactive fiction#interactive novel#stardoomed if#current wip#choice of games#choicescript#if game#if wip#dashingdon#intro post#if#hosted games#interactive game#cog demo
432 notes
·
View notes
Text
you're a wanted person. that isn't new to you, but after years of working, someone. no. something is after you.
you were taught by the best, your mother, she was an amazing woman but she was too trusting and in the end, that was her downfall. you won't make that mistake. you're a killer, but a righteous one. you kill those who deserve it, the disposable.
with your abnormal abilities, of which only twenty-five percent of the population is gifted with. you can succeed in what she was never able to do, rid the world of sinners.
you work for the slaughterhouse, a bar... with a dark side; in a rowdy part of the city. your mother was the owner but she didn't pass it down to you, she passed it your younger twin siblings. she believed you were far too talented to sit behind a desk, dealing with paperwork.
you've traveled all over the world, exterminating. you've claimed plenty of people, but perhaps this time you went after the wrong one. having no other choice you flee back home, but you aren't safe there either, you never are.
play with a customizable mc [gender (male or female), physical appearance, personality, sexuality]
protect those you care about or turn your back on them when they need you.
romance, befriend, or make enemies between any of the sixteen characters. four gender selectable, six male, and six female.
decide what supernatural ability you were gifted with; telepathy, telekinesis, or teleportation [figure out how to develop it and what other ability you have]
define your mc's signature weapon, fighting style and overall skillset; how you feel about killing, and the supernatural abilities you were gifted with.
this story is rated 18+ for sexual themes, substance (drug and alcohol) use, explicit language, and violence. [more themes might be added later]
the tattoo artist [male or female] [ro] wren price – partner in crime. they've been by your side since you can remember. always with a bright smile and cheeky remarks, you can't think about how your life would look without them. though they act differently with others, more serious, with a glint in their eyes you can't quite figure out. they never look at you like that.
the bodyguard [male] [ro] theodore price – the older brother of your best friend. there's no doubt in your mind that they're related. he's protective over you, although you can't hold that against him as that's what he does for a living. protect people. he's hard to get to know on a deeper level and you can't help but wonder what's going on in his mind.
the detective [female] [ro] rori hayes – now, if you weren't yourself, perhaps you could have been friends with her. but unfortunately for you... she's extremely suspicious of you and set to bring you to justice. she's recently been promoted and she cannot afford to fail, not when her family is counting on her.
the chief deputy sheriff [male] [ro] charles butler – good ole charlie, you're acquainted with each other. he can't say he isn't a little impressed with you. but you're endangering the citizens of his city and that includes his little girl. he may not have any evidence on you but you need to be brought down, and he's going to be the one that books you.
the model [male] [ro] julien ripley – son of the sheriff. he always looks uncomfortable with his own father. he’s never talked to you before and you’re almost positive he has no opinion on you. he’s a very well known face, although you can tell he doesn’t like being stared at and overall talking to anyone. *male mcs only
the journalist [female] [ro] sloane campbell – she's fast alright and always seems to know your moves. too bad she isn't on your side. always trying to announce to the world, where you are and what you're planning to do next. good thing she's overlooked at her job, consistently being handed stories that, even you know, aren't going anywhere.
the bartender [male or female] [ro] hale/hart vaughn – a family friend, and your sister's best friend. with their tantalizing words, they don't know the meaning of being serious. they are quite insufferable and you can't seem to be able to get rid of them. you have a feeling if you did, your own sister would come after you.
the florist [female] [ro] paris graham– at first glance she doesn't appear to be anything special, but that would be wrong. she's a firework waiting to explode and you want to be there when it happens. her work doesn't suit her but you have a feeling, that being a florist isn't all that she does. *female mcs only
the apartment owner [male] [ro] nolan adams – he knows about you and what you do, but he doesn’t give off the feeling of someone who’d go running to tell. you’ve always come back to lay low at his apartment complex when you need to and as long as you pay on time he doesn’t care what you do.
the actor [female] [ro] ophelia wylie – a face from your past, one you can’t say you particularly enjoy facing again. she seems remorseful for what she did to you, in fact she looks like a completely different person and she’s offering to help you, but for what in exchange… after all, no one gives anything for free.
the crime lord [male] [ro] louis foster – of course you’ve heard of lou, you’d be an idiot if you didn’t. he's tried and failed to recruit you and he never fails. you’ve been warned before, it would be a mistake to make an enemy out of a king.
