#asking-paradise
Text
[Happy 4 year anniversary! This year I decided to update the icon and header for the blog; the former of which is a simple redraw, and the latter I opted to collage some of the drawings from other the years together.]
#pokemon#pokemon mystery dungeon#pmd#pokemon ask blog#ooc#not plot#mod post#anniversary#4 years#LinnPikachu#MeekoOshawott#art#pikachu#oshawott#icon#asking-paradise#[Apologies for another quiet year#but we're gonna keep on keeping on the best we can here!#It's a Tuesday but if you're reading this feel free to send in a mod ask!]
23 notes
·
View notes
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
#hellsitegenetics#faq#intro post#flowers#plants#requests#birds of paradise#asks#remember to keep checking back!
1K notes
·
View notes
Text
violence made me gentle at last
#me: hoffstrahm phantom au that takes place in sawville or wherever the fuck and its like hoffman as erik and strahm as christine but not re#the black mold in my apartment:#coffinshipping#saw#mark hoffman#peter strahm#hoffstrahm#this looks so saturated here omfg#serious about doin that phatom au though like…#itd have to be like a modern interpretation like phantom of the paradise inthink#polachek lyric cuz … violence did rlly make him gentle at last (who ? who do you think.) (im asking you)#irls look away plz
1K notes
·
View notes
Photo
Once again I bring you some Eriks 😊
#The Phantom of the Opera#Phantom of the Opera#poto#phantom of the paradise#time princess#erik#yes I'm playing time princess just for him listen...#it is very cute#I also wanted to draw him with cat eyes because Leroux makes it sound like he has them with the perfect night vision and glow and color#and his whole little meow meow personality and Miette way of speaking it just feels correct#also that one cover#and Winslow because potp is great and I think hes neat#I may do another one of these just so I can draw Cherik because I miss him#I've been neglecting my asks!! I'm so sorry I'll get to them soon I just haven't been online much..like this whole year#so I'm falling behind and catching up gets increasingly more overwhelming#this past few months have been stressful I've been waiting on a lot of stuff to fall into place and I have no control over any of it#so I just draw Eriks#aaaaaa anyway enjoy#my art
5K notes
·
View notes
Text
saw this on my tl and oh op is so right
credits to @/melondenden on X
#I've been saying he's such an artist since I first read the book ??#like please give me an ounce of that creative streak my king I'm suffering here#and the way i call the cave of thousand gods his secret studio lmao#paradise manor was just him being bored and silly to the point he decided to do an interior designing project#and i want to take him with me to go jewellery shopping#and asking for styling and makeup tips#gosh WHY ISN'T HE A REAL PERSON ???#tgcf#heaven official's blessing#hua cheng#san lang#tian guan ci fu#mxtx
997 notes
·
View notes
Text
1K notes
·
View notes
Text
paradise
#SORRY.#SORRY SORRY SORRY SORRY#I WILL SAY. I DREW ALL THIS BACKGROUND & PERSPECTIVE W/O REFERENCE SOO. 😎😭#SORRY. SORRY.#I had such a specific image in my head & I had to draw it. god.#trigun#trigun 98#trigun 1998#trigun spoilers#< I GUESS? THIS SHOWS REAL OLD.#vash the stampede#nicholas d. wolfwood#wolfwood trigun#trigun wolfwood#vash#vash trigun#the humanoid typhoon#I Love Trigun 98 episode 23 Paradise. I'm Really Normal About It Too!!!#You Can Ask Me About It And I'll Give You My Normal and Rational Opinion On It
2K notes
·
View notes
Text
(to know more about the story and the calendar on pre-order check out previous posts!)
May time! May is time for friends. They take their group of friends to the lake - anyone who was free to go - and then those who couldn’t too. They can be very persistent together if they want to. They rent a small cottage and have a tent pulled up (Keith and Lance get kicked out to the tent on the first night, it’s a given). They spend time swimming, laughing, accidentally setting things on fire and Keith and Lance end up trying to one up each other in who can breakdance better on the grass (none of them, they just start flirting).
At the end of the day Hunk is the last one to tell them goodnight, but they would still sit around engrossed in each other, cooing like a newlywed couple.
Pidge walks out of the cottage to remind them to keep it quiet at night. Keith and Lance start laughing, until Shiro adds it’s not a suggestion. Then they laugh so hard, they end up dragging one another away from the house.