the informant [male] [ro] vincent sutton – it’s rare to ever see him out, only ever seen accompanying lou. if you had the ability to feel fear, you’d fear him. he shows every sign of being against you, but then again, it seems as if he does that to everyone around him as well.
the chef [male or female] [ro] mateo/melanie olsen – you see them quite often, as their restaurant is one of your favorites. they always serve you with a smile and if they do know you, they play oblivious. they're just happy to have a customer who enjoys their food.
the doctor [female] [ro] eileen yates – serene and calming, a voice who always knows exactly what to say. she may look innocent but she’s far from it, you’ve known her for years yet you don’t truly know her, for all you know eileen may not even be her name.
the accountant [female] [ro] felix price – the youngest of the price siblings, she helps out with all the money coming into and out of the slaughterhouse. she’s always been compassionate and reasonable. you can't imagine her hurting a fly.
the rival bar owner [male or female] [ro] kinslee dean – they own a bar just a couple streets down from yours. it’s always been a problem and they’re actively trying to shut down the slaughterhouse. but they’re surprisingly level-headed and want to 'handle' this problem with logic.
the owner of the slaughterhouse [male] archer – your younger brother, he’s honestly kind of a mess. he was not ready for this responsibility but he’s trying. the mischievous boy you grew up with, you don’t know where he is anymore.
the owner of the slaughterhouse [female] iris – your younger sister, she’s always been loud and bold. but she’s changed too, she’s calm and collected. she’s trying her best to help her brother along too.
the sheriff [male] lazlo ripley – a pompous man with nothing else to do but terrorize those he thinks are inferior to him.
DEMO [Coming Soon]
warning: this story is still under development, all elements are subject to change!!
#gold dust#gold dust if#if wip#writing#interactive fiction#interactive story#interactive novel#intro post#upcoming if#choice of games#cog#choice script
674 notes
·
View notes
Text
Welcome to Ordinor Ultor!
You’ve ruled the Duchy of Akize, the southwesternmost duchy in the Kingdom of Ribaur, for 15 years, since the year 1107 ME.
15 years ago, your Liege had your parents executed for a plot they had no part in.
Despite becoming a ruler while only a teenager, your lands have done well - no thanks to your Liege’s proclamations. Despite the annoying interference, you would have been content to just administer your lands and pay your taxes.
But one day, your Liege goes too far, and wrongs one of your siblings - personally.
You’ve had enough. You and your siblings will chafe no longer under the yoke of that tyrant. You will be free from oppression - whatever it takes.
Choose your character's name, the name of their noble house, and whether they are a Duke (male), Duchess (female), or Dux (enby).
Choose which foreign land your mother hailed from - such as the northern court of Ostroway or the island nation of Sayland.
Pick the type of education you received - were you taught how to use the shadows of Intrigue? How to construct Martial strategies? Or something else?
Interact with your friends and family, possibly including your foreign cousins.
Choose how to deal with your Liege - will they be put on Trial, will you lead an armed Rebellion, or will you take to the shadows to have them Assassinated?
Pick from four gender-selectable ROs - two fellow vassals and two foreign nobles.
Deal with various interest groups - such as the Peasants you rule over, your fellow Vassals, the religious head known as the Hierophant, and more.
Ordinor Ultor takes palce in a low(ish...) fantasy world, with the protagonist's home country of Ribaur being inspired by medieval France.
I'm relatively new to coding, so I can't promise a concrete update schedule yet (also, if anyone has any advice and/or resources for me to use, I'd be very grateful!). That being said...
FIRST DEMO OUT
I hope everyone enjoys!
635 notes
·
View notes
Text
You're dead.
Or, at least, you should be.
You remember what it felt when the bullet pierced your chest, the blood rushing out too fast, too much to stop.
The man in red smirking above you.
And yet, here you are. Alive. Safe in bed.
One week before the day of your death.
Redo; Rewind is a story about time. Of an ordinary person working an ordinary office job. Sure, you might work for an info broker and, sure, you sometimes (often) commit acts of corporate espionage for said job, but that's just business.
This is something far beyond that ordinary life.
Time travel. It seems you of all people are capable of it. To manipulate time and bend it to your will. It may not be something you asked for, but you need it now more than ever.
Someone wants you dead. And they've already succeeded once. You can't allow it to happen again.
(Please note that Redo; Rewind is currently rated 18+ for depictions of violence/death, references to drug and alcohol use, explicit language, and heavy themes.)
Play as a customizable MC! Choose your MC’s appearance, gender, skills, and more!
Romance, befriend, or antagonize any of the 3 romance options.
Learn how to master your time control ability and use it to your advantage.
Avoid past mistakes and inadvertently come up with new, much worse ones!
Try not to die. Again. And again. And again...
Victor/Victoria Zhang [M/F] - Your boss and owner of VZSystems, the front for their true work as an info broker. Clever, professional, and cold—a classic business major. That's how they appear, anyway. Having worked for them for sometime now, you know that, despite their intimidating appearance, they hide a much softer side underneath. Will you maintain the status quo as employer and employee, or will you cross the boundary set by your positions?
August Astaire [M] - Hitman, assassin, whatever you want to call him, the man's a killer. That much is clear after he put a bullet through your chest. But is that all there is to him? As arrogant and cruel as he seems, you can't help but wonder if there isn't more to him than meets the eye. Maybe if you play your cards right you could even turn an enemy into an ally. But, even if he plays for your team, how much can you really trust him?
Amara Ingram [F] - Your coworker of about two months now. You don't know her well yet, but she seems genuinely kind, with a good sense of humor and a sharp mind. Since being hired, she's quickly earned her place, proving to be an invaluable asset with her skill in engineering and programing. Undoubtedly, someone you're glad is on your side, but could your feelings for her extend beyond the professional?
[Demo] - Available Here! (Last update: March 23rd 2024)
[ROs] - Additional Details Here!
#interactive fiction#interactive novel#twine if#twine wip#cyoa#if wip#intro post#redo; rewind if#redo rewind if
701 notes
·
View notes
Text
👥DEMO 👥 PLAYLIST 👥 PINTEREST 👥 COG FORUM
You keep having the same dreams over and over. It happened, years ago, before you left. You thought you had left Eastend behind for good.
It seems you can never truly escape your past. The Priest had warned you.
There's a girl you've never seen in your dreams. Yet, she seems so familiar - as a forgotten teddy bear you left in the attic of your home. She feels right, she looks wrong, she's wrong. Because she's not you, she says. And the two of you stand on the road...a bright light blinds you but the smell of iron reaches you. You do not need your eyes to deduce the ending of the nightmares.
Metaphorical dreams have never been your forte...except this is real. On the day you arrive, she's still alive. And smiling...laughing...walking with her friends. She looks like a normal girl of your age.
You black out - from the shock you think. The familiar iron smell being all too close, it makes you nauseous. At least, the earthen scent that lingers on your clothes counters it a little.
Why are you in the woods again?
....Why is there blood on your hands?
Welcome home, whispers the wind.
• Customize the vessel whether be it in looks, personality or identity.
• You are free to romance four of the cast. Maybe more, there are many eyes on you.
• Your choices will shape you as they shape the town. They will have consequences on the people around you and those who aren't anymore. Be careful you never know what effect the ripples may have.
• Explore your past to shape your future.
• Fight your nightmares should you be so inclined - or welcome them, there might be surprises in the deep dark part of your mind?
• Choose whether or not you'll doom your childhood town - although, that might not be left to you. Leaving is an option too, after all, you've already left once.
• Survive - or don't. You didn't think you were the only one who could save them, did you?
Eastend is rated 18+ for sexual themes, substance use, explicit language, explicit violence, death and more.
Beverly Arevalo [F,23], your childhood friend. At least, one of you perceived it that way. She has always been difficult to read and understand, you were one of the few who could years back. Maybe you can rekindle your friendship - maybe it will grow into more. The only thing you know for certain is that there are many unknowns surrounding Beverly.
Aina Valen [F,26] is that stereotypical preppy girl, at least what you know of her. You were never quite close when you still lived in town, but things have changed and so have both of you. Surprisingly enough, she works at the library now, having taken over her brother. You're not aware of what happened between them, only that she seems overly bored whenever you pass by the vitrine. At least she insists on telling you you are the 'spice' of her days, whatever that may mean.
Benjamin Li [M,26] his preferred nickname, Benji has always shown kindness to you and this didn't change with your unexpected return. He somehow always has a nice word for you or others in his vicinity, it's refreshing quite frankly. There are always critters following him around but they say animals are good judges of characters so that's a good sign, right?