#klance#laith#ill be honest one of#my biggest issues with dance au is the fact they are in america and im not#and for me doing technical research absolutely cant compare to real life stories and experiences sometimes#and at times i consider dance au to be happening in united states of europe or something#just dont ask me where they are#paradise or something#but still when you start a violent fight you might get sued#which might be a big downside if you are keith kogane
634 notes
·
View notes
Note
think you could draw Winslow leach from phantom of the paradise? Pre phantom or as the phantom doesn’t matter, either is good, I just think he’d look good in your style
On my list of movies that I REALLY need 2 watxh!!!
On a long car trip, drop me some prompts for rly lazy character doodles
365 notes
·
View notes
Text
#MR FUCKIN PLANES HIMSELF FROM GTI!!!! OUR BEST FRIEND#emolga#i dunno if anyone is gonna get that reference but this one time i saw like. a paradise crew askblog on here randomly and the post i happene#to see was someone asking emolga what thing he thought was coolest to hear about from the human world. and he said like#fuckin planes dude how do they work#and i thought that was the most emolga quote ever and i loved it. and it's been bouncing around in my head ever since even though#i don't even know who wrote it. i dunno the askblog or if it even exists anymore#but either way. this is still like the only pmd character with a canon blush sprite besides watchog i think from psmd#everyone knows he eventually rejects virizion for dunsparce. his very obvious crush on dunsparce throughout the whole game#i have so many thoughts about gti it really is the best pmd game. in some senses. gti and also eotds and also smd are all my favorite pmds#that's three out of four of them and no i am not cheating
178 notes
·
View notes
Note
Linn, what happened to the frism that carried the voices of your friends as Hydreigon took you back to the human world? Were you able to take it with you?
Well it... Huh, I guess I hadn't really thought about it, but it never did make it back with me, even though my bandana made the trip. That would make it the only object that wasn't successfully taken between the human world and the pokemon one. Wonder why that is...
As mysterious as that is though... I don't think I'll linger on that for too long unless it happens again; I don't really want to have to listen back on... such a sad time; they really wanted to leave me with a happy last message, but it'll always be bittersweet.
#pokemon#pokemon mystery dungeon#pmd#pokemon ask blog#ic#not plot#answered#LinnPikachu#pikachu#decocloudico#asking-paradise
14 notes
·
View notes
Note
Is there any reason for the Bird of Paradise flower specifically (at the end of your pinned post), or do you just really like the flower?
i just think it's particularly silly.
176 notes
·
View notes
Photo
louis forgetting the lyrics for paradise lol | faith in the future world tour in lisbon, portugal 10.03.23
#louis#louis tomlinson#*gifs#*mine#hlcreators#hljournal#tomlinsonedits#hldaily#hledit#faith in the future world tour#flashing tw#fitf world tour#louis gifs#fitfwt lisbon#i am once again asking can he pls upload paradise on music streaming platforms now#he's so dhhsjhd#cute cute niya hay#sunshine#idiot (affectionate)
236 notes
·
View notes
Note
He’s so cute! www…x…com/roxx_rxn/status/1710459868237173114?s=46&t=FOz_MGX-u21IDTPZhgsQFg
Aaaaahh!!! 😆 I love it when he’s so goofy.
177 notes
·
View notes
Text
Btw it's so funny how Nagi keeps wondering what motivates other blue lockers to keep going and then he asks this very candid question to two of the most unhinged and soccer-obsessed freaks in there. Like, baby I don't know how to break it to you but the answer you're looking for is insanity. It's not you it's them. Your tragic flaw is that you don't share everyone else's obsession with destroying people's lives with a soccer ball fhdjhdhdid
#Thyandra.txt#Ok but jokes aside on a character growth level it's interesting that he IS asking this question#The last time he experienced this curiosity & frustration he joined Isagi's team#Trouble in paradise theory intensifies#Blue lock
120 notes
·
View notes
Note
I get the mask but... Was the cunty black lipstick necessary? I mean, not that I'm complaining, you'd get all the hoes nowadays (im hoes)
"You loose something sometimes you've got a choice. You can either grieve it, and that's temporary or you get the chance to celebrate something new. Nobody was going to recognise me either way. 'Winslow Leach' was dead to the world. I was 'dead' and I'd never even gotten the chance to be my whole self. So what was I to do? I had nothing left to loose? I felt I owed it to myself to really figure out whoever 'Winslow Leach' was really meant to be."
#phantom of the paradise#winslow leach#podp#((cunty art for a cunty ask))#((Poor Yorick I knew him well))
54 notes
·
View notes
Last Seen Blogs
kookooblog
2010s aesthetics
babygee21
Untitled
huntercompany192
Untitled
schizophrenicfordpinesmoved
eagerly honks my clown nose at you