Hezekiah Lyncroft [M, 24] was always a pain in your ass, even younger. Always arguing with you over anything and nothing, he was the reason for many headaches. Back then, there were rumours about his home life, ones you remember well. At least, he seems to be in a better place nowadays, even though he's still a pain to be around. But not all pains are bad.
+ familiar faces and strangers you've yet to meet
Demo stands currently at 5.8k words. It is meant as short introduction to the setting and story. Hope you enjoy despite the length :)
#interactive fiction#interactive story#interactive novel#interact if#if wip#if intro#intro post#choice of games#cog#choose your own adventure#eastend if
519 notes
·
View notes
Text
Project DARK is an 18+ character-driven SPY IF inspired by a rather eventful weekend binging on Mission Impossible movies. It can be described as Suicide Squad meets Mission Impossible. MC, a retired villain, will be a new operative in a team to bring down their old best friend.
You were a jewel thief and hired mercenary, outsourcing your skills at thievery and espionage for all types of...shady characters. Yeah, you were aiding in the possible destruction of the world in exchange for money, but details, right?
You were the best in the business alongside your partner, Spider. You're not supposed to get close to people in this business, but Spider somehow weaseled into your life and became your best friend.
But then they died, killed by operatives of Mission Shadow, the one organization that has been hunting you down since day one. You decided to retire, changing your name and identity in an attempt to make an honest and private life of what you have left.
Until Project DARK finds you.
Project DARK: an experiment to put the most together the most skilled shadow villains to train and defeat the biggest threat they've faced.
Your best friend, whom you thought was dead.
They need you and your skills. You know Spider best. No longer are you the villain, but a Project DARK operative joining as the newest recruit to the ranks.
Good luck.
Customize your operative from appearance, personality, gender identity.
Tailor your past: were you a merciful villain, or a merciless one? Did you make enemies or try to make friends? Liked for being kind and easy to work with or hated for being the literal worst?
Romance members of your team or your target, with some having special relationships.
Choose what kind of operative you'll be and shape the dynamic of the team.
Try not to fall into old habits and get sucked into the dark world of crime. You left that life for a reason.
THE TARGET | Spider [m or f]: your old best friend and the new target. They've been busy since their 'death' and have grown a network of connections that can dismantle the world as you know it. They're apparently planning something big. Big enough that the organizations of the world created Project DARK to take them down.
Special romance: can have had previous thing with them that was never confronted or simply have been best friends.
THE LEADER | Elias/Elena Steel: one of the best operatives, personally recommended by MI6. The only non-villain on the team, E is also appointed leader and doesn't like you much, considering the fact that a mission of yours ended with their closest partner dead. While you may have not pulled the trigger, E blames you all the same.
Strict and as cold as steel, it makes sense why E is the one with the team on their shoulders.
Special romance: enemies to lovers. E hates your guts.
THE SECOND IN COMMAND | Nick/Nina Sharma: second-in-command and a retired illegal weapons dealer, N is, surprisingly, E's closest friend. N has long given up that life, but before their new work as a operative, you knew them as a distant associate. You two have crossed paths on multiple occasions, most of them happening with them almost killing you or vice versa. N can't help but be nice, but you can tell they're not really a fan of you.
Special romance: may have had a lapse in judgement and have had a one night stand...or multiple.
THE BRAINS | Zane/Zena Omari: One of the most skilled hackers and a familiar face on the FBIs most wanted list, Z is on the team in order to be able to go back home without getting arrested. Oddly enough, they're not what the media says they are. Friendly, warm, comedic. Z seems to be having too much of a good time, even with the circumstances surrounding their presence.
THE WEAPONS EXPERT | Luca/Lucia Cruz: L doesn't know you much, and doesn't care to. Hyper-focused on the mission, L's disinterest in you is a breath of fresh air. You don't know what they did and how they got here, but you do know they were facing a life sentence. Still, things aren't always what they seem.
Maybe it won't stay that way.
#cog#cog wip#choice of games#interactive fiction#interactive fiction wip#interactive novel#interact-if#interactive game#if wip#dashingdon#dashing don#hosted games#intro post#wip
1K notes
·
View notes
Last Seen Blogs
angrysweetspatrol
제목 없음
crescent-dawn
Crescent Dawn
0125159385-blog
arief aziq
dobuhicetuxa
Untitled
stevonnie-otp
The Feels™